SACM1L RNA (Ribonucleic Acid) mqPCR (Polymerase Chain Reaction) primer probe and application
By designing the mqPCR detection primer probe for SACM1L mRNA and circular RNA, combined with the mqPCR method, the problem of insufficient detection of SACM1L mRNA and circular RNA in the existing technology was solved, and accurate and comprehensive detection of ovarian cancer and auxiliary drug guidance were achieved. Highly specific and sensitive.
Patent Information
- Application Number
- CN202411419206.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-12
- Publication Date
- 2024-12-10
AI Technical Summary
The prior art is not rich enough in detecting SACM1L mRNA and circular RNA, and it is difficult to achieve accurate and comprehensive detection of ovarian cancer and auxiliary drug guidance.
Design an mqPCR detection primer probe for SACM1L mRNA and circular RNA, and combine it with mqPCR method to achieve simultaneous detection of SACM1L mRNA and circular RNA, providing a detection solution with high specificity, specificity, high sensitivity and high accuracy.
It has achieved efficient detection of SACM1L mRNA and circular RNA, providing accurate and comprehensive detection of ovarian cancer and auxiliary drug guidance, with potential application prospects.
Smart Images
Figure CN119101742A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of gene molecule detection, and specifically relates to a SACM1L mRNA and circular RNA mqPCR primer probe and an application method. Background Art
[0002] The SACM1L gene is mainly involved in phospholipid metabolism and the maintenance of cell membranes, and these processes are essential for the normal growth, division and signal transduction of cells. Studies have shown that although the specific mechanism is not yet fully clear, the SACM1L gene may play a role in tumor occurrence, progression and treatment response. That is, mutations or changes in the expression level of the SACM1L gene will lead to abnormal structure and function of the tumor cell membrane, thereby promoting the malignant transformation and spread of the tumor. Studies in recent years have shown that not only is SACM1L mRNA associated with the occurrence of ovarian cancer, but the circular RNA produced by SACM1L is also closely related to the onset and development of ovarian cancer. In other words, if the mRNA and circular RNA of the SACM1L gene can be detected simultaneously, the expression levels of linear mRNA and circular RNA can be obtained in one reaction system, so that more timely and effective guidance can be provided for the comprehensive and accurate detection of ovarian cancer and auxiliary medication.
[0003] In view of this, the present invention intends to achieve simultaneous detection of the mRNA of the SACM1L gene and five highly abundant circular RNAs that may have biological functions through primer probe design and application combined with the mqPCR (multiple fluorescence quantitative PCR) method, thereby providing a more ideal detection scheme for the accurate and comprehensive detection of ovarian cancer and auxiliary medication guidance. Summary of the invention
[0004] In view of the defect that the existing technical means for simultaneously detecting SACM1L mRNA and circular RNA are not rich enough, the present invention provides a SACM1L mRNA and circular RNA mqPCR primer probe, which uses the mqPCR method to achieve simultaneous detection of SACM1L mRNA and circular RNA, enriching the detection means of SACM1L mRNA and circular RNA.
[0005] The present invention takes SACM1L mRNA and circular RNA as research objects, and establishes an mqPCR detection method for simultaneously detecting SACM1L mRNA and circular RNA.
[0006] The present invention provides a primer pair and a specific probe for mqPCR detection of SACM1L mRNA and circular RNA.
[0007] The present invention also provides a SACM1L mRNA and circular RNA mqPCR detection kit. The kit has high specificity and specificity, high amplification efficiency, high sensitivity, high accuracy, good reproducibility, short detection cycle, can detect DNA amplification reaction in real time, and has potential application prospects.
[0008] Another object of the present invention is to provide the use of the above detection primer pair and specific probe or detection kit.
[0009] In order to achieve the above object, the present invention adopts the following technical solutions: The first object of the present invention is to provide an mRNA and circular RNA mqPCR detection primer pair and a specific probe for the SACM1L gene, wherein the circular RNA is a circular RNA with high abundance from the SACM1L gene and may have biological functions, and the circular RNA includes hsa_circ_0123884, hsa_circ_0123885, hsa_circ_0123886, hsa_circ_0123887 and hsa_circ_0123889.
[0010] The mRNA nucleotide sequence of the SACM1L gene was obtained through the NCBI database. Furthermore, the nucleotide sequences of the five circular RNAs with high abundance and possible biological functions of the SACM1L gene were obtained through detection in the circbase database.
[0011] Furthermore, the nucleotide sequence of the mRNA of the SACM1L gene is shown in SEQ ID NO.1;
[0012] Furthermore, the nucleotide sequence of hsa_circ_0123884 is shown as SEQ ID NO.2; GCATATCACACCTGAAAAATTTTATGTGGAAGCTTGTGATGATGGAGCAGATGACGTACTTACCATTGACCGTGTGTCCACAGAGGTTACCCTTGCAGTCAAGAAAGATGTTCCTCCTTCAGCTGTCACAAGACCAATATTTGGTATACTGGGCACAATCCATCTGGTGGCAGGTAATTATCTTATAGTCATTACCAAAAAGATAAAAGTAGGTGAATTTTTCAGTCATGTAGTCTGGAAAGCAACAGATTTTGATGTCCTTTCTTATAAGAAGACAATGTTGCACTTAACTGATATTCAGTTACAAGATAATAAAACCTTCCTAGCGATGCTAAACCATGTCTTGAATGTGGATGGATTTTACTTTTCAACAACATATGATTTGACCCATACTTTGCAGCGGCTATCCAACACTAGTCCTGAATTCCAAGAAATGAGTCTCTTGGAAAGGGCAGATCAGCGGTTTGTATGGAATGGTCATCTTCTAAGAGAACTTTCTGCACAGCCAGAGGTTCATCGGTTTGCCCTTCCAGTGTTACATGGCTTTATTACCATGCATTCATGTTCTATTAATGGAAAATACTTTGATTGGATTCTCATCTCGAGGAGGAGCTGTTTCAGAGCTGGTGTGCGCTATTATGTAAGAG。
[0013] Furthermore, the nucleotide sequence of hsa_circ_0123885 is shown as SEQ ID NO.3; GCATATCACACCTGAAAAATTTTATGTGGAAGCTTGTGATGATGGAGCAGATGACGTACTTACCATTGACCGTGTGTCCACAGAGGTTACCCTTGCAGTCAAGAAAGATGTTCCTCCTTCAGCTGTCACAAGACCAATATTTGGTATACTGGGCACAATCCATCTGGTGGCAGGTAATTATCTTATAGTCATTACCAAAAAGATAAAAGTAGGTGAATTTTTCAGTCATGTAGTCTGGAAAGCAACAGATTTTGATGTCCTTTCTTATAAGAAGACAATGTTGCACTTAACTGATATTCAGTTACAAGATAATAAAACCTTCCTAGCGATGCTAAACCATGTCTTGAATGTGGATGGATTTTACTTTTCAACAACATATGATTTGACCCATACTTTGCAGCGGCTATCCAACACTAGTCCTGAATTCCAAGAAATGAGTCTCTTGGAAAGGGCAGATCAGCGGTTTGTATGGAATGGTCATCTTCTAAGAGAACTTTCTGCACAGCCAGAGGTTCATCGGTTTGCCCTTCCAGTGTTACATGGCTTTATTACCATGCATTCATGTTCTATTAATGGAAAATACTTTGATTGGATTCTCATCTCGAGGAGGAGCTGTTTCAGAGCTGGTGTGCGCTATTATGTAAGAGGAATTGATTCGGAAGGCCATGCAGCTAACTTTGTAGAAACAGAACAAATTGTGCACTACAATGGGAGCAAAGCTTCGTTTGTACAGACTCGAGGATCAATACCTGTTTTCTGGTCCCAAAGACCAAACCTCAAGTACAAACCACTGCCACAGATCAGCAAAGTAGCAAATCACATGGACGGTTTCCAAAGGCATTTTGATTCCCAAGTAATTATTTATGGAAAACAAGTTATAATCAATCTG。
[0014]
[0015] Furthermore, the nucleotide sequence of hsa_circ_0123887 is shown in SEQ ID NO.5; GAATTGATTCGGAAGGCCATGCAGCTAACTTTGTAGAAACAGAACAAATTGTGCACTACAATGGGAGCAAAGCTTCGTTTGTACAGACTCGAGGATCAATACCTGTTTTCTGGTCCCAAAGACCAAACCTCAAGTACAAACCACTGCCACAGATCAGCAAAGTAGCAAATCACATGGACGGTTTCCAAAGGCATTTTGATTCCCAAGTAATTATTTATGGAAAACAAGTTATAATCAATCTG.
[0016] Furthermore, the nucleotide sequence of hsa_circ_0123889 is shown in SEQ ID NO.6; GCTGGTGGAGGACACCTTCACCATAGATGAAGTCTCTGAAGTCCTCAATGGATTACAAGCTGTGGTTCATAGTGAGGTGGAATCTGAGCTCATCAACACTGCCTATACCAATGTGTTACTTCTGCGACAGCTGTTTGCACAAGCTGAGAAGTGGTATCTTAAGC TACAGACAGACATCTCTGAACTTGAAAACCGAGAATTATTAGAACAAGTTGCAGAATTTGAAAAAGCAGAGATTACATCTTCAAACAAAAAGCCCATCTTAGATGTCACAAAGCCAAAACTTGCTCCACTTAATGAAGGTGGAACAGCAGAACTCCTAAACAAG.
[0017] Preferably, in some embodiments, the specific detection primer pair and specific probe for mRNA of the SACM1L gene are: SACM1L-mRNA-F: 5'- GAGCAGACGACGTAGTTACC -3'; SACM1L-mRNA-R: 5'-TTGTTTGAGGTGCTCCTTAA-3'; SACM1L-mRNA-probe: 5'-CTGAGTTGTGGGCTACTCAG-3'.
[0018] Preferably, in some embodiments, the specific detection primer pair and specific probe of hsa_circ_0123884 are: hsa_circ_0123884-F: 5'-AGAACACAATGTTGCAGTTAA-3'; hsa_circ_0123884-R: 5'-CTTTGAGCCACTGACGCAAT-3'; hsa_circ_0123884-probe: 5'-AGGCCCATCGGGTTTGCTTTTC-3'.
[0019] Preferably, in some embodiments, the specific detection primer pair and specific probe of hsa_circ_0123885 are: hsa_circ_0123885-F: 5'- AGATATCGTACTTGCGATGTG -3'; hsa_circ_0123885-R: 5'-TCTACGAGTGGTGAGCTATT -3'; hsa_circ_0123885-probe: 5'-TGTGTGACAGGTACGAGTGT-3'.
[0020] Preferably, in some embodiments, the specific detection primer pair and specific probe of hsa_circ_0123886 are: hsa_circ_0123886-F: 5'- TTGCAGAAGGTCAAGGTTGT -3'; hsa_circ_0123886-R: 5'- GGAGGGTGATGGTCTTTCAT -3'; hsa_circ_0123886-probe: 5'-ACGTATCGAGGGCACTGATT-3'.
[0021] Preferably, in some embodiments, the specific detection primer pair and specific probe of hsa_circ_0123887 are: hsa_circ_0123887-F: 5'-TGGTATTAGAGTCCAGGCTC-3'; hsa_circ_0123887-R: 5'-CTAGGAGTGCAGTCAGTTGA-3'; hsa_circ_0123887-probe: 5'-TGGGAGTCAGGTGTCATTCT-3'.
[0022] Preferably, in some embodiments, the specific detection primer pair and specific probe of hsa_circ_0123889 are: hsa_circ_0123889-F: 5'-AAGTGAGTACACCGCAGATA-3'; hsa_circ_0123889-R: 5'- CAGTGAGGGTGTTCTTGCAT -3'; hsa_circ_0123889-probe: 5'-GTCGGATGCTGTACAGGTG-3'.
[0023] Preferably, in some embodiments, the SACM1L mRNA-specific probe, the hsa_circ_0123884-specific probe, the hsa_circ_0123885-specific probe, the hsa_circ_0123886-specific probe, the hsa_circ_0123887-specific probe, and the hsa_circ_0123889-specific probe have a fluorescent group at the 5' end and a quenching group at the 3' end; Preferably, in some embodiments, the fluorescent group is any one of FAM, HEX, TET, JOE, NED, VIC, Cy3, Cy5, ROX or TAMRA, or a combination of at least two thereof. Among them, the fluorescent group of the SACM1L mRNA specific probe is preferably TET; the fluorescent group of the hsa_circ_0123884 specific probe is preferably FAM; the fluorescent group of the hsa_circ_0123885 specific probe is preferably Cy5; the fluorescent group of the hsa_circ_0123886 specific probe is preferably HEX; the fluorescent group of the hsa_circ_0123887 specific probe is preferably ROX; and the fluorescent group of the hsa_circ_0123889 specific probe is preferably TAMRA.
[0024] Preferably, in some embodiments, the quenching group is selected from any one or a combination of at least two of MGB, BHQ1, BHQ2, BHQ3 or Phosphorothioate. Among them, the quenching group of the SACM1L mRNA specific probe is preferably MGB; the quenching group of the hsa_circ_0123884 specific probe is preferably BHQ1; the quenching group of the hsa_circ_0123885 specific probe is preferably BHQ3; the quenching group of the hsa_circ_0123886 specific probe is preferably BHQ2; the quenching group of the hsa_circ_0123887 specific probe is preferably Phosphorothioate; the quenching group of the hsa_circ_0123889 specific probe is preferably BHQ2.
[0025] The second object of the present invention is to provide a detection kit for simultaneously detecting mRNA and circular RNA of the SACM1L gene; the kit comprises the mRNA and circular RNA mqPCR detection primer pair and specific probe of the SACM1L gene described in the above scheme.
[0026] The third object of the present invention is to provide an mRNA and circular RNA mqPCR detection primer pair and specific probe for SACM1L gene described in the above scheme or the detection kit described in the above scheme for detecting single or mixed expression of SACM1L gene mRNA and circular RNA.
[0027] Preferably, in some embodiments, RNA is extracted from a cell-derived sample, residual genomic DNA in the extracted RNA is removed, the RNA is reverse transcribed into cDNA, and the mRNA of the SACM1L gene and the cDNA of the circular RNA are amplified using the mRNA and circular RNA mqPCR detection primer pair and specific probe of the SACM1L gene in the above scheme.
[0028] Preferably, in some embodiments, the total volume of the qPCR reaction system used for expansion is 20 μL, including: 2×QPCR MIX 10 μL; 0.4 μL of each of six pairs of upstream and downstream primers with a concentration of 10 μM; 0.1 μL of each of six specific probes with a concentration of 10 μM; 1 μL of each of the cDNA diluted 5 times; and sterile water is added to a total volume of 20 μL.
[0029] Preferably, in some embodiments, the amplification reaction conditions are: the amplification program is 90°C for 5 min, 90°C for 30 s, 55°C for 15 s, 60°C for 30 s, and 40 cycles.
[0030] Preferably, in some embodiments, the total RNA in the cell-derived sample is extracted by the Trizol method; the residual genomic DNA in the extracted RNA is removed by the DNA enzyme digestion method; and the RNA is reverse transcribed into cDNA by a reverse transcription kit. The process of extracting total RNA from the cell-derived sample by the Trizol method includes: adding 1 mL of trizol to about 800,000 cells, blowing and lysing on ice for 3 minutes, then adding 150 μL of chloroform, vortexing for 30 seconds, placing on ice for 30 minutes, centrifuging at 12000g for 20 minutes at 4°C, taking 400 μL of the supernatant liquid into a new centrifuge tube with a gun tip, adding 1 volume of isopropanol, and vortexing to mix thoroughly; centrifuging at 12000g for 20 minutes at 4°C, removing the supernatant with a gun tip and retaining the precipitate; adding 1 mL of 75% ice-cold ethanol, gently inverting, and then centrifuging at 12000g for 10 minutes at 4°C, and discarding the supernatant; after drying the precipitate at room temperature, adding 20 μL of DEPC water to dissolve the RNA. The process of using DNA enzyme digestion to remove genomic DNA residues in the extracted RNA includes: the total volume of the reaction solution is 10μL, specifically 6μL of total RNA, 1.5μL of DNase enzyme I, 1μL of 10×buffer and 1.5μL of enzyme-free water; after digestion at 37°C for 1.5 hours in the reaction solution, the DNA digestion enzyme is inactivated at 80°C for 10min. The process of reverse transcribing RNA into cDNA using a reverse transcription kit includes: in a reaction system and conditions of 2μg of total RNA and 0.5μL of random primers, first mix the RNA and random primers, denature at 60°C for 10min, and then immediately put them on ice; then add 10μL of 2× reverse transcription reaction solution, make up to 20μL with enzyme-free water, and set the reaction conditions to 25°C for 15min, 37°C for 15min, 40°C for 15min, and 80°C for 10min.
[0031] Another object of the present invention is to provide an mRNA and circular RNA mqPCR detection primer pair and specific probe for the SACM1L gene as described in the above scheme or the detection kit as described in the above scheme for use in preparing auxiliary clinical diagnosis, tumor-related targeted drug selection or tumor-related diagnostic reagents and / or drugs.
[0032] Compared with the prior art, the present invention has the following beneficial effects: The mqPCR specific detection primer pair and specific probe established by the present invention detect the expression of linear mRNA and circular RNA in one reaction system, with high specificity and specificity, high amplification efficiency, high sensitivity, high accuracy, good reproducibility, and short detection cycle, and have potential application prospects. By using mqPCR to simultaneously detect the mRNA of the SACM1L gene and 5 circular RNAs, a more ideal detection scheme will be provided for accurate and comprehensive detection of tumors and auxiliary drug guidance. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] Figure 1 This is a graph showing the content of SACM1L mRNA in various cell lines detected by mqPCR in Example 2.
[0034] Figure 2 This is a graph showing the content of hsa_circ_0123884 in various cell lines detected by mqPCR in Example 2.
[0035] Figure 3 This is a graph showing the content of hsa_circ_0123885 in various cell lines detected by mqPCR in Example 2.
[0036] Figure 4 This is a graph showing the content of hsa_circ_0123886 in various cell lines detected by mqPCR in Example 2.
[0037] Figure 5 This is a graph showing the content of hsa_circ_0123887 in various cell lines detected by mqPCR in Example 2.
[0038] Figure 6 This is a graph showing the content of hsa_circ_0123889 in various cell lines detected by mqPCR in Example 2. DETAILED DESCRIPTION
[0039] The above contents of the present invention are further described in detail below through specific implementation methods in the form of examples. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. In the examples, except for the PCR standard products which were commissioned to be synthesized by a commercial company, the instruments and reagents used can all be commercially available.
[0040] Example 1 SACM1L mRNA and circular RNA mqPCR standard curve amplification The first step is to prepare PCR standards. According to the detailed sequence interval information of fluorescent quantitative PCR amplification, the standard of fluorescent quantitative PCR is prepared by chemical nucleic acid gene synthesis strategy. Specifically, the standard sequence is entrusted to a gene synthesis company (GenScript Biotech) for synthesis, and then the sequence is connected to the pUC-19 plasmid vector to construct a standard. Among them, the plasmid standard fragment sequence used to detect SACM1L mRNA is shown in SEQ ID NO.7, and the SACM1L mRNA standard fragment sequence information is as follows: AGCAGATGACGTACTTACCATTGACCGTGTGTCCACAGAGGTTACCCTTGCAGTCAAGAAAGATGTTCCTCCTTCAGCTGTCACAAGACCAATATTTGGTATACTGGGCACAATCCATCTGGTGGCAGGTAATTATCTTATAGTCATTACCAAAAAGATAAAAGTAGGTGAATTTTTCAGTCATGTAGTCTGGAAAGCAACAGATTTTGATGTCCTTTTCTTATAAGAAGAC (SEQ ID NO.7); The sequence of the plasmid standard fragment used to detect circular hsa_circ_0123884 is shown in SEQ ID NO.8: GGTCATCTTCTAAGAGAACTTTCTGCACAGCCAGAGGTTCATCGGTTTGCCCTTCCAGTGTTACATGGCTTTATTACCATGCATTCATGTTCTATTAATGGAAAATACTTTGATTGGATTCTCATCTCGAGGAGGAGCTGTTTCAGAGCTGGTGTGCGCTATTATGTAAGAG (SEQ ID NO. 8); The sequence of the plasmid standard fragment used to detect circular hsa_circ_0123885 is shown in SEQ ID NO.9: GCGTGTCCACAGAGGTTACCCTTGCAGTCAAGAAAGATGTTCCTCCTTCAGCTGTCACAAGACCAATATTTGGTATACTGGGCACAATCCATCTGGTGGCAGGTAATTATCTTATAGTCATTACCAAAAAGATAAAAGTAGGTGAATTTTCAGTCATGTAGTCTGGAAAGCAACAGATTTTGATGTCCTTTCTTATAAGAAGAC (SEQ ID NO.9); The sequence of the plasmid standard fragment used to detect circular hsa_circ_0123886 is shown in SEQ ID NO.10: GAGGAGCTGTTTCAGAGCTGGTGTGCGCTATTATGTAAGAGGAATTGATTCGGAAGGCCATGCAGCTAACTTTGTAGAAACAGAACAAATTGTGCACTACAATGGGAGCAAAGCTTCGTTTGTACAGACTCGAGGATCAATACCTGTTTTCTGGTCCCAAAGACCAAACCTCAAGTACAAACCACTGCCACAGATCAGCAAAGTAG (SEQ IDNO.10); The sequence of the plasmid standard fragment used to detect circular hsa_circ_0123887 is shown in SEQ ID NO.11: AAGCTTCGTTTGTACAGACTCGAGGATCAATACCTGTTTTCTGGTCCCAAAGACCAAACCTCAAGTACAAACCACTGCCACAGATCAGCAAAGTAGCAAATCACATGGACGGTTTCCAAAGGCATTTTGATTCCCAAGTAATTATTTATGGAAAACAAGTTATAATCAATCTG (SEQ ID NO. 11); The sequence of the plasmid standard fragment used to detect circular hsa_circ_0123889 is shown in SEQ ID NO.12: GTGGAATCTGAGCTCATCAACACTGCCTATACCAATGTGTTACTTCTGCGACAGCTGTTTGCACAAGCTGAGAAGTGGTATCTTAAGCTACAGACAGACATCTCTGAACTTGAAAACCGAGAATTATTAGAACAAGTTGCAGAATTTGAAAAAGCAGAGATTACATCTTCAAACAAAAAGCCCATCTTAGATGTCACAAAGCC (SEQ ID NO. 12); In the second step, the concentration of the standard plasmid was measured by a nucleic acid analyzer, and then the copy concentration of the standard was calculated based on the number of bases of the inserted plasmid fragment and the number of bases of the plasmid backbone. The titer dilution gradient of each plasmid standard was: 5 million copies / μL, 500,000 copies / μL, 50,000 copies / μL, 500,000 copies / μL, 500 copies / μL. Subsequently, the corresponding probes and primers, standards and QPCR kits were mixed, and the qPCR amplification curve and standard curve were obtained by machine testing to determine whether the designed primers and matching probes had a satisfactory gradient linear relationship (each gradient was repeated for 3 wells). Among them, the specific mqPCR reaction system is: 0.4 μL of each of 6 pairs of upstream and downstream primers (10 μM), 0.1 μL of each of 6 probes (10 μM), 0.3 μL of each of 6 plasmid standard templates, 10 μL of probe method fluorescence quantitative detection reagent 2xQPCR reaction solution (Nanjing Novozyme), and sterile water to make up a total volume of 20 μL. In addition, the mqPCR reaction conditions are: 6 fluorescence channel detections are set in each reaction well of the fluorescence quantitative PCR instrument at the same time, and CY5\HEX \TET\CY5\ROX\TAMRA fluorescence signals are detected at the same time. The PCR reaction program is 90°C pre-denaturation for 5 minutes, 90°C denaturation for 30 seconds in the cycle, 55°C annealing for 15 seconds and 60°C extension for 30 seconds, and then the fluorescence signal is detected at the end of each cycle reaction. A total of 40 total reaction cycles are designed; The third step is to perform mqPCR analysis on the standard according to the reaction system and conditions to obtain the gradient amplification curve and standard curve of SACM1L mRNA and circular RNA; The experimental results showed that the dilution gradient relationship and the linear relationship of the standard curve of all standard samples showed good results. Among them, the correlation coefficient of the primer and probe amplification standard of SACM1L mRNA was R2=1.000, the amplification efficiency was E=95.021%, and the slope was S=-3.568; the correlation coefficient of the primer and probe amplification of the hsa_circ_0123884 standard was R2=0.997, the amplification efficiency was E=94.885%, and the slope was S=-3.673; the correlation coefficient of the primer and probe amplification of the hsa_circ_0123885 standard was R2=0.999, the amplification efficiency was E=100.013%, and the slope was S=-3.425; the correlation coefficient of the primer and probe amplification of the hsa_ The correlation coefficient of primer and probe amplification for circ_0123886 standard was R2=0.998, the amplification efficiency was E=99.436%, and the slope was S=-3.394; the correlation coefficient of primer and probe amplification for hsa_circ_0123887 standard was R2=0.996, the amplification efficiency was E=98.297%, and the slope was S=-3.458; the correlation coefficient of primer and probe amplification for hsa_circ_0123889 standard was R2=0.999, the amplification efficiency was E=96.641%, and the slope was S=-3.739.
[0041] Example 2 Application of SACM1L mRNA and circular RNA mqPCR The commonly used ovarian cell lines in the laboratory, IOSE-80 normal cells, OVCAR-3 (human ovarian cancer cells), SKOV-3 (human ovarian cancer cells), A2780 (human ovarian cancer cells), HGSOC cell lines (SACM1L weakly positive ovarian cancer cells), and CAOV3 (SACM1L strongly positive ovarian cancer cells) were selected. The cells were expanded and cultured in the laboratory according to the culture conditions of each cell (37°C, 5% CO2 concentration). When the cells grew to 80% density, the total RNA in the cells was extracted using the classic Trizol method. After the concentration of RNA was measured by a nucleic acid concentration meter, 2 μg of RNA was taken and reverse transcribed into cDNA using a reverse transcription kit (Nanjing Novozyme). The cDNA was then diluted 5 times, and 1 μL of the diluted cDNA was taken for mqPCR detection of the content of SACM1L mRNA and circular RNA in each cell line. The specific experimental method steps include: The first step is to add 1 mL trizol to about 800,000 cells, beat on ice for 3 minutes, then add 150 μL chloroform, vortex for 30 seconds, place on ice for 30 minutes, centrifuge at 12,000 g for 20 minutes at 4°C, take 400 μL of the supernatant into a new centrifuge tube with a pipette tip, add 1 volume of isopropanol, and vortex to mix thoroughly; centrifuge at 12,000 g for 20 minutes at 4°C, remove the supernatant with a pipette tip and retain the precipitate; add 1 mL 75% ice-cold ethanol, gently invert, then centrifuge at 12,000 g for 10 minutes at 4°C, and discard the supernatant; after drying the precipitate at room temperature, add 20 μL DEPC water to dissolve the RNA; In the second step, the genomic DNA residue in the extracted RNA is removed by DNA enzyme digestion. The total volume of the reaction solution is 10 μL, specifically 6 μL of total RNA, 1.5 μL of DNase enzyme I, 1 μL of 10×buffer and 1.5 μL of enzyme-free water; after digestion in the reaction solution at 37°C for 1.5 hours, the DNA digestion enzyme is inactivated at 80°C for 10 minutes. The process of reverse transcribing RNA into cDNA using a reverse transcription kit includes: in the reaction system and conditions of 2 μg of total RNA and 0.5 μL of random primers, first mix the RNA and random primers, denature at 60°C for 10 minutes, and then immediately put them on ice; then add 10 μL of 2× reverse transcription reaction solution, make up to 20 μL with enzyme-free water, and set the reaction conditions to 25°C for 15 minutes, 37°C for 15 minutes, 40°C for 15 minutes, and 80°C for 10 minutes; Step 3: Prepare the mqPCR reaction system: add 0.4 μL of each of 6 pairs of upstream and downstream primers (10 μM), 0.1 μL of each of 6 probes (10 μM), 0.3 μL of each of 6 plasmid standard templates, 10 μL of probe method fluorescence quantitative detection reagent 2xQPCR reaction solution (Nanjing Novozyme), and add sterile water to make up the total volume to 20 μL; In the fourth step, the content of SACM1L mRNA and circular RNA in each cell line was calculated by the standard curve determined in Example 1 and the CT value of each cell line detected by mqPCR, and the results were expressed in ordinate (copy / nanogram). Figure 1-6 The figure is a content diagram of SACM1L mRNA, hsa_circ_0123884, hsa_circ_0123885, hsa_circ_0123886, hsa_circ_0123887, and hsa_circ_0123889 detected by mqPCR. The experimental results show that the mqPCR method of the present invention can effectively detect the content of SACM1L mRNA and circular RNA in cell-derived samples.
[0042] The above embodiments are merely illustrative of the principles and effects of the present invention, and are not intended to limit the present invention. Anyone familiar with the art may modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by a person of ordinary skill in the art without departing from the spirit and technical concept disclosed by the present invention shall still be covered by the claims of the present invention.
Claims
1. A combination of a primer pair and a specific probe for mRNA and circular RNA mqPCR detection of the SACM1L gene, characterized in that: The circular RNA includes hsa_circ_0123884, hsa_circ_0123885, hsa_circ_0123886, hsa_circ_0123887 and hsa_circ_0123889; the nucleotide sequence of the SACM1L mRNA is shown in SEQ ID NO.1, the nucleotide sequence of the hsa_circ_0123884 is shown in SEQ ID NO.2, the nucleotide sequence of the hsa_circ_0123885 is shown in SEQ ID NO.3, the nucleotide sequence of the hsa_circ_0123886 is shown in SEQ ID NO.4, the nucleotide sequence of the hsa_circ_0123887 is shown in SEQ ID NO.5, and the nucleotide sequence of the hsa_circ_0123887 is shown in SEQ ID NO.6; The specific detection primer pair and specific probe for the mRNA of the SACM1L gene are: SACM1L-mRNA-F: 5'- GAGCAGACGACGTAGTTACC -3'; SACM1L-mRNA-R: 5'-TTGTTTGAGGTGCTCCTTAA-3'; SACM1L-mRNA-probe: 5'- CTGAGTTGTGGGCTACTCAG -3'; The specific detection primer pair and specific probe of hsa_circ_0123884 are: hsa_circ_0123884-F: 5'-AGAACACAATGTTGCAGTTAA-3'; hsa_circ_0123884-R: 5'-CTTTGAGCCACTGACGCAAT-3'; hsa_circ_0123884-probe: 5'- AGGCCCATCGGGTTTGCTTTTC -3'; The specific detection primer pair and specific probe of hsa_circ_0123885 are: hsa_circ_0123885-F: 5'- AGATATCGTACTTGCGATGTG -3'; hsa_circ_0123885-R: 5'-TCTACGAGTGGTGAGCTATT -3'; hsa_circ_0123885-probe: 5'- TGTGTGACAGGTACGAGTGT -3'; The specific detection primer pair and specific probe of hsa_circ_0123886 are: hsa_circ_0123886-F: 5'- TTGCAGAAGGTCAAGGTTGT -3'; hsa_circ_0123886-R: 5'- GGAGGGTGATGGTCTTTCAT -3'; hsa_circ_0123886-probe: 5'-ACGTATCGAGGGCACTGATT-3'; The specific detection primer pair and specific probe of hsa_circ_0123887 are: hsa_circ_0123887-F: 5'-TGGTATTAGAGTCCAGGCTC-3'; hsa_circ_0123887-R: 5'-CTAGGAGTGCAGTCAGTTGA-3'; hsa_circ_0123887-probe: 5'- TGGGAGTCAGGTGTCATTCT -3'; The specific detection primer pair and specific probe of hsa_circ_0123889 are: hsa_circ_0123889-F: 5'-AAGTGAGTACACCGCAGATA-3'; hsa_circ_0123889-R: 5'- CAGTGAGGGTGTTCTTGCAT -3'; hsa_circ_0123889-probe: 5'-GTCGGATGCTGTACAGGTG-3'.
2. The combination of a primer pair and a specific probe for mRNA and circular RNA mqPCR detection of the SACM1L gene according to claim 1, characterized in that: The mRNA-specific probe of the SACM1L gene, the hsa_circ_0123884-specific probe, the hsa_circ_0123888-specific probe 5, the hsa_circ_0123886-specific probe, the hsa_circ_0123887-specific probe and the hsa_circ_0123889-specific probe have a fluorescent group at the 5' end and a quenching group at the 3' end; the fluorescent group is any one of FAM, HEX, TET, JOE, NED, VIC, CY3, CY5, ROX or TAMRA or a combination of at least two; the quenching group is selected from any one of MGB, BHQ-1, BHQ-2, BHQ-3 or Phosphorothioate or a combination of at least two.
3. A detection kit for simultaneously detecting mRNA and circular RNA of SACM1L gene, characterized in that: The kit comprises the combination of the mRNA and circular RNA mqPCR detection primer pair and the specific probe of the SACM1L gene described in claim 1.
4. Use of a combination of the mRNA and circular RNA mqPCR detection primer pair and a specific probe for the SACM1L gene according to claim 1 or the detection kit according to claim 3 in the preparation of a reagent for simultaneously detecting the mRNA and circular RNA expression of the SACM1L gene.
5. The use according to claim 4, characterized in that: Extract RNA from the cell-derived sample, remove residual genomic DNA in the extracted RNA, reverse transcribe the RNA into cDNA, and amplify the mRNA of the SACM1L gene and the cDNA of the circular RNA using the mRNA and circular RNA mqPCR detection primer pair and specific probe of the SACM1L gene in claim 1.
6. The use according to claim 4, characterized in that: The total volume of the mqPCR reaction system used for expansion is 20 μL, including: 2×QPCR MIX 10 μL; 0.4 μL of each of the six pairs of upstream and downstream primers with a concentration of 10 μM; 0.1 μL of each of the six specific probes with a concentration of 10 μM; 1 μL of each of the cDNA diluted 5 times; and sterile water to a total volume of 20 μL.
7. The use according to claim 4, characterized in that: The amplification reaction conditions were as follows: the amplification program was 90°C for 5 min, 90°C for 30 s, 55°C for 15 s, 60°C for 30 s, and 40 cycles.
8. The use according to claim 4, characterized in that: The total RNA in the cell-derived sample was extracted by the Trizol method; the residual genomic DNA in the extracted RNA was removed by the DNA enzyme digestion method; the RNA was reverse transcribed into cDNA by a reverse transcription kit; the process of extracting the total RNA in the cell-derived sample by the Trizol method includes: adding 1 mL of trizol according to about 800,000 cells, blowing and lysing on ice for 3 minutes, then adding 150 μL of chloroform, vortexing for 30 seconds, placing on ice for 30 minutes, centrifuging at 4°C and 12000g for 20 minutes, taking 400 μL of the supernatant liquid into a new centrifuge tube with a pipette tip, adding 1 volume of isopropanol, and vortexing to mix thoroughly; centrifuging at 12000g for 20 minutes at 4°C, removing the supernatant with a pipette tip and retaining the precipitate; adding 1 mL of 75% ice-cold ethanol, gently inverting, and then centrifuging at 12000g for 10 minutes at 4°C, and discarding the supernatant; after the precipitate was dried at room temperature, adding 20 μL RNA is dissolved with DEPC water; the process of removing genomic DNA residues in the extracted RNA by DNA enzyme digestion method includes: the total volume of the reaction solution is 10 μL, specifically 6 μL of total RNA, 1.5 μL of DNase enzyme I, 1 μL of 10×buffer and 1.5 μL of enzyme-free water; after digesting the reaction solution at 37°C for 1.5 hours, the DNA digestion enzyme is inactivated at 80°C for 10 minutes; the process of reverse transcribing RNA into cDNA using a reverse transcription kit includes: in a reaction system and conditions of 2 μg of total RNA and 0.5 μL of random primers, firstly, RNA and random primers are mixed, denatured at 60°C for 10 minutes, and then immediately placed on ice; then 10 μL of 2× reverse transcription reaction solution is added, and the volume is supplemented to 20 μL with enzyme-free water, and the reaction conditions are set to 25°C for 15 minutes, 37°C for 15 minutes, 40°C for 15 minutes, and 80°C for 10 minutes.
9. Use of a combination of a primer pair and a specific probe for mRNA and circular RNA mqPCR detection of the SACM1L gene according to any one of claims 1 to 2 or a detection kit according to claim 3 in the preparation of a clinical diagnostic reagent and / or drug for auxiliary ovarian cancer.
10. Use of a combination of a primer pair and a specific probe for mRNA and circular RNA mqPCR detection of the SACM1L gene according to any one of claims 1 to 2 or a detection kit according to claim 3 in the preparation of an ovarian cancer-related targeted drug selection reagent and / or drug.