Decarboxycarnosine composite liposome and application thereof in preparation of products for reducing uric acid and dissolving tophus

Abstract

The invention relates to the field of biological medicine, in particular to a decarboxylated carnosine composite liposome and application thereof in preparation of products for reducing uric acid and dissolving tophus. The decarboxylated carnosine composite liposome is formed by self-assembling raw materials including decarboxylated carnosine, alkaloid, flavone, a polygonum cuspidatum extract, p-coumaric acid, a liquorice extract, a semen coicis extract, a yam rhizome extract, a poria cocos extract and quercetin, and research proves that the decarboxylated carnosine composite liposome can reduce uric acid, dissolve ventilation stone and balance in-vivo acid-base balance; the composition inhibits xanthine oxidase from synthesizing uric acid, promotes uric acid excretion and intestinal tract movement in the body, repairs damaged liver and kidney cells, diminishes swelling, resists inflammation, relieves pain, prevents and treats hyperuricemia, relieves gout inflammation, reduces blood pressure and improves immunity.

Description

Technical Field

[0001] The invention relates to the field of biomedicine, and in particular to a decarboxylated carnosine composite liposome and application thereof in preparing a product for reducing uric acid and dissolving tophi. Background Art

[0002] Hyperuricemia (HUA) refers to a disease caused by purine metabolism disorder that causes blood uric acid concentration to exceed normal values. It is also a common metabolic disease in clinical practice. Clinically, HUA is diagnosed when male blood uric acid is >420μmol / L and female blood uric acid is >360μmol / L. Excessive blood uric acid levels directly or indirectly lead to diseases such as gouty arthritis, uric acid nephropathy and kidney disease. At the same time, high uric acid is also a risk factor for diseases such as coronary heart disease and diabetes. More and more studies have shown that HUA is closely related to diseases such as hypertension and hyperlipidemia, and can increase the risk of total mortality, all-cause cardiovascular disease mortality and cardiovascular events in patients with hypertension. High uric acid can also further aggravate atherosclerosis, promote the occurrence and development of cardiovascular and cerebrovascular diseases, and induce and aggravate kidney damage.

[0003] The causes of hyperuricemia are complex, mainly due to purine metabolism disorders and abnormal uric acid excretion, which lead to continuous increase in uric acid. It is associated with dietary habits, genetic factors and immune system factors. In recent years, HUA patients have become younger and the incidence has increased year by year. At present, hyperuricemia has become the fourth highest disease after hypertension, hyperlipidemia and hyperglycemia. At present, drugs used in clinical treatment of hyperuricemia can be roughly divided into three categories: (1) drugs that inhibit uric acid production, such as allopurinol, febuxostat and topiroxostat; (2) drugs that promote uric acid excretion, such as probenecid, sulfinpyrazone and benzbromarone; (3) drugs that relieve joint inflammation caused by urate deposition, such as non-steroidal anti-inflammatory drugs such as indomethacin and colchicine.

[0004] Although these drugs have a certain effect on the treatment of hyperuricemia, their adverse reactions seriously limit their application. Allopurinol, the first-line drug for gout patients, can cause common gastrointestinal adverse reactions and even serious skin adverse reactions. Its clinical use is currently subject to certain restrictions; while febuxostat is limited to patients with renal insufficiency, and it can also increase the incidence of cardiovascular disease; and the side effects of benzbromarone include liver damage. Therefore, the development of highly effective uric acid-lowering drugs with few side effects and low toxicity is of great significance and application value. Summary of the invention

[0005] Based on this, the present invention provides a decarboxylated carnosine complex liposome which can effectively reduce uric acid and dissolve tophi and has low toxicity.

[0006] A decarboxylated carnosine composite liposome, wherein the raw materials for preparing the liposome are composed of the following components in parts by mass: 20 to 100 parts of lecithin, 5 to 25 parts of cholesterol, 10 to 15 parts of distearoylphosphatidylethanolamine methoxypolyethylene glycol, 20 to 40 parts of flavonoids, 40 to 60 parts of quercetin, 10 to 20 parts of alkaloids, 5 to 25 parts of decarboxylated carnosine, 40 to 60 parts of knotweed extract, 90 to 110 parts of p-coumaric acid, 25 to 45 parts of liquorice extract, 30 to 50 parts of fuzi extract, 30 to 30 parts of radix strychnifoliae extract and 50 to 70 parts of tuckahoe extract.

[0007] In one embodiment, the mass fraction of the lecithin is 40 parts, the mass ratio of the cholesterol to the lecithin is 1:4, and the mass ratio of the decarboxylated carnosine to the lecithin is 1:4.

[0008] The present invention also provides a method for preparing the decarboxylated carnosine composite liposome, comprising the following steps:

[0009] Weighing lecithin, cholesterol, distearoylphosphatidylethanolamine methoxypolyethylene glycol, flavonoids, quercetin and alkaloids, dissolving them in anhydrous ethanol, and then evaporating the anhydrous ethanol at 42-50° C. under vacuum to obtain a phospholipid membrane;

[0010] A PBS solution containing 0.5-1.5 mg / mL decarboxylated carnosine, 4-6 mg / mL Polygonum cuspidatum extract, 8-12 mg / mL p-coumaric acid, 3-4 mg / mL liquorice extract, 3-5 mg / mL Fuzi extract, 1-3 mg / mL Dioscorea paniculata extract and 5-7 mg / mL Poria extract is mixed with the phospholipid membrane and ultrasonicated to self-assemble to form the decarboxylated carnosine complex liposome.

[0011] The present invention also provides the use of the decarboxylated carnosine composite liposome in preparing products for reducing uric acid and dissolving tophi.

[0012] The invention also provides the use of the decarboxylated carnosine composite liposome in preparing products for reducing urea nitrogen or blood creatinine.

[0013] The invention also provides the use of the decarboxylated carnosine complex liposome in preparing a product for inhibiting XO enzyme activity.

[0014] The present invention also provides the use of the decarboxylated carnosine composite liposome in preparing a product for increasing the expression level of TSPO or ABCG2.

[0015] The present invention also provides the use of the decarboxylated carnosine composite liposome in preparing a product for reducing the expression amount of TNF-α or IL-1β.

[0016] The present invention also provides the use of the decarboxylated carnosine composite liposome in preparing a product for increasing the expression level of TLR4, AKT, PI3K or NF-κB-P65.

[0017] The invention also provides a pharmaceutical preparation, which comprises the decarboxylated carnosine complex liposome and pharmaceutically acceptable auxiliary materials.

[0018] The beneficial effects of the present invention are:

[0019] The decarboxylated carnosine composite liposome is self-assembled with decarboxylated carnosine, alkaloids, flavonoids, Polygonum cuspidatum extract, p-coumaric acid, licorice extract, Fuzi extract, Dioscorea paniculata extract, Poria cocos extract and quercetin as raw materials. Studies have shown that the decarboxylated carnosine composite liposome can reduce uric acid, dissolve diastolic stones, balance the acid-base balance in the body, inhibit xanthine oxidase from synthesizing uric acid, promote uric acid excretion and intestinal peristalsis in the body, repair damaged liver and kidney cells, reduce swelling, resist inflammation and relieve pain, prevent and treat hyperuricemia, relieve gout inflammation, reduce blood pressure and improve immunity. DETAILED DESCRIPTION

[0020] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0021] Therefore, it is intended that the present invention covers such modifications and variations that fall within the scope of the appended claims and their equivalents. Other objects, features and aspects of the present invention are disclosed in or are obvious from the following detailed description. Those of ordinary skill in the art will appreciate that this discussion is only a description of exemplary embodiments and is not intended to limit the broader aspects of the present invention.

[0022] The present invention is further described below in conjunction with specific examples, but the examples do not limit the present invention in any form. For those skilled in the art, any other changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principle of the present invention should all be equivalent replacement methods and are included in the protection scope of the present invention.

[0023] Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0024] Example 1

[0025] 1. Experimental Materials

[0026] Soy lecithin, cholesterol, distearoyl phosphatidylethanolamine methoxypolyethylene glycol, flavonoids, quercetin, and alkaloids were all purchased from Shanghai McLean Biochemical Technology Co., Ltd.; decarboxylated carnosine, knotweed extract, p-coumaric acid, licorice extract, fuzi extract, radix polygoni multiflori extract, and tuckahoe extract were all purchased from Shanghai Puping Biotechnology Co., Ltd.

[0027] 2. Instruments and Equipment

[0028] N-1100 rotary evaporator, Shanghai Ailang Instrument Co., Ltd.;

[0029] SHZ-D (Ⅲ) type circulating water multi-purpose vacuum pump, Shanghai Jinfu Experimental Instrument Equipment Co., Ltd.;

[0030] VC505 cell disruptor, Suzhou Renode Biotechnology Co., Ltd.;

[0031] CF16RN high-speed refrigerated centrifuge, Hitachi (China) Co., Ltd.;

[0032] SpectraMax microplate reader, Bio-Rad, USA;

[0033] ZS90 laser nanoparticle size analyzer, Malvern Instruments Ltd., UK;

[0034] JEM2100F transmission electron microscope, JEOL Co., Ltd.

[0035] TenaorⅡ infrared spectrometer, Bruker, Germany.

[0036] 3. Experimental steps

[0037] 1. Introduction of Fmoc protecting group

[0038] Solution preparation: Weigh a certain amount of decarboxylated anserine and dissolve it in dichloromethane (DCM) to prepare a 0.1 M solution. In a separatory funnel, dissolve Fmoc-Cl (9-fluorenylmethoxycarbonyl chloride) in DCM to prepare a 0.1 M solution. Prepare a 0.1 M triethylamine solution as a basic catalyst.

[0039] Reaction mixing: In a reaction flask under nitrogen atmosphere, mix the decarboxylated carnosine solution and the Fmoc-Cl solution. Slowly drop the triethylamine solution into the mixture and stir the reaction for 2 to 4 hours, maintaining the reaction temperature between 0°C and room temperature.

[0040] Reaction termination: After the reaction was completed, the reaction mixture was washed several times with water and ethyl acetate to remove unreacted reagents and by-products.

[0041] Drying and purification: The organic phase was dried over anhydrous sodium sulfate, and the solvent was removed by rotary evaporation to obtain the protected product. The product was purified by silica gel column chromatography.

[0042] 2. Preparation process of decarboxylated carnosine complex liposomes

[0043] 2.1 Optimization of preparation conditions of decarboxylated carnosine complex liposomes

[0044] 2.1.1 Screening of preparation methods of decarboxylated carnosine complex liposomes

[0045] (1) Ethanol injection method. Weigh 150 mg of lecithin, 25 mg of cholesterol, 13 mg of distearoylphosphatidylethanolamine methoxypolyethylene glycol, 30 mg of flavonoids, 50 mg of quercetin, and 15 mg of alkaloids into a 250 mL single-mouth round-bottom flask, and add 150 mL of anhydrous ethanol to dissolve them all as the organic phase. Weigh 10 mL of the dissolved 50 mL of sterile PBS solution with pH 7.4 containing 1 mg / mL decarboxylated carnosine, 5 mg / mL Polygonum cuspidatum extract, 10 mg / mL p-coumaric acid, 3.5 mg / mL licorice extract, 4 mg / mL Fuzi extract, 2 mg / mL Dioscorea strychnifolia extract, and 6 mg / mL Poria cocos extract, preheat at 50°C, and form a uniform vortex by magnetic stirring as the aqueous phase. Use a 1 mL syringe to slowly and evenly inject the organic phase into the aqueous phase. The mixture was stirred and hydrated at 50°C for 1 hour and subjected to ultrasonic wave for 12 minutes to obtain decarboxylated carnosine complex liposomes.

[0046] (2) Thin film hydration method. Weigh 150 mg of soybean lecithin, 25 mg of cholesterol, 13 mg of distearoylphosphatidylethanolamine methoxypolyethylene glycol, 30 mg of flavonoids, 50 mg of quercetin, and 15 mg of alkaloids into a 250 mL single-mouth round-bottom flask, add 150 mL of anhydrous ethanol to dissolve them all; ultrasonicate for 30 seconds to mix them evenly. Then, connect the flask to a rotary evaporator, and completely evaporate the anhydrous ethanol solution in a 45°C water bath under vacuum to form a uniform yellow phospholipid film on the wall of the flask. Then, first prepare 50mL of a sterile PBS solution of pH 7.4 containing 1mg / mL decarboxylated carnosine, 5mg / mL Polygonum cuspidatum extract, 10mg / mL p-coumaric acid, 3.5mg / mL licorice extract, 4mg / mL Fuzi extract, 2mg / mL Dioscorea extract, and 6mg / mL Poria extract, weigh 10ml and separate the phospholipid film in an ultrasonic cleaner, then transfer the flask to an ultrasonic cell disruptor and use 300W ultrasound for 10min to allow the phospholipid film to self-assemble into decarboxylated carnosine complex liposomes. Then detect the encapsulation efficiency of the liposomes. Finally, the obtained liposome solution is stored in a 4°C refrigerator.

[0047] (3) Reverse phase evaporation method. Weigh 150 mg of soybean lecithin, 25 mg of cholesterol, 13 mg of distearoyl phosphatidylethanolamine methoxypolyethylene glycol, 30 mg of flavonoids, 50 mg of quercetin, and 15 mg of alkaloids into a 250 mL single-mouth round-bottom flask, and add 150 mL of anhydrous ether to dissolve them all as the organic phase. Weigh 10 mL of the dissolved 50 mL of sterile pH 7.4 PBS solution containing 1 mg / mL decarboxylated carnosine, 5 mg / mL Polygonum cuspidatum extract, 10 mg / mL p-coumaric acid, 3.5 mg / mL licorice extract, 4 mg / mL Fuzi extract, 2 mg / mL Dioscorea strychnifolia extract, and 6 mg / mL Poria cocos extract, preheat at 50°C, and form a uniform vortex by magnetic stirring as the aqueous phase. Use a 1 mL syringe to slowly and evenly inject the organic phase into the aqueous phase. The mixture was stirred and hydrated at 50°C for 1 hour and subjected to ultrasonic wave for 12 minutes to obtain decarboxylated carnosine complex liposomes.

[0048] 2.1.2 Optimization of preparation conditions

[0049] According to the method selected in 3.1.1, the preparation condition optimization test was carried out.

[0050] The lecithin content (20, 40, 60, 80, 100 mg), the mass ratio of cholesterol to egg yolk lecithin (1:2, 1:3, 1:4, 1:5, 1:6) and the mass ratio of decarboxylated carnosine to lecithin (1:2, 1:3, 1:4, 1:5, 1:6) were selected as single factor indicators to analyze the effects of different factors on decarboxylated carnosine liposomes.

[0051] According to the above preparation conditions, the experiment was repeated 3 times.

[0052] Blank liposomes (B-LIP) were prepared according to the optimized conditions using PBS buffer without active ingredients.

[0053] 2.2 Characterization of decarboxylated carnosine liposomes

[0054] 2.2.1 Determination of average particle size, polydispersity index and zeta potential of decarboxylated carnosine liposomes

[0055] Decarboxylated carnosine complex liposomes were diluted to an appropriate concentration with distilled water, and appropriate amounts of samples were placed in a polystyrene cell and a potential cell for equilibration for 120 seconds. The average particle size, polydispersity index (PDI) and Zeta potential were determined using a Malvern laser nanoparticle size analyzer, and the data were processed using dynamic light scattering processing software.

[0056] 2.2.2 Determination of encapsulation efficiency of decarboxylated carnosine composite liposomes

[0057] The encapsulation efficiency of decarboxylated carnosine composite liposomes was determined by ultrafiltration centrifugation. 2 mL of decarboxylated carnosine composite liposome suspension was taken with a pipette and placed in the top sleeve of a Millipore ultrafiltration centrifuge tube (molecular weight cutoff of 100 kDa), and centrifuged at 7000 r / min for 15 min. The top sleeve was removed, the liquid in the tube was drawn, and the mass of free decarboxylated carnosine composite liposomes was calculated. The experiment was repeated 3 times and the average value was taken. The encapsulation efficiency was calculated.

[0058] 2.2.3 Observation of the microscopic morphology of decarboxylated carnosine liposomes

[0059] 1) Appearance inspection: Place the decarboxylated carnosine complex liposomes in a transparent glass bottle and take photos for observation.

[0060] 2) Transmission electron microscopy (TEM) observation. After the decarboxylated carnosine complex liposomes were diluted to an appropriate multiple, they were dropped on the front of the copper mesh, and the excess sample was absorbed with filter paper. The sample was negatively stained with a 2% phosphotungstic acid solution for 4 minutes, and the excess stain was absorbed with filter paper. After drying, the sample was observed with a transmission electron microscope and photographed for analysis.

[0061] 2.2.4 Infrared spectroscopy analysis of decarboxylated carnosine complex liposomes

[0062] After the freeze-dried sample was pressed into a tablet with potassium bromide, the infrared spectrum was collected with a scanning range of 4000 to 400 cm-1 and a resolution of 2 cm-1.

[0063] 2.3 Determination of storage stability of decarboxylated carnosine liposomes

[0064] The decarboxylated carnosine complex liposomes were stored in the dark at 4 and 25°C, and samples were taken at 0, 1, 3, 5, and 7 days to analyze the average particle size, PDI, and encapsulation efficiency of the decarboxylated carnosine complex liposomes.

[0065] 4. Results and Analysis

[0066] 4.1 Screening results of decarboxylated carnosine complex liposome preparation methods

[0067] Decarboxylated carnosine complex liposomes were prepared by ethanol injection method, thin film hydration method and reverse phase evaporation method respectively. The average particle size, PDI, Zeta potential and encapsulation efficiency of decarboxylated carnosine complex liposomes were used as indicators to screen the optimal method for preparing decarboxylated carnosine complex liposomes. The experimental results are shown in Table 1.

[0068] Table 1 Comparison of parameters of three liposome preparation methods

[0069] Preparation method Particle size / nm PDI Zeta point / mV Encapsulation rate% Ethanol injection method 127.4 0.178 -38.2 45.3 Thin film hydration method 105.2 0.219 -25.4 86.74 Reverse evaporation method 163.1 0.214 -36.1 61.23

[0070] The Zeta potentials in Table 1 are all negative, indicating that the three methods prepared anionic liposomes. The particle size prepared by the thin film hydration method is the smallest, followed by the ethanol injection method, and the particle size prepared by the reverse phase evaporation method is relatively large; the PDI of the liposomes prepared by the three methods is less than 0.3, indicating that their particle size distribution is relatively uniform. The encapsulation efficiency of the thin film hydration method is the highest, reaching 86.74%, followed by the reverse phase evaporation method, and the ethanol injection method is the lowest. The results of this study show that the thin film hydration method is used to prepare composite functional liposomes, with a high encapsulation efficiency, a small particle size and relatively good stability.

[0071] 4.2 Results of optimization of preparation conditions for decarboxylated carnosine complex liposomes

[0072] The effects of egg yolk lecithin content, the mass ratio of cholesterol to egg yolk lecithin, and the mass ratio of each effective component to egg yolk lecithin on the average particle size and encapsulation efficiency of decarboxylated carnosine composite liposomes were investigated. The experimental results are shown in Table 2. As can be seen from the table below, with the continuous increase in the amount of egg yolk lecithin added, the encapsulation efficiency of decarboxylated carnosine composite liposomes increases accordingly. When the amount of egg yolk lecithin reaches 40 mg, the encapsulation efficiency of decarboxylated carnosine composite liposomes reaches a peak of 93.82%. At this time, the encapsulation efficiency begins to decrease when the amount of egg yolk lecithin continues to increase. The phenomenon that encapsulation increases first and then decreases is mainly because when the content of egg yolk lecithin increases, lipid self-assembly can be promoted, and the effective components encapsulated by the lipid bilayer also increase accordingly; when the amount of egg yolk lecithin is further increased, the symmetry and permeability of the lipid bilayer will be reduced, the overall stability of the system will be weakened, and even lipid aggregation will be caused, resulting in a decrease in the encapsulated effective components and a decrease in the encapsulation efficiency. From the particle size distribution point of view, when the amount of egg yolk lecithin is 40 mg, the particle size of the prepared decarboxylated carnosine composite liposome is relatively small and evenly distributed (PDI=0.180). Therefore, the amount of egg yolk lecithin should be set to 40 mg.

[0073] As the proportion of cholesterol decreases, the encapsulation of decarboxylated carnosine composite liposomes increases first and then decreases, and the corresponding average particle size gradually decreases. When the mass ratio of cholesterol to egg yolk lecithin is 1:4, the encapsulation rate of decarboxylated carnosine composite liposomes is the highest and the particle size is moderate. This is because adding a certain amount of cholesterol to the liposome membrane material can adjust the fluidity of the phospholipid bilayer, improve the internal phase leakage phenomenon and increase the stability of the system; cholesterol itself cannot form a bilayer structure, and its excessive dosage will make the lipid bilayer too rigid, and the space inside the liposome that can be used to encapsulate SCSP will become smaller, and the encapsulation rate will decrease; and when the proportion of cholesterol is too small, it will affect the formation of the lipid bilayer, resulting in the instability of the lipid membrane. Considering the encapsulation rate and particle size distribution, the cholesterol and egg yolk lecithin dosage ratio is set to 1:4.

[0074] As shown in Table 2, as the proportion of the effective ingredient dosage decreases, the encapsulation rate of the decarboxylated carnosine composite liposome increases. When the mass ratio of decarboxylated carnosine to egg yolk lecithin is 1:4, the encapsulation rate of the decarboxylated carnosine composite liposome reaches a maximum value of 85.12%. At this time, the proportion of the effective ingredient continues to decrease, and the encapsulation rate of the decarboxylated carnosine composite liposome decreases significantly. This is because the SCSP dosage is too high, which will result in most of the effective ingredients still existing in the aqueous buffer in a free form when the encapsulation capacity reaches the maximum under this lipid dosage, and the effective ingredients are wasted, and the encapsulation rate is relatively low; while the less amount of effective ingredients will lead to uneven liposome encapsulation, imbalance of the entire system, and reduced encapsulation rate. The change in the amount of effective ingredients has little effect on the particle size of the decarboxylated carnosine composite liposome. Therefore, the mass ratio of the effective ingredient to egg yolk lecithin is set to 1:4.

[0075] This study shows that the optimal conditions for the preparation of decarboxylated carnosine composite liposomes are: 40 mg of egg yolk lecithin, a mass ratio of cholesterol to egg yolk lecithin of 1:4, a mass ratio of effective ingredients to egg yolk lecithin of 1:4, and probe ultrasound for 12 minutes. Three batches of composite functional liposomes were prepared according to the optimized conditions of this experiment, and the particle sizes were measured to be 104.32 nm, 107.2 nm, and 105.3 nm, with an average particle size of (105.6 ± 1.2) nm; the encapsulation efficiency was 89.31%, 83.22%, and 86.51%, and the average encapsulation efficiency was 86.35% ± 2.49%. The properties of the three batches of composite functional liposomes were stable.

[0076] Table 2 Effect of preparation conditions on average particle size and encapsulation efficiency of decarboxylated carnosine composite liposomes

[0077] Lecithin mass (mg) 20.0 40.0 60.0 80.0 100 Encapsulation rate (%) 53.21±1.32 88.42±5.4 71.51±3.22 63.15±2.26 55.46±2.17 m(cholesterol):m(lecithin) 1：2 1：3 1：4 1：5 1：6 Encapsulation rate (%) 62.44±3.64 61.71±4.16 83.16±1.96 65.42±2.57 42.31±3.26 m(decarboxylated carnosine): m(lecithin) 1：2 1：3 1：4 1：5 1：6 Encapsulation rate (%) 60.21±4.19 65.22±2.26 80.19±3.54 58.44±2.19 57.21±5.19

[0078] 4.3 Analysis of the physicochemical properties of decarboxylated carnosine liposomes

[0079] 4.3.1 Particle size and Zeta potential analysis of decarboxylated carnosine liposomes

[0080] The results of particle size distribution and Zeta potential analysis of decarboxylated carnosine composite liposomes showed that the average particle size of decarboxylated carnosine composite liposomes was (105.44±3.167)nm, the PDI was 0.189±0.024, the particle size distribution range was narrow, and the distribution area was relatively concentrated. The Zeta potential of decarboxylated carnosine composite liposomes was (-29.42±0.322)mV. It can be preliminarily judged that the decarboxylated carnosine composite liposomes obtained in this study have a small particle size, uniform distribution and certain stability.

[0081] Example 2 Decarboxylated carnosine liposome cell efficacy verification

[0082] 1. Hepatocyte test

[0083] 1. Materials

[0084] Human primary hepatocytes (L-O2 cells, Shanghai Puping Biotechnology Co., Ltd.) were selected to measure whether the decarboxylated carnosine complex liposomes prepared above have cytotoxicity to them and the intervention effect on hyperuricemia model cells.

[0085] 2. Cytotoxicity Assay

[0086] Select L-O2 cells growing in the logarithmic phase, digest them with trypsin containing 0.25% EDTA, gently blow them into a cell suspension and count them, and dilute them to 1×10 with culture medium. 5 5000 cells / mL were inoculated into each well of a 96-well cell culture plate, and then 200 μL of serum-containing culture medium was added, and the plate was placed in a cell culture incubator for overnight culture to allow the cells to completely adhere to the wall. After the cells were completely attached to the wall, the culture medium in the well was removed, and the plate was rinsed once with sterile PBS solution, and 200 μL, 200 μM of different test samples (dissolved in tert-butyl alcohol) was added to the serum-free culture medium.

[0087] Then incubate in a 37°C incubator for 24h, 48h and 96h. After the incubation, aspirate the culture medium in the well plate, rinse twice with sterile PBS, add 100μL of serum-free culture medium containing 1mg / mL MTT in a light-proof environment, and incubate in a 37°C incubator for 4h. Aspirate the culture medium in the well plate, add 100μL DMSO and incubate in a 37°C constant temperature shaking box for 20min, then use an enzyme marker to measure the absorbance of each well solution in the well plate at 570nm, and use serum-free culture medium as the control group. Make 6 parallel groups for each group, and calculate the cell survival rate using the following formula = absorbance of the test group / absorbance of the control group × 100%.

[0088] Table 3 Cell survival rate

[0089]

[0090] Table 3 shows the cell survival rates of human primary hepatocytes in each treatment group at 24h, 48h and 96h. As shown in Table 3, the cell survival rates of each group at 24h and 48h were all higher than 100%, and decreased at 96h, indicating that the test products in each group had almost no toxic effect on human primary hepatocytes.

[0091] 3. In vitro hyperuricemia model cell intervention test

[0092] Human primary hepatocytes in the logarithmic growth phase were divided into a control group, a model group and an observation group, with 9 wells in each group.

[0093] 1) Establishment of hyperuricemia model cells:

[0094] LO2 cells in the logarithmic growth phase were taken at 105 The cells were inoculated at a density of 100 / mL on a 24-well plate, cultured in a 37°C, 5% CO2 incubator for 48 hours, and then the culture medium was removed. Different concentrations of adenosine solution (CAS: 58-61-7, Nanjing Spike Biotechnology Co., Ltd.) were added, and 3 parallel wells were set for each concentration. After 36 hours of continuous culture, the cell supernatant was taken out, and xanthine oxidase was added to make its concentration 0.005U / mg. The cells were incubated for 12 hours, and the uric acid concentration in the cell supernatant was analyzed by high-performance liquid chromatography (the detection method refers to "Construction of Hyperuricemia Cell Model and Its Application in Screening Uric Acid-Lowering Peptides [J] Modern Food Science and Technology, Vol. 33, No. 8, 2017"). Taking the control group without the above-mentioned adenosine induction process as the control, the uric acid production in the model group increased significantly, and there was basically no uric acid production in the blank control group, indicating that the hyperuricemia model was basically successfully constructed.

[0095] 2) Group test

[0096] The above-induced hyperuricemia model cells were plated as the model group, and were set as the model group, positive drug group and test group, and adhered to the wall for 24 hours. Complete medium was added to the model group, 0.5 mg / mL Febuxostat solution (CAS: 144060-53-7, Shanghai Puping Biotechnology Co., Ltd.) was added to the positive drug group, and 200 μM of the above-mentioned test samples containing different test samples (dissolved in tert-butyl alcohol) were added to the test group and incubated for 24 hours, and the supernatant was removed, washed three times with PBS, and the blank control group was added with complete medium, and the model group, positive drug group and decarboxylated carnosine complex liposome group were added with adenosine solution and continued to incubate for 36 hours, and the uric acid content in the cell supernatant was determined by high-performance liquid chromatography.

[0097] After each group of cells was cultured for 4 hours, the culture medium was collected and centrifuged at 1000 r / min for 5 minutes, and the supernatant was taken to detect the XO enzyme activity according to the instructions of the XO enzyme detection kit (BEENbio-CR-085, BEENbio). The enzyme activity of the model group was used as a reference, and the percentage of the difference between the enzyme activity of the supernatant of each group of cells and the enzyme activity of the supernatant of the model group and the enzyme activity of the model group was used as the percentage of the enzyme activity decrease.

[0098] Table 4 Uric acid content and XO enzyme decrease rate

[0099] Uric acid content (mM) XO enzyme reduction rate (%) Model Group 1.163±0.544 1 Positive drug group 0.322±0.612*** 48.51±6.22*** Decarboxylated carnosine liposome 0.284±0.662*** 83.54±3.29***

[0100] Table 4 shows the uric acid content in the cell supernatant of each group of cells after treatment, and the data therein are subjected to multiple comparisons and significant difference markings. As can be seen from Table 4, the uric acid content and XO enzyme activity of the model group are the highest, while the uric acid content in the positive drug group is reduced to about half of its content, and the XO enzyme activity is also greatly reduced, indicating that the positive drug has the ability to reduce uric acid content and inhibit XO enzyme activity. In the experimental group, decarboxylated carnosine composite liposomes can significantly reduce the XO enzyme activity and uric acid synthesis of L-O2 model cells, indicating that the synthesized decarboxylated carnosine composite liposomes can be used to prepare a pharmaceutical preparation that can significantly intervene in the uric acid metabolism of hepatocytes and significantly reduce the amount of uric acid metabolism.

[0101] 2. Small Intestinal Mucosal Epithelial Cell Test

[0102] 1. Materials

[0103] Rat intestinal epithelial cells were purchased from ATCC cell bank.

[0104] 2. Culture and Passage of Rat Small Intestinal Epithelial Cells

[0105] The rat small intestinal epithelial cells were cultured in DMEM medium with 100 mL / L fetal bovine serum, 10 g / L penicillin and streptomycin in a 37°C, 5% CO2 incubator, with the medium changed every 2 days. When the number of cells grew to about 80% to 90%, the cells were digested with trypsin and subcultured at a ratio of 1:3. The cells used in the experiment were the third generation cells. The cells were cultured at 5×10 4 / cm2 ratio was inoculated into the well plate for subsequent experiments.

[0106] 3. Establishment of the Intestinal Epithelial Cell Inflammation Model

[0107] Uric acid treatment of cells: Cells were inoculated into 96-well plates at a ratio of about 1000 cells per well, with a volume of 100 μL per well. They were treated with 50 mg / L uric acid (to ensure model establishment and cell activity), with 4 replicates per concentration, and placed in a cell culture incubator for 48 hours. The MTS method was used to detect cell activity with almost no attenuation.

[0108] 4. Group Test

[0109] The small intestinal mucosal epithelial cells in the logarithmic growth phase were taken as the normal group, and the above-mentioned small intestinal mucosal epithelial cell inflammation model cells were taken as the model group.

[0110] About 1000 small intestinal mucosal epithelial cells in the logarithmic growth phase were taken and inoculated into a 96-well plate with a volume of 100 μL per well. They were treated with 50 mg / L uric acid (to ensure model establishment and cell activity at the same time), and 4 replicate wells were set for each concentration. After being placed in a cell culture incubator for 48 hours, 100 μL of 2 mg / mL of the above test sample was added and incubated for 24 hours before use.

[0111] 5. Real-time fluorescence quantitative PCR

[0112] The mRNA expression of TSPO (transporter), ABCG2 (ATP-bound membrane transporter), and IL-1β in small intestinal mucosal epithelial cells was detected. RNA was extracted with Trizol (TAKARA), and then 1 μg RNA was reverse transcribed into cDNA using a reverse transcription kit (TAKARA). The operation method was carried out according to the reagent instructions. The SYBR Ex Taq kit (TAKARA) was used to detect the expression content of the gene, with GAPDH as an internal reference. The primer sequences are shown in Table 5. Table 6 shows the relative expression levels of TSPO, ABCG2, and IL-1β detected by RT-PCR in each group of cells, and multiple comparisons and significant difference marks were performed on each column of data. The results are shown in Table 6. Compared with the normal group, the expression of TSPO, ABCG2, and IL-1β in the model group cells after uric acid treatment for 24 hours was significantly increased. This shows that uric acid stimulates the expression of TSPO, ABCG2, and IL-1β in small intestinal mucosal epithelial cells, which not only accelerates the uric acid transport of cells, but also causes the cells to produce an inflammatory response.

[0113] Table 5 Primer sequences

[0114]

[0115] Table 6 Relative expression of mRNA

[0116]

[0117]

[0118] As can be seen from the table above, after the cells were treated with decarboxylated carnosine, the expression of TSPO in the cells increased compared with the normal group and was equivalent to the model group, the expression of ABCG2 increased significantly compared with the model group, and the expression of IL-1β decreased significantly compared with the model group. After the cells were treated with decarboxylated carnosine complex liposomes, the expression of TSPO in the cells increased significantly compared with the model group, the expression of ABCG2 increased significantly compared with the model group, and the expression of IL-1β decreased significantly compared with the model group. This shows that decarboxylated carnosine complex liposomes can not only promote the transport of uric acid, but also reduce the occurrence of inflammatory response.

[0119] 3. Animal Experiments

[0120] 1. Experimental Animals

[0121] Healthy male SD rats, clean grade, weighing (250±25)g, a total of 60 rats were selected, provided by Shanghai Slake Experimental Animal Center, animal license number: SCXK (Shanghai) 2017-0005. Animal breeding environment: clean laboratory breeding, temperature 20-25℃, humidity 40%-70%, noise <60 decibels, ventilation frequency 10-20 times / h, working illumination L / D = 12h / 12h. All animals were adaptively caged for 1 week after purchase, and those with no adverse reactions and normal diet and drinking water were included in the experiment.

[0122] 2. Establishment of the hyperuricemia model in rats

[0123] The rats in the modeling group were given potassium oxonate (Sigma) 100 mg / kg intraperitoneal injection and hypoxanthine 500 mg / kg gavage to induce hyperuricemia. The modeling drugs were administered once a day until the end of the experiment, for a total of 24 days.

[0124] 3. Experimental Grouping

[0125] After routine adaptive feeding, rats were divided into normal group, model group, experimental group and control group (febuxostat 4 mg / kg dose), 10 rats in each group, to establish the hyperuricemia model in rats.

[0126] 4. Processing steps

[0127] After successful modeling, the experimental group was given the above test product by gavage at 7.5 mg / (kg·d), 2 times / d, daily; at the same time, the febuxostat group was treated at 4 mg / (kg·d), 1 time / d, and the rest of the normal group and model group were gavaged with an equal volume of normal saline. Starting from the 4th day of the experiment, 0.5h after the modeling agent was administered, the drug was converted according to the adult dose by body surface area conversion method, and the decarboxylated carnosine complex liposome was gavaged, the positive drug group (febuxostat 4 mg / kg dose), the model group and the normal group were only gavaged with an appropriate amount of normal saline. The treatment drug was given once / d for a total of 21 days. The entire experiment lasted for 24 days. The normal control group did not receive any treatment.

[0128] 5. Detection

[0129] HE staining: The synovial tissue of the joint was fixed in 4% paraformaldehyde solution, dehydrated with gradient alcohol, embedded in conventional paraffin, sliced ​​at 5 μm, and read under a light microscope after HE staining.

[0130] On the 21st day, 3 hours after drug treatment, 3 ml of blood was collected from the heart (using vacuum blood collection tubes commonly used in clinical practice), and the serum was separated by centrifugation at 3000 r / min and 4°C for 15 minutes and stored at -80°C.

[0131] The concentration of UA, creatinine and urea nitrogen in serum were determined by Hitachi-7150 automatic biochemical analyzer.

[0132] ELISA kits (e Bioscience) were used to detect the levels of TNF-α and IL-1β in rat serum.

[0133] RT-PCR detection (related kits from TAKARA) extracts total cell RNA according to the Trizol reagent product instructions, and then reverse transcribes 1 μg RNA into cDNA using a reverse transcription kit (TAKARA), and the operation method is carried out according to the reagent instructions. The SYBR Ex Taq kit (TAKARA) is used to detect the expression level of the gene, with GAPDH as the internal reference. The relevant detection genes and primers are shown in Table 7.

[0134] Table 7 Primer sequences

[0135] Primer name Primer sequence 5'-3' TLR4-F SEQ ID NO: 9: ctccattcaagcccaagcct TLR4-R SEQ ID NO: 10: gtccttccatgacagaacggt AKT-F SEQ ID NO: 11:caggaccacgagaagctgtt AKT-R SEQ ID NO: 12: gatctccttggcatcctcgg PI3K-F SEQ ID NO: 13: ggagaaccagccctaagctc PI3K-R SEQ ID NO: 14: cagtgatggggttttgcagc NF-kBp65-F SEQ ID NO: 15: atgcccaacttctccgacag NF-kBp65-R SEQ ID NO: 16: aggacttccggtactccctc

[0136] 6. Results

[0137] Table 8 below shows the results of uric acid, uric acid protein and blood creatinine in the serum of each group of mice, and multiple comparisons and significant difference marks are performed on each column of data. The results show that in the blood UA test results of rats, the blood UA level of the model group is much higher than that of the normal control group, and the difference is statistically significant (P < 0.01), indicating that the modeling method is effective. After intraperitoneal injection of potassium oxonate and oral gavage of hypoxanthine, the experimental rats are in a state of hyperuricemia. In the experimental group, the levels of uric acid, urea nitrogen and blood creatinine in the serum of mice treated with decarboxylated carnosine complex liposomes were significantly lower than those in the model group, and the control effect of uric acid, urea nitrogen and blood creatinine in mice was not inferior to that of the control group.

[0138] Table 8 Uric acid, uric acid protein and serum creatinine content

[0139] UA (umol / L) Urea nitrogen (umol / L) Serum creatinine (umol / L) Normal group 59.46± 42.36± 1.15± Model Group 612.35± 116.24± 2.58± Model + positive drug control group 136.46± 65.42± 1.24± Model+Decarboxylated Carnosine 435.6± 89.24± 1.54± Model + decarboxylated carnosine complex liposome 146.24± 60.31± 1.15±

[0140] Table 9 below shows the results of TNF-α and IL-1β content in the serum of mice in each group, and multiple comparisons and significant difference marks are performed on each column of data. In the experimental group, the levels of TNF-α and IL-1β in the serum of mice treated with decarboxylated carnosine complex liposomes were significantly lower than those in the model group, and the control effect on TNF-α and IL-1β in mice was not inferior to that of the control group, indicating that decarboxylated carnosine complex liposomes can effectively control the occurrence of inflammation.

[0141] Table 9 TNF-α and IL-1β content

[0142] TNF-α(pg / mL) IL-1β (pg / mL) Normal group 154.36±25.46 85.49±23.26 Model Group 414.22±23.17 276.46±27.54 Model + positive drug control group 175.26±15.32 126.54±52.33 Model+Decarboxylated Carnosine 354.19±16.19 206.42±18.61 Model + decarboxylated carnosine complex liposome 174.26±25.41 113.54±7.24

[0143] Table 10 mRNA relative expression

[0144]

[0145] Table 10 shows the results of TLR4, AKT, PI3K, and NF-κB-P65 gene expression in the serum of mice in each group, and multiple comparisons and significant difference marks are performed on each column of data. In the experimental group, the TLR4, AKT, PI3K, and NF-κB-P65 gene expression in the serum of mice treated with decarboxylated carnosine complex liposomes were significantly higher than those in the model group, and the control effect on the expression of TLR4, AKT, PI3K, and NF-κB-P6 genes in mice was not inferior to that of the control group, indicating that decarboxylated carnosine complex liposomes have a good therapeutic effect on hyperuricemia, and the therapeutic effect is achieved based on the regulation of the PI3K / AKT signaling pathway.

[0146] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0147] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A decarboxylated carnosine complex liposome, characterized in that: The preparation raw materials are composed of the following components in parts by mass: 20 to 100 parts of lecithin, 5 to 25 parts of cholesterol, 10 to 15 parts of distearoyl phosphatidylethanolamine methoxy polyethylene glycol, 20 to 40 parts of flavonoids, 40 to 60 parts of quercetin, 10 to 20 parts of alkaloids, 5 to 25 parts of decarboxylated carnosine, 40 to 60 parts of knotweed extract, 90 to 110 parts of p-coumaric acid, 25 to 45 parts of liquorice extract, 30 to 50 parts of fuzi extract, 30 to 30 parts of radix polygoni multiflori extract and 50 to 70 parts of tuckahoe extract.

2. The decarboxylated carnosine complex liposome according to claim 1, characterized in that The mass fraction of the lecithin is 40 parts, the mass ratio of the cholesterol to the lecithin is 1:4, and the mass ratio of the decarboxylated carnosine to the lecithin is 1:

4.

3. A method for preparing the decarboxylated carnosine complex liposome according to claim 1 or 2, characterized in that: The following steps are involved: Weighing lecithin, cholesterol, distearoylphosphatidylethanolamine methoxypolyethylene glycol, flavonoids, quercetin and alkaloids, dissolving them in anhydrous ethanol, and then evaporating the anhydrous ethanol at 42-50° C. under vacuum to obtain a phospholipid membrane; A PBS solution containing 0.5-1.5 mg / mL decarboxylated carnosine, 4-6 mg / mL Polygonum cuspidatum extract, 8-12 mg / mL p-coumaric acid, 3-4 mg / mL liquorice extract, 3-5 mg / mL Fuzi extract, 1-3 mg / mL Dioscorea paniculata extract and 5-7 mg / mL Poria extract is mixed with the phospholipid membrane and ultrasonicated to self-assemble to form the decarboxylated carnosine complex liposome.

4. Use of the decarboxylated carnosine complex liposome according to claim 1 or 2 in preparing a product for reducing uric acid and dissolving tophi.

5. Use of the decarboxylated carnosine complex liposome according to claim 1 or 2 in preparing a product for reducing urea nitrogen or blood creatinine.

6. Use of the decarboxylated carnosine complex liposome according to claim 1 or 2 in the preparation of a product for inhibiting XO enzyme activity.

7. Use of the decarboxylated carnosine complex liposome according to claim 1 or 2 in the preparation of a product for increasing the expression of TSPO or ABCG2.

8. Use of the decarboxylated carnosine complex liposome according to claim 1 or 2 in the preparation of a product for reducing the expression of TNF-α or IL-1β.

9. Use of the decarboxylated carnosine complex liposome according to claim 1 or 2 in the preparation of a product for increasing the expression of TLR4, AKT, PI3K or NF-κB-P65.

10. A pharmaceutical preparation, characterized in that The invention comprises the decarboxylated carnosine complex liposome according to claim 1 or 2 and pharmaceutically acceptable auxiliary materials.

Images