Multiplex PCR primer pair combination for detecting Flavobacterium psychrophilum and its application

Abstract

The present invention discloses a multiplex PCR primer pair combination for detecting psychrophilic Flavobacterium and its application, and relates to the technical field of molecular biology. The present invention first obtains the whole genome sequence of psychrophilic Flavobacterium by high-throughput sequencing technology, compares the whole genome sequence one by one in the NCBI database, finds specific sequences that are completely mismatched with other genomes, designs specific primers according to the specific sequences, and finally screens out primers with high specificity through the specificity of other strain detection primers. Afterwards, a multiplex PCR primer pair combination of psychrophilic Flavobacterium was designed and used for multiplex PCR detection. The results show that the multiplex PCR primer pair combination designed and screened by the present invention has a good amplification effect for detecting the target psychrophilic Flavobacterium, and the detection of psychrophilic Flavobacterium by using it has significant specificity and high detection sensitivity.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, in particular to a multiplex PCR primer pair combination for detecting Flavobacterium psychrophilum and an application thereof. Background Art

[0002] Flavobacterium psychrophilum belongs to the genus Flavobacterium in the phylum Bacteroidetes. It is a low-temperature pathogen that is usually cultured and proliferated at 4-23°C, with 15-18°C as the optimal growth temperature.

[0003] With the development of molecular biology techniques, PCR has been widely used in the rapid detection of pathogens. Multiplex PCR (PCR) technology builds on conventional PCR by combining multiple primer pairs and optimizing reaction conditions to detect a single bacterium. This significantly improves detection efficiency and accuracy while retaining the high sensitivity and specificity of conventional PCR. This present invention proposes the development of multiple specific primers and a multiplex PCR detection method for Flavobacterium psychrophilum to enhance the specificity, sensitivity, and accuracy of Flavobacterium psychrophilum detection. Summary of the Invention

[0004] The purpose of the present invention is to provide a multiplex PCR primer pair combination for detecting psychrophilic bacterium and its application, so as to solve the problems existing in the above-mentioned prior art and improve the specificity, sensitivity and accuracy of psychrophilic bacterium detection.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a specific PCR primer pair for detecting Flavobacterium psychrophilum, wherein the specific PCR primer pair is FP88-F / R, FP995-F / R, FP1024-F / R, FP90-F / R, 2FP90-F / R or 2FP1022-F / R;

[0007] The FP88-F / R comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.2;

[0008] The FP995-F / R comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.4;

[0009] The FP1024-F / R comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.6;

[0010] The FP90-F / R comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO.7 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.8;

[0011] The 2FP90-F / R comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO.9 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.10;

[0012] The 2FP1022-F / R comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO.11 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.12.

[0013] The present invention also provides a multiplex PCR primer pair combination for detecting Flavobacterium psychrophilum, wherein the multiplex PCR primer pair combination is combination ①, combination ⑥ or combination ⑪;

[0014] The combination ① includes primer pairs FP88-F / R, FP995-F / R and FP1024-F / R;

[0015] The combination ⑥ includes primer pairs FP90-F / R, FP995-F / R and FP1024-F / R;

[0016] The combination (10) includes primer pairs 2FP90-F / R, FP1024-F / R and 2FP1022-F / R;

[0017] The FP88-F / R comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.2;

[0018] The FP995-F / R comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.4;

[0019] The FP1024-F / R comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.6;

[0020] The FP90-F / R comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO.7 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.8;

[0021] The 2FP90-F / R comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO.9 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.10;

[0022] The 2FP1022-F / R comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO.11 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.12.

[0023] The present invention also provides use of the specific PCR primer pair in preparing a PCR detection kit for Flavobacterium psychrophilum.

[0024] The present invention also provides use of the multiplex PCR primer pair combination in preparing a multiplex PCR detection kit for Flavobacterium psychrophilum.

[0025] The present invention also provides a PCR detection kit for Flavobacterium psychrophilum, comprising the above-mentioned specific PCR primer pair.

[0026] The present invention also provides a multiplex PCR detection kit for Flavobacterium psychrophilum, comprising the multiplex PCR primer pair combination.

[0027] The present invention also provides a PCR method for detecting psychrophilic Flavobacterium for non-disease diagnosis purposes, comprising the following steps:

[0028] Extracting genomic DNA of the sample to be tested;

[0029] Using the genomic DNA as a template, PCR amplification is performed using the above-mentioned specific PCR primer pair to obtain an amplified product, and then electrophoresis is performed for detection;

[0030] Determine whether the sample to be tested contains psychrophilic bacterium according to the electrophoresis test result:

[0031] When the FP88-F / R is used for PCR amplification, if a 172 bp electrophoresis band is detected, it is determined that the sample to be tested contains psychrophilic bacterium;

[0032] When the FP995-F / R is used for PCR amplification, if a 325 bp electrophoresis band is detected, it is determined that the sample to be tested contains psychrophilic bacterium;

[0033] When PCR amplification is performed using the FP1024-F / R, if a 610 bp electrophoresis band is detected, it is determined that the sample to be tested contains psychrophilic bacterium;

[0034] When the FP90-F / R is used for PCR amplification, if a 197 bp electrophoresis band is detected, it is determined that the sample to be tested contains psychrophilic bacterium;

[0035] When the 2FP90-F / R is used for PCR amplification, if a 470 bp electrophoresis band is detected, it is determined that the sample to be tested contains psychrophilic bacterium;

[0036] When the 2FP1022-F / R is used for PCR amplification, if a 914 bp electrophoresis band is detected, it is determined that the sample to be tested contains psychrophilic Flavobacterium.

[0037] Furthermore, the reaction system of the PCR amplification is: 1 μL each of upstream and downstream primers, 10 μL of 2×Taq Plus PCR Master Mix, 2 μL of DNA template and 6 μL of ddH2O;

[0038] The amplification conditions of the PCR amplification were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 90 s, 35 cycles of amplification; and extension at 72°C for 10 min.

[0039] The present invention also provides a multiplex PCR method for detecting psychrophilic Flavobacterium for non-disease diagnosis purposes, comprising the following steps:

[0040] Extracting genomic DNA of the sample to be tested;

[0041] Using the genomic DNA as a template, multiplex PCR amplification is performed using the above-mentioned multiplex PCR primer pair combination to obtain amplified products, and then performing electrophoresis detection;

[0042] Determine whether the sample to be tested contains psychrophilic bacterium according to the electrophoresis test result:

[0043] When the combination ① is used for multiplex PCR amplification, if three electrophoretic bands of 172 bp, 325 bp, and 610 bp appear, it is determined that the sample to be tested contains psychrophilic bacterium;

[0044] When the combination ⑥ is used for multiplex PCR amplification, if three electrophoretic bands of 197 bp, 325 bp, and 610 bp appear, it is determined that the sample to be tested contains psychrophilic bacterium;

[0045] When the combination ⑪ is used for multiplex PCR amplification, if three electrophoretic bands of 470 bp, 610 bp and 914 bp appear, it is determined that the sample to be tested contains psychrophilic bacterium.

[0046] Furthermore, when the combination ① is used for multiplex PCR amplification, the reaction system of the multiplex PCR amplification is: 10 μL of 2×Taq Plus PCR Master Mix, 3 μL of a primer pair combination with a volume ratio of FP88-F / R:FP995-F / R:FP1024-F / R=1:1:3, 2 μL of DNA template, and ddH2O is added to make up to 20 μL; the reaction procedure of the multiplex PCR amplification is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 90 s, and 35 cycles of amplification; extension at 72°C for 10 min;

[0047] When the combination ⑥ is used for multiplex PCR amplification, the reaction system of the multiplex PCR amplification is: 10 μL of 2×TaqPlus PCR Master Mix, 3 μL of a primer pair combination with a volume ratio of FP90-F / R:FP995-F / R:FP1024-F / R=2:1:2, 2 μL of DNA template, and ddH2O is added to make up to 20 μL; the reaction procedure of the multiplex PCR amplification is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 90 s, and 35 cycles of amplification; extension at 72°C for 10 min;

[0048] When the combination ⑪ is used for multiplex PCR amplification, the reaction system for the multiplex PCR amplification is: 10 μL of 2×TaqPlus PCR Master Mix, 3 μL of a primer pair combination with a volume ratio of 2FP90-F / R:FP1024-F / R:2FP1022-F / R=3:1:3, 2 μL of a DNA template, and ddH2O is added to make up to 20 μL; the reaction procedure for the multiplex PCR amplification is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 90 s, 35 cycles of amplification, and extension at 72°C for 10 min.

[0049] The present invention discloses the following technical effects:

[0050] The present invention first obtains the full genome sequence of Psychrophilus spp. using high-throughput sequencing technology. The full genome sequence is then compared one by one in the NCBI database to identify specific sequences that do not match any other genome sequences. Specific primers are then designed based on the specific sequences. The specificity of the primers is then tested against other strains to ultimately screen for primers with high specificity. Subsequently, a multiplex PCR primer pair combination for Psychrophilus spp. was designed and used for multiplex PCR detection. The results showed that the multiplex PCR primer pair combination designed and screened by the present invention has good amplification effects for detecting the target Psychrophilus spp., and its use in detection of Psychrophilus spp. has significant specificity and high detection sensitivity. The primer pair combination FP88-F / R, FP995-F / R, and FP1024-F / R could detect mixed samples as low as 3 pg / μL; the primer pair combination FP90-F / R, FP995-F / R, and FP1024-F / R could detect mixed samples as low as 6 pg / μL; and the primer pair combination 2FP90-F / R, FP1024-F / R, and 2FP1022-F / R could detect mixed samples as low as 12 pg / μL.

[0051] For fish body detection, the kit of the present invention has good application value, provides new technical support for the rapid detection of psychrophilic bacterium, and can help prevent and control bacterial cold water disease in fish. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0053] Figure 1 The results of amplifying Flavobacterium psychrophilum using 6 pairs of primers, including: 1: Marker; 2: Primer FP88-F / R; 3: Primer FP90-F / R; 4: Primer 2FP90-F / R; 5: Primer FP995-F / R; 6: Primer 2FP1022-F / R; 7: Primer FP1024-F / R; 8: Primer 27-F / 1492-R;

[0054] Figure 2The results of primer specificity detection in Example 2 are shown; A to F are gel images obtained by amplifying primers for Vibrio parahaemolyticus, Exiguobacterium acetylicum, Shewanella putrefaciens, Aeromonas hydrophila, Plesiomonas shigelloides, and Bacillus polymyxa, respectively; in A to F, 1: Marker; 2: Primer FP88-F / R; 3: Primer FP90-F / R; 4: Primer 2FP90-F / R; 5: Primer FP995-F / R; 6: Primer 2FP1022-F / R; 7: Primer FP1024-F / R; 8: Primer 27-F / 1492-R;

[0055] Figure 3 This is the electrophoresis diagram for screening multiplex PCR primer combinations; where 1: Marker; 2-12: combinations ①-⑪;

[0056] Figure 4 Electrophoresis diagram for optimizing the concentration ratio of multiplex PCR primers; 1: Marker; 2: Combination ①; 3: Combination ⑥; 4: Combination ⑪;

[0057] Figure 5 Figure 2 is the sensitivity electrophoresis diagram of multiplex PCR; A to C correspond to combination ①, combination ⑥, and combination ⑪, respectively; in A, M: DNA Marker; 1-15 are the DNA concentrations of psychrophilic bacterium 120 ng / μL, 24 ng / μL, 12 ng / μL, 2.4 ng / μL, 1.2 ng / μL, 240 pg / μL, 120 pg / μL, 24 pg / μL, 12 pg / μL, 6 pg / μL, 3 pg / μL, 1.5 pg / μL, 0.8 pg / μL, 0.4 pg / μL, and 0.2 pg / μL, respectively; in B, M: DNA Marker; 1-15 are the DNA concentrations of psychrophilic bacterium 120 ng / μL, 24 ng / μL, 12 ng / μL, 2.4 ng / μL, 1.2 ng / μL, 240 pg / μL, 120 pg / μL, 24 pg / μL, 12 pg / μL, 6 pg / μL, 3 pg / μL, 1.5 pg / μL, 0.8 pg / μL, 0.4 pg / μL, 0.2 pg / μL; in C, M: DNAMarker; 1-15 are the DNA concentrations of psychrophilic bacterium 120 ng / μL, 24 ng / μL, 12 ng / μL, 2.4 ng / μL, 1.2 ng / μL, 240 pg / μL, 120 pg / μL, 24 pg / μL, 12 pg / μL, 6 pg / μL, 3 pg / μL, 1.5 pg / μL, 0.8 pg / μL, 0.4 pg / μL, 0.2 pg / μL, respectively. DETAILED DESCRIPTION

[0058] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0059] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0060] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0061] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0062] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0063] Example 1 Primer specificity design

[0064] The complete genome sequence of Flavobacterium psychrophilum was obtained using high-throughput sequencing. The whole genome sequence was uploaded to the NCBI database for alignment, and specific sequences (100–1000 bp) that did not match any other sequences in the database were screened. Primer sequences were designed using Primer Premier 5 software, and primer specificity was analyzed using the NCBI database. Six primer pairs were designed, designated FP88-F / R, FP995-F / R, FP1024-F / R, FP90-F / R, 2FP90-F / R, and 2FP1022-F / R. Primer information and product fragments are shown in Table 1.

[0065] Table 1 Information of 6 primer pairs and product fragments

[0066] Primer pair Sequence Amplified product size Product fragment FP88-F / R F: TCACAACGCTGCAAATT (SEQ ID NO.1) R: TTGCTTGTAACCCAGTAATC (SEQ ID NO.2) 172 bp <![CDATA[ TTGCTTGTAACCCAGTAATC CTAAATTCTTATCTTGAAATTGAAGTTTAACATCTTTAAATAACGGACTATCGAATCTTACATCAGGATTCATTATACAAATTATTTTAGAATTACAGTTGTCTATTCCTACATTGTTACCTTGTCCGTATCCTA AATTTGCAGCGTTGTGA (SEQ ID NO.13)]]> FP995-F / R F: TGGGCTAATAGTGAAGTGAG (SEQ ID NO.3) R: GAATAATTTGTCCTGTCGGT (SEQ ID NO.4) 325 bp <![CDATA[ TGGGCTAATAGTGAAGTGAG TGAAAAAATCCCACAATTTGGTCGTTTTCTTGTGTTGAAATCTTTGTTTGACATTGCAAGATCGACAGAAGATAACATTTCGATGGCAGTAGACTTTGACGAAGACATCGAAGATAAATTTGAAGAAATAAAAGAAAAAGTTGGACAAGAAAAACTATTTGACTTTTTGAAATCATATTCAAAAGGTATGATTTACAATATAATCGGATTATTAGACGAAGGAAACCTAGAAGTTGACCGTGACAAAATTAGTTGGGCACTTTTGAAAACTGACGATAATTTTGA ACCGACAGGACAAA TTATTC (SEQ ID NO.14)<!-- 5 --> ]]> FP1024-F / R F: CACTTCTTTGAATGGGCTTTTG (SEQ ID NO.5) R: TGCTTTACTTTGTGGGTCTC (SEQ ID NO.6) 610 bp <![CDATA[ CACTTCTTTGAATGGGCTTTTG ACTAATTTAAATACCGATTTAGGTTTACTAATTAATCGAAAGTTTGTATTTGGATCTTATGACCGTGACACTATTTTGCCAAGGAAATATGACTCAAAATCCGATATTGATGTTATGGTAGTATTTAATCATACACAATATGAAAGAACTCCAGAAACTTATAGAGCTTGGCTTAATTATTTGCAGACAAATACTACAAGAACAGATACGGGTCAGAAGTTGTAAAATCATTTCCAACTGTAACCATTAGATTAGGTCATATTTATTTTGACCTTGTTCCAGC AAAAGAAGAAATAACATTTTATAACTCTACTCTATCAATTCCAGGAGATTATGGTTGGAGAACTACTGACCCTAATGATGTTAAACAAAAACTAACTGAAGCTAATACTAAATACAATCAAGTAGTTAGACCGATAATAAGACTAATGAAGGCTTGGAATTGTCACAATGGCTTTCCATATGATTCATACTTGTTAGAGCTTCAAATAACAGGGATGAACTTTTTTGGAGACAACGTTGAAACAGGTTTTTTTTACGCAGTCGGACAATTAAATACAACTTGGG GAGACCCACAAAGTAAAGCA (SEQ ID NO.15)]]> FP90-F / R F: AAAGAGTATGGGATAATGGG (SEQ ID NO.7) R: TGTGCAATAGAAGGTGATGT (SEQ ID NO.8) 197 bp AAAGAGTATGGGATAATGGGAATTATAATTGTTATAATTGCTTTAGGAATGCTTTTTTCTGAAAGTGGTTTTACCAACGCATTAATAAATAAAAAAGATCGTAACGATTTAGATTATAATACCTCATTTTATTCTAATGTTGGTATTTCAGTACTTATTTATATTTTGCTGTTTTTTACATCACCTTCTATTGCACA (SEQ ID NO.16) 2FP90-F / R F: TTTGGAGTTTGGGCGTTAG (SEQ ID NO.9) R: GGAATCATTTCGCTCCATTT (SEQ ID NO.10) 470 bp <![CDATA[ TTTGGAGTTTGGGCGTTAG TTACACAATCTTTTGCATTAAATTTTTTTAGTTTACTATTATATTATAAATATGTAAAGTGGAGACCAAAATTAGAATATTCAATTGCATCGTTTACCTATTTGTTTAATTTTAGCTCTAAAATTTTAGTGGCAGGGATTTTGCAAAATCTATATATGTATAGCTATAATTTTTTTATTGGAAAAGGAATTTCTACACAATCGTTAGGAATTTTTAGTAAATCAAATCAGTTTACACAAATGCCAGTTTCGCTATTAAGCACAACATTGCAAAGAGTTTTTTATCCTTTTGTATCAAATTTTCAAGACAATGATATTAAAATATTCAATGTTTCAATCAATTTCACACAACTAATAATTGCATTTTTCTTTCCTTTTATGGTCATAATTGCAACGGTTTCAGAGCCTTTTGTTATGTTGTTCTTAGGTGAA AAATGGAGCGAAAT GATTCC (SEQ ID NO.17)<!-- 7 --> ]]> 2FP1022-F / R F: AATGGGTTCCGTATCAAGA (SEQ ID NO.11) R: TTATGCGTTCGGCTTTA (SEQ ID NO.12) 914 bp <![CDATA[ AATGGGTTCCGTATCAAGA TTTAGAAGACTTCAAACCAAAAATTGAAGAGATTGAAGTTGAATCTAATCAAGTACAAAATAAAAAGAAATTAAACATAACCAACTTTCTAGTTTTGTTATTCCTTATCCTTTCAGCTTCAGGAATTGCCTATTTTTTAACTGAAGAACACAAAAAGAGAGATTTTCAAAAACTAGAGGAAAGAGTTAATGATATATTTGCTGGTAAAGACGAAATTTGTGATTATACAAAGTCAGGTGTAAAAGGGGAATTAAAAAAGCCAAGTGATTTTTTTCTTTCCAGTAAAAAAGATAATGAAGACAACGAACTTTATGAATACTATTCTTGTGAATCAGGTGGTTGGACTGTATACACTTTGAAAAAATTAAATTATGGTTACGATTTAATTGAAAGTTCTTCCACAAATATGGGATTTAAAGTGCCCGAATCTACATATCGA GCAGGAACTGACTTTGGCTATGGTTATAGTACACCTGGATATTCAATTCCAACTTATCGAGGTTCTGTCCAAAATGCATACAATGAAGCAATGGAATACATATCTGTTGAAAAAGAGGACAAGTCATATGTTGCTGGCTCATATAACAGAATAATAACCTTTGACGAATTATATAGTGACTTGCATTATATTGACAATATTCATCCAACAAAATATACAAGTGCTTCCGTAAATTCAAAATCTTGGGAGAATTTAGGAGAAGCTTATGTATTTAATAAAAATTGGATTGTTTGGTACAAACAAAGTGGAAAGCATTATGAAATTGTACTTGACAAAGATGAATATCTAAAAAAATTACTTGTCAATTTAGGAATTGGAATTGTTACCGCAATTTTAGCTTTCCTGCTTTGGAAATACAGCTTAAAAAACAGAATAAATA TA AAGCCGAACGCATAA (SEQ ID NO.18)]]>

[0067] The genome of Flavobacterium psychrophilum was amplified by PCR using 6 pairs of primers, and clear bands of different sizes were obtained, such as Figure 1 shown.

[0068] PCR amplification used a 20 μL reaction system: 1 μL of each upstream and downstream primer (concentration of 5 nmol) was added to a PCR reaction tube, followed by 10 μL of 2× Taq Plus PCR Master Mix, 2 μL of DNA template, and 6 μL of ddH2O.

[0069] PCR amplification conditions were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 90 s, 35 cycles of amplification, and extension at 72°C for 10 min.

[0070] Example 2 Primer specificity detection

[0071] PCR amplification was performed on the DNA templates of the test strains using the primers designed in Example 1, and universal primers 27-F / 1492-R were used as positive controls. The specific operation was as follows:

[0072] (1) Preparation of DNA template: There are 6 test strains, namely: Vibrio Parahaemolyticus, Exiguobacterium acetylicum, Shewanella putrefaciens, Aeromonas hydrophila, Plesiomonas shigelloides, and Paenibacillus polymyxa.

[0073] Method for extracting DNA templates of each strain: take 1 mL of bacterial solution and centrifuge it in a high-speed refrigerated centrifuge at 12000 rpm, 1 min, 4°C, discard the supernatant until the remaining 200 μL, resuspend the bacterial solution, and extract the bacterial solution DNA (TIANGEN DNA Extraction Kit).

[0074] (2) PCR system

[0075] A 20 μL reaction system was used: 1 μL of each upstream and downstream primer (both at a concentration of 5 nmol) was added to a PCR reaction tube, followed by 10 μL of 2×Taq Plus PCR Master Mix, 2 μL of DNA template, and 6 μL of ddH2O.

[0076] PCR amplification conditions were as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 90 s, 35 cycles of amplification, and extension at 72°C for 10 min.

[0077] (3) Determination of test results

[0078] Prepare a 1.5% agarose gel plate with TBE electrophoresis buffer and place it in a horizontal electrophoresis tank so that the electrophoresis buffer covers the gel surface. Take 4 μL of PCR product and add it to the sample well. Run the gel at 120 V and 200 A for 30 min, then place it on a gel imager to view the results.

[0079] The test results of each strain are as follows Figure 2 The results showed that lane 8 (primers 27-F / 1492-R) of each pathogen showed fluorescence, while no fluorescence appeared in other lanes, indicating that primers FP88-F / R, FP90-F / R, 2FP90-F / R, FP995-F / R, 2FP1022-F / R, and FP1024-F / R had no reaction to the above pathogens.

[0080] Example 3 Multiplex PCR detection of Flavobacterium psychrophilum using primer pair combinations

[0081] In order to obtain primer pair combinations for multiplex PCR detection of psychrophilic Flavobacterium, it is necessary to screen out psychrophilic Flavobacterium-specific gene fragments with similar PCR reaction procedures and different PCR product lengths as candidate detection target fragments for multiplex PCR.

[0082] According to the PCR reaction procedure and the length of the PCR product, the following 11 primer pairs can be established:

[0083] Combination ①: FP88-F / R (172 bp), FP995-F / R (325 bp), and FP1024-F / R (610 bp);

[0084] Combination ②: FP88-F / R (172 bp), FP995-F / R (325 bp), and 2FP90-F / R (470 bp);

[0085] Combination ③: FP88-F / R (172 bp), FP995-F / R (325 bp), and 2FP1022-F / R (914 bp);

[0086] Combination ④: FP88-F / R (172 bp), 2FP90-F / R (470 bp), and 2FP1022-F / R (914 bp);

[0087] Combination ⑤: FP88-F / R (172 bp), FP1024-F / R (610 bp), and 2FP1022-F / R (914 bp);

[0088] Combination ⑥: FP90-F / R (197 bp), FP995-F / R (325 bp), and FP1024-F / R (610 bp);

[0089] Combination ⑦: FP90-F / R (197 bp), FP995-F / R (325 bp), and 2FP90-F / R (470 bp);

[0090] Combination ⑧: FP90-F / R (197 bp), FP995-F / R (325 bp), and 2FP1022-F / R (914 bp);

[0091] Combination ⑨: FP90-F / R (197 bp), 2FP90-F / R (470 bp), and 2FP1022-F / R (914 bp);

[0092] Combination ⑩: FP90-F / R (197 bp), FP1024-F / R (610 bp), and 2FP1022-F / R (914 bp);

[0093] Combination ⑪: 2FP90-F / R (470 bp), FP1024-F / R (610 bp), and 2FP1022-F / R (914 bp).

[0094] Several sets of multiplex PCR candidate primer pairs with good amplification effects were selected, and a 20 μL PCR reaction system was set up: 10 μL of 2×Taq Plus PCR Master Mix, 3 μL of total primers (so that the volume ratio of primer pair 1: primer pair 2: primer pair 3 was 1:1:1, and the concentration of each primer was 5 nmol), 2 μL of psychrophilic Flavobacterium DNA template, and ddH2O was added to make up to 20 μL.

[0095] The multiplex PCR reaction program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 90 s, 35 cycles of amplification, and extension at 72°C for 10 min.

[0096] After the PCR reaction, agarose gel electrophoresis was performed and the results were shown in Figure 3 Whether the target DNA fragment of Flavobacterium psychrophilum is contained is determined by whether a clear fluorescent band appears on the PCR electrophoresis graph.

[0097] The results showed that only the three target fragments, combination ①, combination ⑥ and combination ⑪, could detect obvious bands.

[0098] Optimize the primer ratio for multiplex PCR of combination ①:

[0099] A 20 μL PCR reaction system was set up: 10 μL of 2×Taq Plus PCR Master Mix, 3 μL of a primer pair combination of FP88-F / R:FP995-F / R:FP1024-F / R = 1:1:3 (volume ratio) (each primer concentration was 5 nmol), 2 μL of the psychrophilic Flavobacterium DNA template, and ddH2O was added to make up to 20 μL. The multiplex PCR reaction program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 90 s, 35 cycles of amplification, and extension at 72°C for 10 min. Results ( Figure 4 Lane 2 in the middle shows that all three target gene fragments have clear bands, and the brightness of the three bands is slightly different.

[0100] Optimize the primer ratio for multiplex PCR of combination ⑥:

[0101] A 20 μL PCR reaction system was set up: 10 μL of 2×Taq Plus PCR Master Mix, 3 μL of a primer pair combination of FP90-F / R:FP995-F / R:FP1024-F / R = 2:1:2 (volume ratio) (each primer concentration was 5 nmol), 2 μL of the psychrophilic Flavobacterium DNA template, and ddH2O was added to make up to 20 μL. The multiplex PCR reaction program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 90 s, 35 cycles of amplification, and extension at 72°C for 10 min. Results ( Figure 4 Lane 3 in the middle shows that all three target gene fragments have clear bands, and the brightness difference of the three bands is relatively small.

[0102] Optimize the primer ratio for multiplex PCR of combination ⑪:

[0103] A 20 μL PCR reaction system was set up: 10 μL of 2×Taq Plus PCR Master Mix, 3 μL of a primer pair combination of 2FP90-F / R: FP1024-F / R: 2FP1022-F / R = 3:1:3 (each primer concentration was 5 nmol), 2 μL of the psychrophilic Flavobacterium DNA template, and ddH2O was added to make up to 20 μL. The multiplex PCR reaction program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 90 s, 35 cycles of amplification, and extension at 72°C for 10 min. Results ( Figure 4 Lane 4 in the middle shows that all three target gene fragments have clear bands, and the brightness difference of the three bands is relatively small.

[0104] Example 4 Sensitivity Experiment

[0105] In order to determine the detection sensitivity of the multiplex PCR in Example 3, the extracted DNA of Flavobacterium psychrophilum was diluted in equal proportions according to the optimized multiplex PCR reaction conditions and procedures to form 15 concentration gradients, and the sensitivity of the multiplex PCR was tested.

[0106] The sensitivity of the combination ① (FP88-F / R, FP995-F / R and FP1024-F / R) was tested by multiple PCR. Figure 5 In Figure A, the results show that three target bands can still be amplified simultaneously when the DNA template amount of Psychrophilus is 3 pg / μL, and the band fragment sizes are consistent with expectations. This indicates that the sensitivity of the multiplex PCR detection method for Psychrophilus established in the present invention can reach 3 pg / μL.

[0107] Multiplex PCR sensitivity testing was performed on combination ⑥ (FP90-F / R, FP995-F / R, and FP1024-F / R). The results are shown in Figure 5 In Figure B, the results show that three target bands can be simultaneously amplified even with a DNA template amount of 6 pg / μL for Flavobacterium psychrophilum, and the band sizes are consistent with expectations. This indicates that the sensitivity of the established Flavobacterium psychrophilum multiplex PCR can reach 6 pg / μL.

[0108] Multiplex PCR sensitivity testing was performed on combination ⑪ (2FP90-F / R, FP1024-F / R, and 2FP1022-F / R). Figure 5 In Figure C, the results show that three target bands can be simultaneously amplified even with a DNA template amount of 12 pg / μL. The band sizes are consistent with expectations, indicating that the sensitivity of the established multiplex PCR for psychrophilic F. psychrophilicus can reach 12 pg / μL.

[0109] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A method for detecting psychrophilic Flavobacterium ( Flavobacterium psychrophilum ) is a multiplex PCR primer pair combination, characterized in that, The multiplex PCR primer pair combination is combination ①; The combination ① is the primer pair FP88-F / R, FP995-F / R and FP1024-F / R; The FP88-F / R is composed of an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.2; The FP995-F / R is composed of an upstream primer having a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.4; The FP1024-F / R consists of an upstream primer with a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.

6.

2. Use of the multiplex PCR primer pair combination as claimed in claim 1 in preparing a multiplex PCR detection kit for Flavobacterium psychrophilum.

3. A multiplex PCR detection kit for Flavobacterium psychrophilum, characterized in that: The method comprises the multiplex PCR primer pair combination according to claim 1.

4. A multiplex PCR method for detecting Flavobacterium psychrophilum for non-disease diagnosis purposes, characterized in that: The following steps are involved: Extracting genomic DNA of the sample to be tested; Using the genomic DNA as a template, performing multiplex PCR amplification using the multiplex PCR primer pair combination of claim 1 to obtain amplified products, and performing electrophoresis detection; Determine whether the sample to be tested contains psychrophilic Flavobacterium according to the electrophoresis test result: If three electrophoresis bands of 172 bp, 325 bp and 610 bp appear, it is determined that the sample to be tested contains psychrophilic Flavobacterium.

5. The multiplex PCR method according to claim 4, characterized in that: The reaction system of the multiplex PCR amplification is: 10 μL of 2×Taq Plus PCR Master Mix, 3 μL of a primer pair combination with a volume ratio of FP88-F / R:FP995-F / R:FP1024-F / R=1:1:3, 2 μL of a DNA template, and ddH2O is added to make up to 20 μL; the reaction procedure of the multiplex PCR amplification is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 90 s, and 35 cycles of amplification; extension at 72°C for 10 min.

Images