Genetically engineered bacterium for producing phospholipase D as well as construction method and application of genetically engineered bacterium

Abstract

The invention relates to a gene engineering bacterium for producing phospholipase D as well as a construction method and application of the gene engineering bacterium, and belongs to the technical field of gene engineering. The genetically engineered bacterium for producing phospholipase D uses escherichia coli as an expression host and plasmid as an expression vector to express phospholipase D. The recombinant phospholipase D is used for catalyzing phosphatidylcholine to generate the phosphatidyl ethanolamine, so that the high conversion rate of the phosphatidyl ethanolamine is realized, the conversion rate can reach 78.8%, and good phosphatidyl transfection capability is shown. Compared with the prior art, the method has the advantages of mild reaction conditions, high reaction rate, higher selectivity on raw materials and fewer reaction byproducts, and is beneficial to industrial production.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a genetic engineering bacterium producing phospholipase D and a construction method and application thereof. Background Art

[0002] Phosphatidylethanolamine, also known as cephalin, belongs to aminophospholipids. It is the most abundant phospholipid in prokaryotic cells and the second most abundant phospholipid in mammalian cells. Phosphatidylethanolamine usually provides 20%-50% of the total phospholipids in the cell membrane. Phosphatidylethanolamine is widely distributed in the brain, nervous system, heart, liver, kidney and other important organs. It is particularly abundant in brain tissue, accounting for about 45% of the total phospholipids. Phosphatidylethanolamine is one of the important phospholipid components of the cell membrane and can maintain the structure and function of the cell. In most eukaryotic cells, the cell membrane contains a large amount of phosphatidylethanolamine, which can form a lipid bilayer. Since lipids are fluid, they can promote the fluidity of the cell membrane. In addition, phosphatidylethanolamine also plays an important role in maintaining mitochondrial morphology, regulating insulin signal transduction, coagulation, antibacterial, and improving brain vitality.

[0003] Phospholipases are widely present in animal, plant and microbial cells, and mainly act on phospholipid compounds. According to the different action sites on the substrate, they can be divided into phospholipase A1 (Phospholipase A1; PLA1), phospholipase A2 (Phospholipase A2; PLA2), phospholipase C (Phospholipase C; PLC) and phospholipase D. Among them, the action site of phospholipase D (PLD; EC 3.1.4.4) is on the phosphodiester bond of phospholipid substrates, which can catalyze two types of reactions: phosphodiester bond hydrolysis and transacylation. The substrates that can be catalyzed include phosphatidylcholine, phosphatidylethanolamine and other soluble phospholipids. The commonly used industrial preparation method of phospholipase D is to extract the enzyme from plants with high phospholipase D content. However, although the phospholipase D content of plant tissues is higher than that of animal sources, it still cannot meet industrial needs. Therefore, the industrial production research of phospholipase D has gradually turned to microbial expression systems. The reported phospholipase D expression systems include Salmonella, Pseudomonas, Streptomyces, Corynebacterium, Bacillus, etc. The phospholipase D produced by the microbial expression system exhibits strong substrate tolerance and specificity. For example, the phospholipase D from Streptomyces exhibits higher activity and better substrate specificity in the transacylation reaction, which proves the good application prospects of phospholipase D from this source in industrial production.

[0004] At present, the main methods for preparing high-content phosphatidylethanolamine include solvent extraction, freeze crystallization, column chromatography, adsorption, supercritical fluid extraction, chemical synthesis and enzyme catalysis. In solvent extraction, freeze crystallization and adsorption, the PE content obtained is not high, while in column chromatography, the phosphatidylethanolamine product content obtained is high, but the preparation cycle is long, and the solvent is difficult to recover. The cost of supercritical fluid extraction is high, and the chemical synthesis method has more by-products, which pollutes the environment and is not conducive to industrial production. The enzyme catalysis method has mild reaction conditions, fast reaction rate, high selectivity for raw materials and fewer by-products than the chemical synthesis method. Phospholipase D can catalyze the mutual conversion of polar head groups of different phospholipid components through transphosphatidylation reaction. For example, when ethanolamine is contained in the solution, phospholipase D can catalyze the cleavage of the phosphodiester bond of phosphatidylcholine, so that the phosphatidyl group combines with ethanolamine to produce phosphatidylethanolamine. Therefore, phospholipase D can be used in industry to catalyze the synthesis of phosphatidylethanolamine from phosphatidylcholine, which is widely present in nature. At present, studies have found that the activity of phospholipase D in Streptomyces is generally higher than that of other strains, but the enzyme production cycle of Streptomyces is long and the cost is too high, which is not conducive to industrial production. On the other hand, most of the current methods use phospholipase D to catalyze the production of phosphatidylserine, and there are very few reports on the use of phospholipase D to catalyze the production of phosphatidylethanolamine, and the technology is not yet mature. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a genetically engineered bacterium producing phospholipase D and a construction method and application thereof.

[0006] The first object of the present invention is to provide a genetically engineered bacterium that produces phospholipase D, using Escherichia coli as an expression host and a plasmid as an expression vector to express phospholipase D; the gene sequence of the phospholipase D is shown in SEQ ID NO.1.

[0007] In one embodiment of the present invention, the plasmid is a pET series plasmid; the Escherichia coli is E. coli BL21.

[0008] The second object of the present invention is to provide a method for constructing a genetically engineered bacterium producing phospholipase D, comprising the following steps: connecting a gene encoding phospholipase D to a plasmid vector and recombinantly expressing it in a host Escherichia coli; the gene sequence encoding phospholipase D is shown in SEQ ID NO.2.

[0009] In one embodiment of the present invention, the plasmid is a pET series plasmid; the Escherichia coli is E. coli BL21.

[0010] The third object of the present invention is to provide a method for preparing phospholipase D, comprising the following steps: culturing the genetically engineered bacteria to an OD of 600is 0.6-0.8, and phospholipase D is expressed by induction.

[0011] In one embodiment of the present invention, the inducer is IPTG, and the concentration of the inducer is 0.1 mmol / L-0.5 mmol / L.

[0012] In one embodiment of the present invention, the induced expression is fermented at 16°C-37°C and 200rpm-220rpm for 12h-48h.

[0013] The third object of the present invention is to provide a phospholipase D prepared by the preparation method.

[0014] The fourth object of the present invention is to provide a method for preparing phosphatidylethanolamine, comprising the following steps: using phosphatidylcholine and ethanolamine as substrates, performing a shaking table oscillation reaction under the action of the phospholipase D to obtain phosphatidylethanolamine.

[0015] In one embodiment of the present invention, the shaking reaction is carried out at 30°C-40°C and 200rpm-220rpm for 10h-14h.

[0016] The technical solution of the present invention has the following advantages over the prior art:

[0017] (1) The phospholipase D-producing genetically engineered bacteria of the present invention successfully expressed phospholipase D through a series of optimization and selection of gene sequences, tags, expression vectors, expression strains, etc., and the enzyme activity was significantly improved compared to the unmodified strain, ultimately reaching 26.4 U / mL.

[0018] (2) The present invention uses a phospholipase D constructed by a genetically engineered bacterium producing phospholipase D to express in a shake flask fermentation, showing good activity. The phospholipase D can also catalyze the reaction between phosphatidylcholine and ethanolamine to generate phosphatidylethanolamine, and the conversion rate of phosphatidylethanolamine can reach 78.8%, showing good phosphatidyl transfer ability. Compared with the prior art, the reaction conditions are mild, the reaction rate is fast, the selectivity of the raw materials is high, and the by-products of the reaction are less, which is conducive to industrial production.

[0019] (3) The genetically engineered bacteria producing phospholipase D of the present invention have good stability and a short fermentation cycle, which provides the possibility for large-scale industrial production and has good application prospects in the fields of food, medicine and health care. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below according to specific embodiments of the present invention in conjunction with the accompanying drawings, wherein:

[0021] Figure 1 This is the protein electrophoresis diagram in Example 3 of the present invention;

[0022] Figure 2 The optimum reaction temperature and reaction temperature stability diagram in Example 5 of the present invention;

[0023] Figure 3 The optimum reaction pH and pH stability diagram in Example 5 of the present invention;

[0024] Figure 4 It is the liquid chromatogram of phosphatidylethanolamine in Example 6 of the present invention. DETAILED DESCRIPTION

[0025] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0026] In the present invention, unless otherwise explained, technical and scientific terms used in the present invention have the same meanings as commonly understood by those skilled in the art to which the present invention belongs.

[0027] In the present invention, unless otherwise stated, the term "and / or" used in the present invention includes any and all combinations of one or more of the associated listed items.

[0028] In the present invention, unless otherwise stated, the experimental methods used in the embodiments of the present invention are conventional methods unless otherwise stated, and the materials, reagents, etc. used are all commercially available unless otherwise stated.

[0029] (1) The culture medium involved in the following embodiments is as follows:

[0030] The formula of LB medium is: sodium chloride 10 g / L, yeast extract 5 g / L, tryptone 10 g / L, pH 7.0;

[0031] The formula of TB medium is: KH2PO4 17 mmol / L, K2HPO4·3H2O 72 mmol / L, glycerol 0.4% (v / v), yeast powder 24 g / L, and peptone 12 g / L.

[0032] (2) The reagents involved in the following examples are as follows:

[0033] Substrate solution: 10 mg phosphatidylcholine, 10 mg anhydrous calcium chloride, and 10 μL Triton X-100 dissolved in 10 mL 0.1 mol / L tris-hcl buffer.

[0034] Reaction termination solution: 0.334 g EDTA-2Na dissolved in 10 mL 1.0 mol / L tris-hcl buffer.

[0035] Color developing solution: 15 mg phenol, 12.5 mg, dissolved in 10 mL 0.1 mol / L tris-hcl buffer.

[0036] Colorimetric enzyme solution: 40 U choline oxidase and 40 U horseradish peroxidase were dissolved in 4 mL 0.1 mol / L tris-hcl buffer.

[0037] Example 1 Construction of genetically engineered bacteria producing phospholipase D

[0038] S1. By searching the NCBI gene library, a gene sequence of phospholipase D with high phosphatidyl transfer activity was screened out as a template. The gene sequence is shown in SEQ ID NO.1. Since the phospholipase D gene is derived from Streptomyces and the subsequent expression strain is Escherichia coli, in order to obtain a higher enzyme protein expression amount, the gene sequence is optimized for Escherichia coli codons to obtain a gene sequence encoding phospholipase D. The gene sequence is shown in SEQ ID NO.2, and finally the desired target gene fragment is synthesized;

[0039] S2, clone the target gene fragment into the expression vector pET28a(+) through the NcoI and HindIII restriction sites;

[0040] S3, the ligation product was introduced into the competent E. coli BL21 (DE3) and cultured on a kanamycin-resistant LB plate for 12 h;

[0041] S4, the colonies on the plate were verified by PCR and restriction digestion, and the strains carrying the target gene plasmid were sequenced to screen out positive transformants and preserve them;

[0042] S5. In this experiment, two different strains were constructed, namely E. coli BL21(DE3)-pET28a(+)-PLD without his tag and E. coli BL21(DE3)-pET28a(+)-hPLD with his tag.

[0043] As shown in SEQ ID NO.1:

[0044] gtgctggccg gcccgctcgc cgccgccctt cccgcgcgcg ccaccaccgg gacccccgcc

[0045] ttcctgcacg gcgtcgcctc cggggacccg ctcccggacg gcgtcctgct gtggacccgg

[0046] gtgacaccca ccgccgatgc gacgcccggc tccggactcg gcccggacac cgaggtcggc

[0047] tggaccgtgg ccacggacaa ggcgttcacg aacgtcgtcg ccaagggctc caccaccgcg

[0048] accgccgcct ccgaccacac ggtcaaggcc gacatccgcg gcctcgcgcc cgccaccgac

[0049] cactggttcc gcttctccgc cggcggcacc gactccccgg ccggccgcgc ccgcaccgct

[0050] cccgccgccg acgcggcggt cgcgggcctc cgcttcggcg tcgtctcctg cgccaactgg

[0051] gaggccggct acttcgccgc ctaccgccac ctcgccgccc gcggcgacct ggacgcctgg

[0052] ctgcacctcg gcgactacat ctacgagtac ggcgccggcg agtacggcac ccggggcacc

[0053] tccgtccgct cgcacgcccc cgcgcacgag atcctcaccc tcgccgacta ccgcgtccgg

[0054] cacggccggt acaagacgga ccccgacctc caggcgctgc acgccgccgc cccggtcgtg

[0055] gcgatctggg acgaccacga gatagccaac gacacctggt ccggcggcgc cgagaaccac

[0056] accgagggcg tcgagggcgc ctgggccgcc cgccaggccg ccgccaagca ggcctacttc

[0057] gagtggatgc cggtccgccc ggcgatcgcc ggcaccacct accgccggct gcgcttcggc

[0058] aagctcgccg acctctccct gctcgacctg cgctccttcc gcgcgcagca ggtctccctc

[0059] ggcgacggcg acgtcgacga cccggaccgc acgctcaccg ggcgcgccca gctcgactgg

[0060] ctcaaggcgg gcctgaagtc ctccgacacc acctggcggc tggtcggcaa ctcggtgatg

[0061] atcgcgccct tcgccatcgg ctcgctctcc gccgagctgc tgaagccgct ggccaagctg

[0062] ctcggcctgc cccaggaggg cctggccgtc aacaccgacc aatgggacgg ctacaccgac

[0063] gaccgccgcg aactcctcgc ccacctgcgg tcgaacgcga tccgcaacac ggtcttcctc

[0064] accggcgaca tccacatggc ctgggccaac gacgtcccgg tgaacgccgg tacgtacccg

[0065] ctgtcggcgt ccgccgccac ggagttcgtg gtcacctcgg tcacctccga caacctcgac

[0066] gacctcgtga aggtccccga gggcaccgtc tccgccctcg cctcgccggt catccgcgcg

[0067] gccaaccggc acgtccactg ggtcgacacc gaccgccacg gctacggcgt cctggacatc

[0068] accgccgagc gggcgcagat ggactactac gtcctgtccg accgcaccca ggccggcgcg

[0069] acggcctcct ggagccgctc ctaccgcacg cgcagcggca cgcagagggtcgagcgcacctacgaccccg agtag。

[0070] As shown in SEQ ID NO.2:

[0071] tgttagcagg acccttagcc gctgctctg ccagcccgtg ccaccactgg gacgccagca

[0072] ttcttgcacg gggtcgctag tggagatcct ttgcctgacg gagttttgct gtggactcgt

[0073] gtcacaccta cggccgatgc taccccaggc agcggccttg gccctgatac ggaggtgggg

[0074] tggacagtag caactgataa ggcctttact aacgtagtcg ctaaggggag cacgactgcg

[0075] accgccgctt ccgatcatac tgtaaaagct gatattcgcg ggcttgctcc cgctacagat

[0076] cactggttcc gtttctcggc aggcggtact gattcccccg ctgggcgcgc tcgtacggcc

[0077] ccagctgcgg atgcagcggt agctgggctt cgctttggag tcgttagttg cgcgaactgg

[0078] gaggccggat acttcgcggc ctatcgtcat ctggctgcac gtggtgacct ggacgcctgg

[0079] ttgcacctgg gtgactatatttatgaatat ggcgctggag agtacggcac ccgtgggacg

[0080] agtgtccgtt cacacgcgcc agcgcatgaa attcttactttggccgactatcgcgtgcgc

[0081] cacggccgtt acaaaacgga tcccgacctg caagcacttc acgcggctgc gccagttgtt

[0082] gcaatttggg acgaccatga aatcgccaac gacacatgga gtggaggtgc tgaaaaccac

[0083] acagagggcg ttgagggagc gtgggcagcc cgtcaagctg cagcaaaaca ggcttacttt

[0084] gaatggatgc cagtgcgtcc tgccattgca ggcaccacgt accgtcgtct gcgttttggc

[0085] aaattagcgg acttgagcct gttggacctg cgctcctttc gtgcacagca agttagcctt

[0086] ggtgacggag atgttgatga tccggatcgt acgttgacag ggcgcgcaca gcttgattgg

[0087] ttgaaggccg gcttaaaatc cagtgatacg acctggcgcc tggtcggtaattccgtcatg

[0088] atcgctccat ttgctatcgg ctcgctttcc gctgaattac tgaaaccctt agcaaagctg

[0089] ttgggactgc cacaagaggg cttggcggtc aatacggatc agtgggacgg gtataccgac

[0090] gatcgtcgtg aattacttgc ccatcttcgt agcaacgcga tccgcaacac tgtattcctg

[0091] acgggagata ttcatatggc gtgggctaac gatgtgcctg tgaacgcggg cacatatccc

[0092] ttatccgcta gtgcagccac cgagttcgtg gtgacaagtg taacgtcaga caatctggac

[0093] gacctggtca aagtccccga aggcacggtt agcgctttgg cttccccagt aatccgcgca

[0094] gccaaccgtc acgttcattg ggttgacact gatcgtcacg gatacggcgt tttagacatc

[0095] acggcggaac gcgcgcagat ggactattac gtcctgagcg accgcacgca agctggggcc

[0096] acggcatcgt ggtcccgctc gtatcgtaca cgctcaggaa ctcagcgcgt ggaacgcacc

[0097] tacgacccgg agtaa.

[0098] Example 2 Inducible expression of phospholipase D

[0099] S1. Strain activation: Add kanamycin with a final concentration of 50 μg / mL to 10 mL of LB liquid culture medium, inoculate 20 μL of the bacterial solution of the genetically engineered bacteria in the bacterial preservation tube, and culture on a shaker at 37°C and 220 rpm overnight.

[0100] S2. Expanded culture: Add kanamycin with a final concentration of 50 μg / mL to 50 mL of TB medium, inoculate into the medium at a 1% inoculum, and culture at 37° C., 220 rpm in a shaker until the logarithmic phase.

[0101] S3. Induce expression: measure the absorbance of the bacterial solution at 600 nm after expansion culture. When it reaches between 0.6-0.8, add the inducer IPTG with a final concentration of 0.5 mmol / L, change the reaction temperature to 25°C, and ferment at 220 rpm for 36 hours.

[0102] S4. After the induction fermentation is completed, the bacterial solution is placed at 4°C, 8000rpm and centrifuged for 15 minutes, the supernatant is discarded, a certain amount of tris-hcl (pH=7.5) solution is added to resuspend the precipitate, so that the bacteria are distributed in the solution, and the bacteria are ultrasonically broken at a power of 300W, working for 3s, with an interval of 5s, and continuing for 30min. After the ultrasonication is completed, centrifuge at 4°C, 10000rpm for 15min, collect the supernatant, and filter with a 0.22μm filter membrane to obtain a phospholipase D solution.

[0103] Example 3 Protein molecular weight detection of phospholipase D

[0104] Prepare separation gel and concentration gel according to the SDS-PAGE kit formula, take 32μL sample and add 8μL of 5X protein loading buffer, mix thoroughly, boil in water for 10min to denature the protein, cool and centrifuge at 12000rpm for 2min, take 20μL sample, and then run the gel at 80V in electrophoresis buffer. After the sample runs to the interface of the concentration gel and separation gel, adjust the voltage to 120V and continue running the gel for about 45min until the sample runs to the bottom of the gel. The SDS-PAGE results are as follows Figure 1 As shown. Figure 1 It can be seen that product A is hPLD and product B is PLD, with a molecular weight of about 57 kDa, and the protein expression level of product B is significantly higher than that of product A, indicating that the his tag will affect the protein expression of phospholipase D. Therefore, product B was used for subsequent experiments.

[0105] Example 4 Detection of the hydrolase activity of phospholipase D

[0106] 200 μL of substrate solution was fully mixed with 100 μL of phospholipase D solution, and reacted in a water bath at 37°C for 5 min. After the reaction was completed, 50 μL of reaction stop solution was added, and the water bath was boiled for 5 min; after cooling to room temperature, 20 μL of color development solution and 20 μL of color development enzyme solution were added in sequence, mixed, and placed in a shaker at 37°C for 2 h, and the absorbance of the sample was measured at 505 nm, a standard curve was established, and the enzyme activity was calculated to be 26.4 U / mL.

[0107] In addition, the enzyme activity of the commercially available phospholipase D (source leaf) was compared with that of the commercially available phospholipase D under the same experimental conditions, and was 16 U / mL. It can be seen that the phospholipase D of the present invention has a higher enzyme activity.

[0108] Example 5 Study on the enzymatic properties of phospholipase D

[0109] (1) The phospholipase D of Example 2 was placed in a water bath at 30°C-70°C for 8 h. The residual enzyme activity was measured using the original enzyme solution as a control group according to the method of Example 4 to explore the temperature stability of the phospholipase D. The reaction temperature was controlled at 30°C-70°C. The optimal reaction temperature of the phospholipase D was explored using the highest enzyme activity measured as a control group according to the method of Example 4. The results are as follows: Figure 2 As shown. Figure 2 It can be seen that in the experiment to explore the temperature stability of phospholipase D, as the temperature continues to rise, the enzyme activity continues to decrease. At 50°C, the enzyme activity can still be retained at 85% of the initial enzyme activity, but when the temperature continues to rise, the enzyme activity will decrease rapidly. At 70°C, the enzyme activity is only 31% of the initial enzyme activity, indicating that too high a temperature will inhibit the activity of phospholipase D. The reason is that high temperature destroys the spatial structure of phospholipase D, resulting in a decrease in its enzyme activity; in the experiment to explore the optimal reaction temperature of phospholipase D, as the temperature continues to rise, the enzyme activity will continue to rise, reaching the highest at 60°C, and then continue to rise in temperature, the enzyme activity will continue to decrease, indicating that the optimal reaction temperature of this phospholipase D is 60°C.

[0110] (2) Prepare 0.1 mol / L different pH (pH 4.0-9.0), take the phospholipase D in Example 5, dilute the same amount with the above buffer solutions of different pH by 10 times, place at 4°C for 6 h, and measure the residual enzyme activity of the original enzyme solution as the control group according to the method of Example 4 to explore the pH stability of phospholipase D; control the reaction pH in the above buffer solution, and explore the optimal reaction pH of phospholipase D according to the method of Example 4, with the highest enzyme activity measured as the control group. The results are as follows: Figure 3 As shown. Figure 3 It can be seen that in the experiment to explore the pH stability, both the overly acidic and alkaline environments have an inhibitory effect on the enzyme activity. At a pH of 7.5, the enzyme activity is 92.8% of the initial enzyme activity, indicating that phospholipase D has the highest stability in an environment of pH 7.5; in the experiment to explore the optimal reaction pH, as the pH continues to rise, the enzyme activity also continues to rise, reaching the highest at pH 8.0, and then increasing the buffer pH, the enzyme activity will continue to decrease, indicating that the optimal reaction pH of phospholipase D is 8.0.

[0111] Example 6 Phospholipase D catalyzes phosphatidylcholine to produce phosphatidylethanolamine

[0112] 9 mL of ethyl acetate was used as the organic phase for the reaction, and 30 mg of phosphatidylcholine was fully dissolved in the organic phase; 3 mL of acetic acid-sodium acetate buffer (pH = 6.0) was used as the aqueous phase, 0.5 mL of ethanolamine, 2 mL of phospholipase D solution, and 10 mmol / L of anhydrous calcium chloride were fully dissolved in the aqueous phase, and the organic phase and the aqueous phase were fully mixed by ultrasound, and the reaction solution was placed at 40°C and shaken at 200 rpm for 12 hours, and the conversion rate of phosphatidylethanolamine was 78.8%.

[0113] After the reaction is completed, a certain amount of organic phase is mixed with chloroform: methanol (2:1, v / v) in equal volumes. After extraction for a period of time, centrifuge for 10 minutes at 4°C and 2500rpm. A certain amount of the lower organic phase is taken and diluted with chloroform to make its concentration 50% of the original concentration. After filtering through a 0.22μm organic membrane, HPLC is used to detect and analyze the product phosphatidylethanolamine. The conditions of HPLC are: Shimadzu LC-20A evaporative light scatterer, chromatographic column is UltimateSiO24.6×250mmol / L5μm, mobile phase is acetonitrile / methanol (6:4, v / v), needle washing agent is 50% methanol, flow rate is 1mL / min, injection volume is 10μL, drift tube temperature is 50°C, gain value is 6, nitrogen flow rate is 1L / min, and the analysis results of HPLC are as follows: Figure 4 As shown. Figure 4 It can be seen that the substrate phosphatidylcholine is not completely consumed, and the product phosphatidylethanolamine is generated. According to the area ratio obtained by integration, it can be calculated that the substrate phosphatidylcholine remains at 19.2%, other impurities are generated at 2%, and the conversion rate of the product phosphatidylethanolamine is 78.8%.

[0114] In addition, the phospholipase D (source leaf) purchased from the market was compared, and under the same experimental conditions, the conversion rate of the product phosphatidylethanolamine was 60%. It can be seen that the phospholipase D of the present application exhibits good phosphatidyltransferase ability in catalyzing phosphatidylcholine to generate phosphatidylethanolamine.

[0115] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A genetically engineered bacterium producing phospholipase D, characterized in that: Escherichia coli is used as an expression host and a plasmid is used as an expression vector to express phospholipase D; the gene sequence of the phospholipase D is shown in SEQ ID NO.

1.

2. The genetically engineered bacterium producing phospholipase D according to claim 1, characterized in that: The plasmid is a pET series plasmid; the Escherichia coli is E. coli BL21.

3. A method for constructing a genetically engineered bacterium producing phospholipase D as claimed in claim 1 or 2, characterized in that: The method comprises the following steps: connecting a gene encoding phospholipase D with a plasmid vector, and recombinantly expressing the gene in a host Escherichia coli; the gene sequence encoding phospholipase D is shown in SEQ ID NO.

2.

4. The method for constructing a genetically engineered bacterium producing phospholipase D according to claim 3, characterized in that: The plasmid is a pET series plasmid; the Escherichia coli is E. coli BL21.

5. A method for preparing phospholipase D, characterized in that: The method comprises the following steps: culturing the genetically engineered bacteria according to claim 1 or 2 to an OD of 600 is 0.6-0.8, and phospholipase D is expressed by induction.

6. The method for preparing phospholipase D according to claim 5, characterized in that: The inducer is IPTG, and the concentration of the inducer is 0.1 mmol / L-0.5 mmol / L.

7. The method for preparing phospholipase D according to claim 5, characterized in that: The induced expression is carried out at 16°C-37°C and fermented at 200rpm-220rpm for 12h-48h.

8. A phospholipase D prepared by the preparation method according to any one of claims 5 to 7.

9. A method for preparing phosphatidylethanolamine, characterized in that: The method comprises the following steps: taking phosphatidylcholine and ethanolamine as substrates, carrying out a shaking reaction under the action of the phospholipase D described in claim 8, and obtaining phosphatidylethanolamine.

10. The method for preparing phosphatidylethanolamine according to claim 9, characterized in that: The shaking reaction is carried out at 30°C-40°C and at 200rpm-220rpm for 10h-14h.

Images