Application of CRY1ZL1 gene / protein as target spot in screening medicine for preventing or treating Seneca virus infection

Abstract

The invention discloses an application of CRY1ZL1 gene / protein as a target spot in screening a medicine for preventing or treating Seneca virus infection, and belongs to the technical field of gene engineering. Specifically, the invention discloses application of a CRYZL1 gene / protein expression inhibitor or a knockout reagent in prevention or treatment of SVA infection, and the CRYZL1 gene / protein expression inhibitor or the knockout reagent can inhibit SVA endocytosis, growth, proliferation and invasion. The CRYZL1 gene is knocked out from the cell line, and it is found that the cell line has a remarkable disease-resistant effect on SVA infection.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to a use of a CRY1ZL1 gene / protein as a target in screening drugs for preventing or treating Seneca virus infection. Background Art

[0002] Seneca virus (Infection with Seneca virus) was originally named Seneca Valley virus. It was discovered in 2002 by American researchers when they were culturing adenovirus in embryonic retinal cells. When it was first isolated, purified and analyzed, it was very similar to members of the genus Cardiovirus and was considered to be a recombinant virus of the members of the genus Cardiovirus. After in-depth research, it was found that its complete nucleotide sequence and microscopic structure were still different. It was eventually determined to be a member of the Picornaviridae family and the genus Senecavirus. In 2015, the International Committee on Taxonomy of Viruses named it Senecavirus A (SVA). When Seneca virus was first discovered, most studies focused on its oncolytic properties. It was not until 2007 that Seneca virus was linked to primary vesicular disease in pigs, which attracted widespread attention in the veterinary field.

[0003] SVA infection can cause a vesicular disease characterized by diarrhea, lameness, anorexia, and vesicles and erosions in the mouth and nose, and its clinical features are difficult to distinguish from vesicular diseases caused by foot-and-mouth disease virus (FMDV) infection. Since 2014, Seneca virus-induced swine vesicular disease has been reported in the United States, Brazil, China, Thailand, and other places. my country first reported SVA infection in 2015. Some studies have shown that pigs are the main host of SVA, and some studies have also detected Seneca virus nucleic acid in houseflies and mice. In general, the current research on SVA is insufficient. There are no effective therapeutic drugs and commercial vaccines available for SVA infection, and molecular breeding also lacks original target genes.

[0004] Crystallin was first discovered as a structural protein of the lens in 1894. ζ-crystallinzeta (CRYZ) is an important member of the crystallin family and was first discovered in the lens of guinea pigs. Subsequent studies have found that homologous genes encoding CRYZ are widely distributed in animals, plants and microorganisms (Huang et al., 1987). In 1999, ζ-crystallinzetalike1 (CRYZL1) was discovered on human chromosome 21q22.1. Due to its high similarity to CRYZ, it was named CRYZL1. The CRYZL1 gene is highly expressed in the lungs, brain, heart and liver (Kim et al., 1999). Currently, there are few studies on CRYZL1. Lim et al. detected the genome-wide miRNA expression profile using miRNA chips and found that miRNA targeting CRYZL1 was related to Down syndrome (Limetall., 2015), but there are no reports on CRYZL1 and the prevention and treatment of SVA. Summary of the invention

[0005] In view of the above-mentioned deficiencies in the prior art, the present invention provides a use of a CRY1ZL1 gene / protein as a target in screening drugs for preventing or treating SVA infection. By silencing or knocking out the CRYZL1 gene, the infection of SVA can be effectively inhibited.

[0006] To achieve the above purpose, the technical solution adopted by the present invention to solve the technical problem is:

[0007] Use of the CRYZL1 gene / protein as a target in screening drugs for preventing or treating SVA infection, wherein the CRYZL1 gene ID is ENSSSCG00000028377.

[0008] Use of a CRYZL1 gene / protein expression inhibitor or knockout agent in the preparation of a drug for preventing or treating SVA infection.

[0009] Furthermore, the drug for preventing or treating SVA infection has at least one of the following functions:

[0010] A1) Inhibition of SVA endocytosis;

[0011] A2) inhibiting SVA growth or proliferation;

[0012] A3) Inhibition of SVA invasion.

[0013] Furthermore, the CRYZL1 gene / protein expression inhibitor or knockout agent is at least one of a nucleic acid molecule, a small molecule compound, a polypeptide, a protein, a gene editing vector, a lentivirus or an adeno-associated virus.

[0014] Furthermore, inhibiting CRYZL1 gene expression, silencing or knocking out CRYZL1 gene can be achieved by gene mutation, gene silencing, gene knockout, gene editing or gene knockdown techniques known to those skilled in the art. For example, RNA interference (RNAi) technology can be used to specifically eliminate or shut down the expression of a specific gene; the tool using gene editing technology can be CRISPR / Cas9 technology, zinc finger nuclease (ZFNs) or transcription activator-like effector nuclease (TALENs) technology, but is not limited thereto.

[0015] Furthermore, the CRYZL1 gene / protein expression inhibitor or knockout agent includes sgRNA that targets and knocks out the CRYZL1 gene / protein, or siRNA that silences and inhibits the expression of the CRYZL1 gene.

[0016] Further, the sgRNA is a double-stranded fragment formed by annealing sgRNA-F and sgRNA-R, and its targeting sequence is: GAGAAGGATTTCTTTCCTGT;

[0017] Among them, the sequences of sgRNA-F and sgRNA-R are as follows:

[0018] sgRNA-F: 5'-CACCGAGAAGGATTTCTTTCCTGT-3';

[0019] sgRNA-R: 5'-AAACACAGGAAAGAAATCCTTCTC-3'.

[0020] Furthermore, the siRNA is CRYZL1-si256-F / R, CRYZL1-si415-F / R or CRYZL1-si526-F / R.

[0021] A drug combination for preventing or treating SVA infection, comprising the above-mentioned CRYZL1 gene / protein expression inhibitor or knockout agent; or a combination of the above-mentioned inhibitor and an endocytosis inhibitor.

[0022] Furthermore, the endocytosis inhibitor is CPZ or EIPA.

[0023] Use of CRYZL1 gene in preparing preparations for breeding SVA disease-resistant pig breeds.

[0024] Use of the CRYZL1 gene in preparing a preparation for improving germplasm resources of SVA-related disease-resistant pig breeds.

[0025] Beneficial effects of the present invention:

[0026] The present invention knocks out the CRYZL1 gene in the cell line and finds that the cell line has a significant disease resistance effect to SVA infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The changes in CRYZL1 mRNA and SVA virus RNA copy numbers in IBRS-2 cells after knockdown of CRYZL1;

[0028] Figure 2 The expression of SVA virus protein after knocking down CRYZL1;

[0029] Figure 3 This is a diagram of the structure of the three-plasmid system;

[0030] Figure 4 Schematic diagram of sequencing of CRYZL1 gene targeted cell lines;

[0031] Figure 5 DNA sequencing of CRYZL1 knockout cell lines and CRYZL1 mRNA detection results;

[0032] Figure 6 This is the cell morphology of CRYZL1-KO1 cells infected with SVA virus;

[0033] Figure 7 The results of the detection of viral RNA copy number and viral protein after CRYZL1-KO1 cells were infected with SVA virus;

[0034] Figure 8 To investigate the effect of knocking out CRYZL1 on virus adsorption and internalization;

[0035] Fig. 9 The effect of inhibitor treatment on the endocytic pathway of SVA;

[0036] Fig.10 The infection status of SVA in CRYZL1-KO1 cells after inhibitor treatment;

[0037] Fig.11 To investigate the effect of knocking out the CRYZL1 gene on the macropinocytosis-mediated viral endocytosis pathway;

[0038] Fig.12 To investigate the effect of knocking out the CRYZL1 gene on the clathrin-mediated viral endocytosis pathway. DETAILED DESCRIPTION

[0039] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0040] Example 1 Effect of inhibiting the expression of CRYZL1 gene on SVA infection

[0041] 1. Synthesize siRNA

[0042] CRYZL1-si256, CRYZL1-si415, and CRYZL1-si526 interference sequences were designed and synthesized based on the CRYZL1 gene with the gene number ENSSSCG00000028377. The specific sequences are shown in Table 1.

[0043] Table 1 siRNA sequences

[0044]

[0045] 2. Effect of inhibiting CRYZL1 gene expression on SVA infection

[0046] Wild-type IBRS-2 cells were seeded in 12-well plates, and CRYZL1-siRNA and CRYZL1-siNC were transfected when the cell growth density reached 60%-70%. After 36 hours, each group of cells was infected with SVA (MOI=1). Total RNA was extracted 12 hours after virus infection, and qRT-PCR was used to detect the relative content of CRYZL1 mRNA and the number of viral RNA copies. GAPDH was used as the internal reference gene. The horizontal axis represents different interference sequences, and the vertical axis represents the relative content of CRYZL1 or SVA mRNA. Statistical analysis was performed using one-way ANOVA, and the results are shown in Figure 1 , where A is the relative content of CRYZL1 mRNA after knocking down CRYZL1; Figure B is the detection result of viral RNA copy number after knocking down CRYZL1, * represents p<0.05, ** represents p<0.01, *** represents p<0.001.

[0047] like Figure 1 As shown, knocking down CRYZL1 in IBRS-2 cells reduces the relative content of CRYZL1 mRNA. CRYZL1-si256, CRYZL1-si415, and CRYZL1-si526 can all achieve knockdown of CRYZL1. After knocking down CRYZL1, the number of viral RNA copies is also significantly reduced.

[0048] 3. Detection of SVA VP2 protein content

[0049] The expression of SVA VP2 protein in the cell samples treated in step 2 was detected. The results were as follows: Figure 2 As shown, after knocking down the expression of CRYZL1 gene, the expression of SVA VP2 protein was also significantly reduced, indicating that CRYZL1 played an important role in SVA infection of IBRS-2 cells.

[0050] Example 2 Construction of CRYZL1 gene knockout cell line

[0051] 1. The present invention adopts the CRISPR-PB vector system (see Figure 3 ), this system contains three plasmids, namely the piggyBac transposon backbone vector pSg4 (containing the puro resistance gene) containing sgRNA, the plasmid pPBase that transiently expresses the PB transposase, and the plasmid pS10 (containing the drug resistance gene neo) that is induced by doxorubicin to express the Cas9-flag protein.

[0052] 2. The sgRNA-F / R sequences were designed based on the CRYZL1 gene with the gene number ENSSSCG00000028377, sgRNA-F: 5'-CACCGAGAAGGATTTCTTTCCTGT-3'; and sgRNA-R: 5'-AAACACAGGAAAGAAATCCTTCTC-3'.

[0053] During synthesis, we added the sticky ends corresponding to the nuclease Bbs I. After obtaining the sequence, we annealed the two single strands of sgRNA to form a double strand. The annealing reaction system is shown in Table 2, and the reaction procedure is shown in Table 3.

[0054] Then, it was connected with the vector backbone pSg4 after Bbs I digestion. The connection reaction system is shown in Table 4. The digestion reaction conditions are: 16°C metal bath overnight. When the PCR fragment to be connected is small, the connection time can be shortened. When performing the connection reaction, the molar ratio of the vector backbone DNA to the insert fragment DNA is generally 1:2-10.

[0055] Finally, the connected vector was sequenced and verified to obtain the CRISPR targeting vector of the host gene. At the same time, a pair of verification primers CRYZL1-F: 5'-TTGGATCTGGTGTCACTGTGG-3'; CRYZL1-R: 5'-GAGCAAA GTGATTCAGGCTTACA-3' were designed and synthesized at about 250bp on both sides of the sgRNA sequence to verify the targeting of the host gene.

[0056] Table 2 sgRNA annealing reaction system

[0057]

[0058] Table 3 sgRNA annealing reaction program

[0059]

[0060] Table 4 Ligation reaction system

[0061]

[0062] 3. 1.5 μg Psg4 plasmid, 1.5 μg pS10 plasmid and 1 μg pPBase plasmid were transfected into 2 wild-type IBRS-2 cells by liposome transfection. We also transfected the plasmid expressing green fluorescence. In order to remove the untransfected cells, the cells were treated with medium containing 2 μg / mL puromycin and 4 μg / mL doxorubicin 24 hours after transfection. Puromycin selected transfected positive cells, and doxorubicin induced the expression of Cas9 protein to target the target gene.

[0063] The cells selected by puromycin were cultured again. After about a week, the genome of the cells was extracted and PCR amplification and DNA sequencing were performed to determine the knockout of the candidate gene. The results are shown in Figure 4 , indicating that the CRYZL1 gene knockout system was successfully constructed.

[0064] 4. Pick the CRYZL1 knockout IBRS-2 monoclonal cell line, revive it in a 10 cm dish, and then culture the CRYZL1 mixed targeting cell line with a medium containing 4 μg / mL puromycin. After 36 hours, change to a growth medium without puromycin. After about a week of culture, there are obvious monoclonal cell spots in the 10 cm dish. Use a cloning ring to pick the monoclonal cells and perform sequencing verification to obtain the CRYZL1 gene knockout IBRS-2 monoclonal cell line CRYZL1-KO1. The results are shown in Figure 5 , where A is the genome sequencing result of CRYZL1-KO1, the green sequence is the sgRNA target sequence; the blue sequence is the PAM sequence; the red part is the gene mutation. Figure B shows the expression of CRYZL1 mRNA in CRYZL1-KO1 cells.

[0065] like Figure 5 As shown in Figure A, the present invention successfully obtained the IBRS-2 monoclonal cell line CRYZL1-KO1 with CRYZL1 gene knockout. Both chains in CRYZL1-KO1 were mutated, one chain lost 3 bases and gained 1 base, and the other chain lost 24 bases. Moreover, according to the test results in Figure B, the mRNA expression level of CRYZL1 gene was significantly reduced after knockout. Both chains of CRYZL1-KO2 gained 1 base.

[0066] Example 3 Disease resistance detection of CRYZL1 gene knockout cell line

[0067] 1. Disease resistance detection of CRYZL1-KO1

[0068] (1) Wild-type cells and CRYZL1-KO1 cells were seeded in 12-well plates and infected with SVA at an MOI of 1 when the cell density reached 80% to 90%. After infection with the virus, the cell morphology of wild-type cells and CRYZL1-KO1 cells was observed. The results are shown in Table 1. Figure 6 .

[0069] like Figure 6 As shown, wild-type cells developed obvious CPE 24 h after virus infection, while CRYZL1-KO1 cells had no obvious CPE.

[0070] (2) Wild-type IBRS-2 cells and CRYZL1-KO1 cells were infected with SVA, and cell samples were collected 6 h and 12 h after virus infection. Total RNA and total protein were extracted, and the viral RNA copy number and VP2 protein expression were detected. The results are shown in Figure 7 , where A and B are the detection results of viral RNA copy number 6h and 12h after virus infection, respectively. C is the expression of VP2 protein 12h after virus infection.

[0071] like Figure 7 As shown, compared with wild-type cells, the number of intracellular viral RNA copies in CRYZL1-KO1 cells was significantly reduced at 6h and 12h after virus infection, and the expression of viral VP2 protein was also significantly reduced, indicating that the CRYZL1 knockout cell line can resist SVA infection.

[0072] (3) Wild-type IBRS-2 cells and CRYZL1-KO1 cells were inoculated in 12-well plates. When the cell growth density reached 80%-90%, each group of cells was infected with SVA (MOI = 10). After incubation at 4°C for 1 h, the adsorption of the virus was detected. After incubation at 37°C for 30 min, the internalization of the virus was detected. The results of virus adsorption were as follows: Figure 8 As shown in A, compared with wild-type cells, the relative content of viral RNA adsorbed on the cell surface was not significantly affected after CRYZL1 knockout. Figure 8 As shown in B, the relative content of intracellular viral RNA was significantly reduced after CRYZL1 knockout.

[0073] (4) IBRS-2 cells were seeded in 12-well plates. When the cell growth density reached 60%-70%, CRYZL1-si526 and CRYZL1-siNC were transfected into the cells. After 36 hours of transfection, each group of cells was infected with SVA (MOI = 10). After incubation at 37°C for 30 minutes, the internalization of the virus was detected. Figure 8 As shown in C, knockdown of CRYZL1 also affected viral internalization.

[0074] Example 4 Effect of CRYZL1 knockout on SVA endocytosis

[0075] 1. Determine the endocytic pathway

[0076] IBRS-2 cells were inoculated in 12-well plates. When the cell growth density reached 80%-90%, they were treated with DMSO or 50nM MBCD (caveolin-mediated endocytosis inhibitor), CPZ (clathrin-mediated endocytosis inhibitor), EIPA (macropinocytosis-mediated endocytosis inhibitor) for 6 hours. Then, each group of cells was infected with SVA (MOI = 10). After incubation at 37°C for 30 minutes, cell samples were collected, total RNA was extracted, and the relative content of viral RNA was detected by qRT-PCR. GAPDH was used as the internal reference gene. The horizontal axis represents different inhibitors, and the vertical axis represents the relative content of SVA mRNA. The results are shown in Fig. 9 .

[0077] like Fig. 9 As shown, compared with wild-type cells, MBCD treatment did not affect viral internalization, while CPZ and EIPA treatment significantly reduced the relative content of intracellular viral RNA and inhibited viral internalization. This study first discovered that SVA infects host cells through two pathways: clathrin-mediated endocytosis and macropinocytosis-mediated endocytosis.

[0078] At the same time, the effects of different inhibitors, MBCD, CPZ, and EIPA, on SVA infection were tested. Fig.10 As shown, similar to the results of virus internalization, MBCD treatment does not affect virus infection, while CPZ and EIPA treatment significantly reduce the number of intracellular viral RNA copies and inhibit virus infection.

[0079] 2. Effect of CRYZL1 on macropinocytosis-mediated viral endocytosis pathway

[0080] Wild-type IBRS-2 cells and CRYZL1-KO1 cells were inoculated in 24-well plates. When the cell growth density reached 80%-90%, each group of cells was infected with a mixture of 250 μg / mL FITC-Dextran and SVA (MOI=10). After incubation at 37°C for 30 min, the culture medium was discarded and the internalization of Dextran was observed by immunofluorescence. The results are shown in Fig.10 In the figure, DAPI stains the cell nucleus and shows blue signal, Dextran shows green signal, and the Merge group is the overlapping image of DAPI image and GFP image, and the scale is 400pum.

[0081] like Fig.10 As shown, compared with wild-type cells, the green fluorescence signal was significantly reduced after CRYZL1 knockout, indicating that CRYZL1 affected the endocytosis of Dextran, indicating that CRYZL1 can affect the macropinocytosis-mediated viral endocytosis pathway.

[0082] 3. Effect of CRYZL1 on clathrin-mediated viral endocytosis pathway

[0083] Wild-type IBRS-2 cells and CRYZL1-KO1 cells were inoculated in 24-well plates. When the cell growth density reached 80%-90%, each group of cells was infected with a mixture of 50ug / mL Bio-Transferrin and SVA (MOI=10). After culturing at 37%C for 30min, the culture medium was discarded. Immunofluorescence detection was performed using streptavidin coupled to a fluorescent marker to observe the endocytosis of Transferrin. The results are shown in Fig.11 In the figure, DAPI stains the cell nucleus and shows blue signal, Dextran shows green signal, and the Merge group is the overlapping image of DAPI image and GFP image, and the scale is 400pum.

[0084] like Fig.11 As shown, compared with wild-type cells, the green fluorescence signal was significantly reduced after CRYZL1 knockout, indicating that the endocytosis of Transferrin was affected, indicating that CRYZL1 affected the clathrin-mediated viral endocytosis pathway.

[0085] Finally, it should be noted that the above specific implementation methods are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to examples, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the spirit and scope of the technical solution of the present invention, which should be included in the scope of the claims of the present invention.

Claims

1. Use of CRYZL1 gene / protein as a target in screening drugs for preventing or treating SVA infection.

2. Use of CRYZL1 gene / protein expression inhibitors or knockout agents in the preparation of drugs for preventing or treating SVA infection.

3. The use according to claim 2, characterized in that: The drug for preventing or treating SVA infection has at least one of the following functions: A1) inhibit SVA endocytosis; A2) inhibiting SVA growth or proliferation; A3) Inhibition of SVA invasion.

4. The use according to claim 2, characterized in that: The CRYZL1 gene / protein expression inhibitor or knockout agent is at least one of a nucleic acid molecule, a small molecule compound, a polypeptide, a protein, a gene editing vector, a lentivirus or an adeno-associated virus.

5. The use according to claim 4, characterized in that The CRYZL1 gene / protein expression inhibitor or knockout agent includes sgRNA that targets and knocks out the CRYZL1 gene / protein, or siRNA that silences and inhibits the expression of the CRYZL1 gene.

6. The use according to claim 5, characterized in that The sgRNA is a double-stranded fragment formed by annealing sgRNA-F and sgRNA-R, and its targeting sequence is: GAGAAGGATTTCTTTCCTGT; Among them, the sequences of sgRNA-F and sgRNA-R are as follows: sgRNA-F: 5'-CACCGAGAAGGATTTCTTTCCTGT-3'; sgRNA-R: 5'-AAACACAGGAAAGAAATCCTTCTC-3'.

7. The use according to claim 5, characterized in that The siRNA is CRYZL1-si256-F / R, CRYZL1-si415-F / R or CRYZL1-si526-F / R.

8. A drug combination for preventing or treating SVA infection, characterized in that: A CRYZL1 gene / protein expression inhibitor or knockout reagent comprising any one of claims 2 to 7; Or a combination of a CRYZL1 gene / protein expression inhibitor or knockout agent and an endocytosis inhibitor according to any one of claims 2 to 7.

9. Use of CRYZL1 gene in the preparation of a preparation for breeding SVA disease-resistant pig breeds.

10. Use of CRYZL1 gene in the preparation of a preparation for improving germplasm resources of SVA-related disease-resistant pig breeds.

Images