Gene sequence fragment related to content of amylose in red rice and method for improving content of amylose in red rice

Abstract

The invention relates to the technical field of gene agriculture, in particular to a gene sequence fragment related to the content of amylose in red rice and a method for improving the content of the amylose in the red rice. The invention discloses a gene sequence segment related to the content of amylose in red rice, the nucleotide sequence of the gene sequence segment is shown as SEQ ID No.1, and the gene sequence segment is located in a promoter region of a Wx gene. The gene sequence segment, related reagents and a method can be applied to accurate regulation and control of rice amylose and molecular breeding practice of local high-quality rice in Guizhou. By editing or knocking out a gene sequence fragment, the expression quantity of the Wx gene can be moderately reduced, the amylose content of rice is further reduced, after the gene sequence fragment is knocked out, the expression of the Wx gene is moderately reduced, the amylose content of local high-quality red rice in Guizhou is reduced from 20% to about 5%, and the gel consistency is improved from 61mm to about 99mm. By editing or knocking out the gene sequence fragment, the amylose content of the red rice of local high-quality rice in Guizhou can be accurately improved, the rice quality of the rice is improved, popularization and planting of the variety are facilitated, and storage and utilization of high-quality germplasm resources are facilitated.

Description

Technical Field

[0001] The present invention relates to the field of gene agricultural technology, and in particular to a gene sequence fragment related to the amylose content of red rice and a method for improving the amylose content of red rice. Background Art

[0002] Rice is the most important food crop in the world, and more than half of the population relies on rice as their staple food. The white rice we eat daily is generally polished rice, which loses 80% of its nutrients during processing. Colored rice such as red rice is rich in anthocyanins, unsaturated fatty acids, oryzanol, vitamins and various minerals. It has the effects of anti-oxidation, scavenging free radicals, controlling blood sugar and anti-aging, and is a food with high nutritional value. However, red rice is mainly consumed as brown rice, which has poor taste and is not as palatable as the white rice and polished rice we usually eat, and is difficult to digest, so it is rarely used as a staple food. Therefore, red rice is only used as a coarse grain and occasionally appears on the table. Directed improvement of the amylose content of red rice, improving its palatability, and cultivating delicious and nutritious red rice varieties are of great significance to promoting the development of the red rice industry.

[0003] "Pi Gu Nian" is a high-quality characteristic germplasm resource in Guizhou, collected in Panzhou City, Guizhou Province. As a member of Panzhou red rice, it was listed as a national geographical indication product in 2016. Its rice is ruddy in color, rich in nutrients, and has medicinal effects such as anti-oxidation and hypoglycemic, making it one of the rices that can be used as both medicine and food. However, "Pi Gu Nian" has a high content of amylose (about 20%). In addition, because red rice is mainly consumed with brown rice, it has a hard taste and is difficult to digest. Its high nutritional quality but poor taste limits its promotion and application. How to reduce the amylose content of "Pi Gu Nian" and improve its palatability is an urgent problem to be solved.

[0004] Studies have shown that starch is the main component of rice endosperm (accounting for 90% of dry weight). The content, composition and structure of starch determine the softness and palatability of rice. Generally speaking, cooked rice grains with low or medium amylose content have elastic, sticky and smooth texture and better palatability (Li H, Prakash S, Nicholson TM, et al. The importance of amylose and amylopectin fine structure for textural properties of cooked rice grains. Food Chemistry, 2016, 196: 702-711.). The Wx gene is the main effect gene controlling the content of amylose. The gene encodes GBSSI enzyme to catalyze the synthesis of amylose (Wang Z, Wu Z L, Xing YY, et al. Nucleotide sequence of rice waxy gene. Nucleic Acids Research, 1990, 18 (19): 5898.). The diversity of amylose content is largely attributed to the allele variation of the Wx locus, and the glutinous and non-glutinous properties of rice are also caused by the variation of the Wx gene. To date, at least 8 Wx alleles Wxlv, Wxa, Wxin, Wxb, Wxop, Wxhp, Wxmq and Wx have been shown to be associated with five types of amylose content in rice varieties (Zhang C, Zhu J, Chen S, et al. Wxlv, the ancestral allele of rice Waxy gene. Molecular Plant, 2019, 12 (8): 1157-1166.). Different Wx loci show different amylose content and cooking quality (Lin L, Wang Y, Xu X, et al. Relationships between starch molecular components and eating and cooking qualities of rice using single-segment substitution lines with different Wx loci. Journal of Cereal Science, 2023, 114: 103765.). In addition to Wx, FLO19, BEIIb, and BEIIa also play a certain role in the regulation of rice amylose.

[0005] Knocking out the coding region of the Wx gene will cause the complete loss of Wx gene expression, and the rice will directly become sticky rice with almost no amylose. Therefore, how to coordinate the amylose content and excellent nutritional quality of rice, especially red rice such as "Pi Gu Nian", and accurately improve the amylose content of red rice such as "Pi Gu Nian" without changing its quality is not only a practical need to improve the taste quality of rice, but also a need for sustainable agricultural development. Summary of the invention

[0006] In order to solve the above problems existing in the prior art, the present invention provides a gene sequence fragment related to the amylose content of red rice and a method for improving the amylose content of red rice, which is specifically achieved through the following technical scheme.

[0007] A gene sequence fragment related to the content of amylose in red rice, the gene sequence fragment is located in the region 2206-2183 bp upstream of the start codon of the promoter region of the starch granule-binding enzyme Wx gene and the region 2050-2027 bp upstream of the start codon of the Wx gene. Its nucleotide sequence is shown in SEQ ID No. 1:

[0008] SEQ ID No.1:

[0009]

[0010] The gene sequence fragment comprises a CT region with or without A inserted in the middle of 2034-2033 bp.

[0011] The gene sequence fragment is used in rice improvement and breeding.

[0012] Furthermore, in the rice improvement and breeding, specifically inhibiting or knocking out the gene sequence fragment can effectively reduce the amylose content of rice; overexpressing the gene sequence fragment can effectively increase the amylose content of rice.

[0013] The method for editing a gene sequence fragment comprises the following steps:

[0014] The CRISPR / Cas9 system is used, and the target sequence of the sgRNA is located in the promoter region, and the sequence connected to the 3' end of the target sequence is NGG; the length of the target sequence is 19-20bp, and N is any one of A, T, G, and C. Genome editing can be specifically achieved with the help of the CRISPR / Cas9 system. In the CRISPR / Cas9 method, the target sequence is the XXX sequence located on any nucleotide sequence including XXXNGG in the Wx gene. Designing the target sequence of the sgRNA of the CRISPR / Cas9 system in the promoter region can effectively ensure that the expression of the target gene is moderately reduced.

[0015] Furthermore, the target sequence is located in the region 2206-2183bp upstream of the start codon of the Wx gene and the region 2050-2027bp upstream of the start codon of the Wx gene. After gene editing, a mutant rice plant can be obtained, in which one or two of the target sequences on the mutant rice plant are mutated.

[0016] Furthermore, the sgRNAs are sgRNA1 and sgRNA2; the target sequence of sgRNA1 is shown in SEQ ID No.4, and the target sequence of sgRNA2 is shown in SEQ ID No.5:

[0017] SEQ ID No.4: Target 1: 5'-CATCGATCATCCCTTTGTCGAGG-3' (SEQ ID No.4, as shown in the segment 2206-2183 bp away from the start codon ATG of the Wx gene on SEQ ID No.1, PAM is AGG);

[0018] SEQ ID No.5: Target 2: 5'-CGCCCTGCATGAGAAGCTCGCGG-3' (SEQ ID No.5, as shown in the segment 2050-2027 bp away from the start codon ATG of the Wx gene on SEQ ID No.1, and PAM is CGG).

[0019] A method for accurately improving the amylose content of red rice is carried out by inhibiting or knocking out the gene sequence fragment.

[0020] Furthermore, the inhibition or knockout of the gene sequence fragment is performed by using the above-mentioned editing method to obtain a mutant red rice plant after gene editing, in which one or two of the target sequences on the red rice plant are mutated.

[0021] The red rice finally obtained after gene editing is a plant that meets the following conditions: the base sequence of the promoter region of the Wx gene mutates in the target region of one or two sgRNAs. Genetically modified red rice is understood to include not only the first to second generation transgenic rice, but also its progeny. For transgenic rice, the gene can be inherited in the species, and the gene can also be transferred into other varieties of the same species using conventional breeding techniques, especially commercial varieties. The transgenic rice includes seeds, callus, complete plants and cells.

[0022] A method for creating new rice germplasm with high amylose content, which can be achieved by inhibiting or knocking out the above gene sequence fragment in the target rice.

[0023] The gene editing reagents / methods described in the present application can be used to inhibit the expression of the Wx gene, and / or to reduce the abundance of the Wx protein, and / or to knock out the Wx gene, and to be used in rice molecular breeding; mutant plants are obtained after treatment with the reagents, and the relative expression level of the Wx gene in the Wx-1 material of the mutant plants is significantly reduced to about 0.3 compared with the wild-type Pi Gu Nien, while the relative expression level of the Wx gene in the Wx-2 and Wx-3 materials does not show a significant decrease compared with the wild-type Pi Gu Nien.

[0024] Compared with the prior art, the technical effects created by the present invention are embodied in:

[0025] The inventors of the present application have found that the promoter sequence of the Wx gene is a key gene site that affects the amylose content of rice and leads to palatability. Different Wx gene sites will lead to different amylose contents. The present invention uses gene editing technology to knock out multiple segments of the promoter sequence of the granule-bound starch synthase Wx gene in "Pi Gu Nian". It is found that after a special segment upstream of its ATG is knocked out, the expression of the Wx gene decreases moderately, and the amylose content of "Pi Gu Nian" decreases from 20% to about 5%, and the gel consistency increases from 61mm to about 99mm. The present invention can be applied to the precise regulation of rice amylose and the molecular breeding practice of Guizhou local high-quality rice. The present invention provides a method for reducing the amylose content by moderately reducing the expression of the Wx gene. The specific embodiment of the present invention proves that by editing the promoter sequence of the Wx gene, the amylose content of Guizhou local high-quality rice "Pi Gu Nian" can be accurately improved, the rice quality can be improved, the promotion and planting of the variety can be facilitated, and the preservation of high-quality germplasm resources can be facilitated. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a comparison chart of the appearance phenotype, amylose content, total starch and gel consistency of different rice varieties in Example 1.

[0027] Figure 2 Schematic diagram of the promoter sequence knockout target design of the Wx gene in Example 1.

[0028] Figure 3 This is the vector skeleton diagram of Example 1.

[0029] Figure 4 Schematic diagram of sequencing after knockout of sequences at different sites in the promoter of the Wx gene.

[0030] Figure 5 The relative expression levels of the Wx gene in the mutants with sequence knockout at different sites in the promoter of the Wx gene (mean±SD, n=6).

[0031] Figure 6 The amylose content of mutants with different sequence deletions in the promoter of the Wx gene (mean±SD, n=6).

[0032] Figure 7 The gel consistency of the mutants with different sequence knockouts in the promoter of the Wx gene (mean±SD, n=6).

[0033] Figure 8 This is the sequencing results of the Wx gene promoter sequence mutant strain Wx-1-4 in Example 2.

[0034] Fig. 9 This is the sequencing result of the Wx gene promoter sequence mutant strain Wx-1-7 in Example 2.

[0035] Fig.10 This is the sequencing result of the Wx gene promoter sequence mutant strain Wx-1-12 in Example 2.

[0036] Fig.11 Comparison of appearance, brown rice rate, 1000-grain weight and proanthocyanidin content of three strains of the Wx gene promoter sequence mutants in Example 2 (mean±SD, n=6). DETAILED DESCRIPTION

[0037] The technical solution of the present invention is further limited below in conjunction with specific implementation methods, but the scope of protection is not limited to the description. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art; the experimental methods used are conventional methods, and the materials, reagents, etc. used can all be obtained from commercial channels.

[0038] The expression vectors pYLsgRNA-OsU3, pYLsgRNA-OsU6a, and binary vector pYLCRISPR / Cas9Pubi-H are available from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences.

[0039] The transcript used in the following examples is Wx-1, which is only used as an example and does not limit the editing site in the application. Unless otherwise specified, the examples are all carried out according to conventional experimental conditions or product instructions. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.

[0040] Example 1: Construction of promoter knockout vector

[0041] The applicant has previously collected materials of high-quality rice "Pi Gu Nian" from Guizhou Province (the materials were planted in Guiyang, Guizhou), and found that "Pi Gu Nian" has a higher content of amylose ( Figure 1 AB, C), with a lower total starch content ( Figure 1 AB, D), low viscosity ( Figure 1 D) Among them, Figure 1 In the figure, A is the appearance phenotype of rice skin drum sticky, Xiahuang sticky, Niuwei sticky, Chishi, Hongxu and weedy rice 31; B is the statistics of amylose content; C is the statistics of total starch content; D is the gel consistency test; BD statistical data are: mean±SD, n=3. The results were analyzed for significant differences using Duncan test, and lowercase letters are marked above the data. In the same figure, different lowercase letters indicate significant differences, p<0.05, the same below.

[0042] 1. Target sequence selection

[0043] The coding sequence of "Pi Gu Nian" Wx is the sequence shown in SEQ ID No.2 in the sequence table, and its amino acid sequence is shown in SEQ ID No.3; the promoter sequence of the Wx gene is the sequence shown in SEQ ID No.1 in the sequence table.

[0044] SEQ ID No.1 (5'-3', underline indicates Target 1 and Target 2):

[0045] TGTATCTGGTTTTGCGGTTGAAGGACGGAAATTGGATTTATTGACAAGTCAAGGGACCTTAGATGAACTTATTCCTTTTTAATTTGCACAGGCCTAATTTCAAGTCCAGCCCAGCTTTCCTTCAGCCTGTTT GATAATTCTCTCTAGCTTATTACAGCCGTGGGAGAGGAGATATACAGCTACAAGATTACAAGTCGATGTATACAGCAAACCCATGAGCTGATTGCCTGATTAGACGGTAAGAATGCATCCCTGAGAAGCAAA TGCATCACCAAATTTGTAGCTTAGATAAATGCTGTGACCTGCAAGAAAATAAAATTAAAATCAAAATAAAAGAAAAGCGCAGGTAATTGACACCCCACGCATATAAGTGTAGATACATAACACGTTCATCTA ATCATCTTAATTAGACTTAGGTAAAACTACAATGAGGTTTATGTCCCTACGGAATGACGACAAGCTAGCAGCACAGAGGCACAGATCATATCGTCTCCAGACTCAAGTGCACGTTGATCGTTCGCTCACTGCTT CATCGATCATCCCTTTGTCGAGG CGTTAGTTGGCAGGCACTAATAGCTACAGTAAAGTAAAGAGCAACGTGCCAACGTACGCACGCTAACGTGAGTCATGTAGCGTAATTCCAAGTTCTTTTTTTTTTTGTCAGCACGTACAAGCAGCCGCTAGCCT CGCCCTGCATGAGAAGCTCGCGG

[0046] SEQ ID No.2(5’-3’):

[0047]

[0048] SEQ ID No.3:

[0049] MSA LTT SQL ATS ATG FGI ADR SAP SSL LRH GFQ GLKPRS PAG GDA TSL SVTTSA RAT PKQ QRS VQR GSR RFP SVVVYA TGA GMN VVF VGA EMA PWS KTG GLG DVL GGLPPAMAA NGH RVM VIS PRY DQY KDA WDT SVV AEI KVA DRYERV RFF HCY KRG VDR VFIDHPSFL EKV WGK TGE KIY GPDTGV DYK DNQ MRF SLL CQA ALE APR ILN LNN NPY FKG TYGEDVVFV CND WHT GPL ASY LKN NYQ PNG IYRNAK VAF CIHNIS YQG RFA FED YPE LNL SER FRSSFD FID GYD TPV EGRKIN WMK AGI LEA DRV LTV SPY YAE ELI SGI ARG CEL DNIMRL TGITGI VNG MDV SEW DPS KDK YIT AKY DAT TAI EAKALN KEA LQA EAG LPV DRK IPL IAFIGR LEE QKG PDV MAAAIP ELM QED VQI VLL GTG KKK FEK LLK SME EKY PGK VRAVVK FNAPLA HLI MAG ADV LAV PSR FEP CGL IQL QGM RYGTPC ACA STG GLV DTV IEG KTG FHMGRL SVD CKV VEP SDVKKV AAT LKR AIK VVG TPA YEE MVR NCM NQD LSW KGPAKN WEN VLLGLG VAG SAP GIE GDE IAP LAK ENV AAP*

[0050] The promoter sequence of Wx in "Pi Gu Nian" has been amplified and sequenced in the early stage. The double target of CRISPR vector was designed for the region where the cis-elements of the promoter sequence of the gene are more concentrated, and the promoter sequence knockout vector was constructed. For details, see Figure 2The carrier and the obtained material of the combination of Target 1 and Target 2 are named Wx-1, the carrier and the obtained material of the combination of Target 3 and Target 4 are named Wx-2, and the carrier and the obtained material of the combination of Target 5 and Target 6 are named Wx-3.

[0051] Among them, Wx-1 is used as an example for illustration, and its target sequence is as follows:

[0052] Target 1: 5'-CATCGATCATCCCTTTGTCGAGG-3'(SEQ ID

[0053] No.4, as shown in the segment 2206-2183 bp away from the start codon ATG of the Wx gene in SEQ ID No.1, PAM is AGG);

[0054] Target 2: 5'-CGCCCTGCATGAGAAGCTCGCGG-3' (SEQ ID No. 5, as shown in the segment 2050-2027 bp away from the start codon ATG of the Wx gene in SEQ ID No. 1, and PAM is CGG).

[0055] The sgRNA targeting Target 1 in the CRISPR / Cas9 method is recorded as sgRNA1, and the sgRNA targeting Target 2 in the CRISPR / Cas9 method is recorded as sgRNA2.

[0056] 2. Construction of sgRNA expression cassette

[0057] 1. Construction of sgRNA1 expression cassette pOsU3-WxgRNA

[0058] Using UF, gRNA-R, U3-OsWx-F, and U3-OsWx-R as primers, and pYLsgRNA-OsU3 plasmid as template, fusion PCR was performed to amplify the pOsU3-WxgRNA expression cassette. The pOsU3-WxgRNA expression cassette can encode sgRNA1, that is, the sgRNA1 expression cassette, and bacterial liquid PCR was performed. A positive single clone with a band size of about 0.8kb was selected for sequencing, and the sequencing primer was SP1. The specific primer sequences used are as follows:

[0059] U3-OsWx-F:

[0060] (SEQ ID No. 6, the sequence indicated by the wavy line is Target 1, and the sequence indicated by the underline is the linker sequence);

[0061] U3-OsWx-R:

[0062] (SEQ ID No. 7, the sequence indicated by the wavy line is reverse complementary to Target 1, and the sequence indicated by the underline is the linker sequence);

[0063] UF:5'- CTCCGTTTTACCTGTGGAATCG -3'(SEQ ID No.8);

[0064] gRNA-R:5'- CGGAGGAAAATTCCATCCAC -3' (SEQ ID No. 9).

[0065] The PCR product was diluted 10 times and used as the template for the second round of PCR amplification. The second round of PCR amplification was performed using BL and B2 as primers to introduce the BsaI enzyme recognition site. The primer sequences used are as follows:

[0066] BL:5'-TTCAGA GGTCTC TCTCGACTAGTATGGAATCGGCA GCAAAGG-3' (SEQ ID No. 10, the underlined sequence is the BsaI enzyme recognition site);

[0067] B2:5'-AGCGTG GGTCTC GTCAGGGTCCATCCACTCCAAGCT C-3′ (SEQ ID No. 11, the underlined sequence is the BsaI enzyme recognition site).

[0068] The amplified products were detected by agarose gel electrophoresis and the target fragments were purified and recovered.

[0069] 2. Construction of sgRNA2 expression cassette pOsU6a-WxgRNA

[0070] Using UF, gRNA-R, U6a-Wx-F, and U6a-Wx-R as primers, and pYLsgRNA-OsU6a plasmid as a template, fusion PCR was performed to amplify the pOsU6a-WxgRNA expression cassette. The pOsU6a-WxgRNA expression cassette can encode sgRNA2, which is the sgRNA2 expression cassette. The primer sequences used are as follows:

[0071] (SEQ ID No. 12, the sequence indicated by the wavy line is Target 2, and the sequence indicated by the underline is the linker sequence);

[0072] (SEQ ID No. 13, the sequence indicated by the wavy line is reverse complementary to Target 2, and the sequence indicated by the underline is the linker sequence);

[0073] UF: 5'-CTCCGTTTTACCTGTGGAATCG-3' (SEQ ID No. 8);

[0074] gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3' (SEQ ID No. 9).

[0075] The PCR product was diluted 10 times and used as the template for the second round of PCR amplification. The second round of PCR amplification was carried out using B2' and BR as primers to introduce the BsaI enzyme recognition site. The primer sequences used are as follows:

[0076] B2':5'-TTCAGA GGTCTC TCTGACACTGGAATCGGCAGCAA AGG-3' (SEQ ID No. 14, the underlined sequence is the BsaI enzyme recognition site);

[0077] BR:5'-AGCGTG GGTCTC GACCGACGCGTATCCATCCACTC CAAGCTC-3′ (SEQ ID No. 15, the underlined sequence is the BsaI enzyme recognition site).

[0078] The amplified products were detected by agarose gel electrophoresis and the target fragments were purified and recovered.

[0079] 3. Construction of the recombinant expression vector CRISPR-OsWx-1Target

[0080] The second round PCR purified product obtained in step 1 and the second round PCR purified product obtained in step 2 were constructed into pYLCRISPR / Cas9Pubi-H (see the vector skeleton diagram) by the "cut and ligate" method of conventional molecular experimental operation using restriction endonuclease BsaI and ligase T4ligase. Figure 3 ) and then transformed into DH5α, and single clones were picked.

[0081] The recombinant plasmid was sequenced to confirm that the correct expression vector was obtained, where the sequencing primers were:

[0082] SP1: 5'-CCGACATAGATGCAATAACTTC-3' (SEQ ID No. 16).

[0083] The correctly sequenced recombinant plasmid was named CRISPR-OsWx-1Target. For easy identification and distinction from other plasmids, we referred to it as Wx-1 plasmid. CRISPR-OsWx-1Target contains sgRNA1 expression cassette pOsU3-WxgRNA, sgRNA2 expression cassette pOsU6a-WxgRNA and cas9 encoding gene, and can express sgRNA1 and sgRNA2 as well as Cas9. The Wx-2 and Wx-3 plasmids were obtained in the same way. The difference between them and the Wx-1 plasmid is the different target sequences, as described above.

[0084] Example 2: Construction and phenotypic identification of the "Pi Gu Nien" plant with a specific segment of the Wx gene promoter knocked out

[0085] 1. Cultivation of "Pi Gu Nien" plants with special segments of Wx gene promoter knocked out

[0086] The Wx-1, Wx-2, and Wx-3 plasmids obtained in Example 1 were transformed into Agrobacterium EHA105 by conventional electroporation methods in the art, and the callus tissue of "Pi Gu Ni" was infected with Agrobacterium. The callus was screened with 50 mg / L of hygromycin, and the callus tissue was differentiated to obtain transformed seedlings in about 4 months. After hardening the seedlings for 1-2 weeks, they were transplanted into the soil. After the seedlings grew for about 3 months, the genomic DNA of the transformed seedlings was extracted, and the OsWx-1, OsWx-2, and OsWx-3 series of strains were amplified with specific primers.

[0087] The primer pair used to amplify OsWx-1 consists of OsWx-1-F and OsWx-1-R:

[0088] OsWx-1-F:5'-CAGCCGTGGGAGAGGAGAT-3', (SEQ IDNo. ​​17);

[0089] OsWx-1-R: 5'-TTGGGGTGTGCGTGGAGCG-3', (SEQ ID No. 18).

[0090] The genome editing material was selected, its fragment was amplified to obtain the product, and the product was sequenced to determine the mutation type. In this example, the "Pi Gu Nien" genetic transformation system was established and a series of mutant plants with reduced amylose content were obtained, and sequencing was performed for identification. The results showed that all three plasmids had obtained mutant plants with fragment knockout. Figure 4The gene mutation of different mutant plants was shown. After collecting seeds from individual plants, they were planted to obtain T1 generation materials. The rice leaf RNA of each T1 generation material was extracted, reverse transcribed into cDNA, and the real-time fluorescence quantitative PCR experiment of Wx gene was performed. The results showed that the relative expression of Wx gene in Wx-1 material decreased to about 0.3 compared with the wild type Pi Gu Nien, while the relative expression of Wx gene in Wx-2 and Wx-3 materials decreased significantly compared with the wild type Pi Gu Nien ( Figure 5 ). The amylose content of each material was counted and it was found that the amylose content in Wx-1 material was slightly reduced to about 5%, reaching the waxy level, while the amylose content of Wx-2 and Wx-3 was significantly reduced ( Figure 6 ).

[0091] 2. The "sticky skin" phenotype of knockout of a specific region of the Wx gene promoter

[0092] Different knockout materials of Wx were planted in the field, and the Wx gene resequencing results of three strains with double knockout of Wx gene promoter sequence targets 1, 2, targets 3, 4 and targets 5, 6 are as follows: Figure 4 The T1 generation lines with mutations at different sites were numbered Wx-1-4, Wx-1-7, and Wx-1-12. Figure 8 The sequencing results of the Wx-1-4 mutant are compared with the wild type, which has an A base inserted in target 2. Fig. 9 The sequencing results of the Wx-1-7 mutant were compared with the wild type, and a sequence between targets 3 and 4 was knocked out; Fig.10 The sequencing results of the Wx-1-12 mutant were compared with the wild type, and a sequence between targets 5 and 6 was knocked out; Fig.11 The appearance, brown rice rate, thousand-grain weight and proanthocyanidin content among the three mutant lines are shown. Figure 8-10 The mismatch between the front and back sequences in the sequencing graph is due to the sequencing error base that exists at the beginning of the sequencing reaction.

[0093] The field phenotypes of these materials were observed. Taking the wild type of "Pi Gu Nien" in the first figure as the control, it can be clearly seen that the amylose content of the three strains of the Wx mutant changed ( Fig.11 In order to identify the phenotype more accurately, the amylose content of the wild type and three Wx mutant strains of "Pi Gu Nien" and the relative expression of the Wx gene in each strain were measured and statistically analyzed. It was found that the relative expression of the Wx gene in the three Wx mutant strains was lower than that in the wild type strain, and the expression levels of each strain were between 0.3-0.7 times that of the wild type ( Figure 5 The amylose content of the three Wx mutant strains was significantly lower than that of the wild-type material, and only Wx-1 had a significantly higher gel consistency than the wild-type material ( Figure 6 , 7 ). The amylose and gel consistency of the three strains changed to some extent, especially the insertion of an A into the CT base on target 2 led to a significant change in amylose, indicating that the CT base on target 2 is a key site for regulating the amylose content in the promoter sequence of the Wx gene. It can be seen that the promoter region where target 2 is located is the core promoter region of the Wx gene, among which the CT base on target 2 (the segment of 2034-2033bp from the start codon ATG of the Wx gene) is the core promoter region that plays the most critical regulatory role.

[0094] Therefore, in Guizhou's high-quality local rice "Pi Gu Nian", by editing the specific promoter segment of the Wx gene, we can precisely reduce the content of amylose, help improve the quality and nutritional value of rice, and thus improve the market competitiveness of rice. In this way, we can produce rice that better meets consumer demand and contribute to the development of the rice planting industry.

[0095] Finally, it should be pointed out that the above embodiments are only representative examples of the present invention. Obviously, the technical solution of the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by ordinary technicians in this field should be considered as the protection scope of the present invention.

Claims

1. A gene sequence fragment related to the amylose content of red rice, characterized in that: The gene sequence fragment is located in the region 2206-2183 bp upstream of the start codon of the promoter region of the starch granule-type binding enzyme Wx gene and in the region 2050-2027 bp upstream of the start codon of the Wx gene.

2. The gene sequence fragment according to claim 1, characterized in that: It contains a CT region with or without an A insertion in the middle of 2034-2033 bp.

3. Use of the gene sequence fragment according to claim 1 in rice improvement and breeding.

4. The use according to claim 3, characterized in that In terms of rice improvement and breeding, specifically, inhibiting or knocking out the gene sequence fragment described in claim 1 can effectively reduce the amylose content of rice; overexpressing the gene sequence fragment described in claim 1 can effectively increase the amylose content of rice.

5. The method for editing a gene sequence fragment according to claim 1, characterized in that: The steps include: The CRISPR / Cas9 system is used, the target sequence of the sgRNA is located in the promoter region, and the sequence connected to the 3' end of the target sequence is NGG; the length of the target sequence is 19-20 bp, and N is any one of A, T, G, and C nucleotides.

6. The editing method according to claim 5, characterized in that: The target sequence is located in the region 2206-2183 bp upstream of the start codon of the Wx gene and in the region 2050-2027 bp upstream of the start codon of the Wx gene.

7. The editing method according to claim 5, characterized in that: The sgRNAs are sgRNA1 and sgRNA2; the target sequence of sgRNA1 is shown in SEQ ID No.4, and the target sequence of sgRNA2 is shown in SEQ ID No.5: SEQ ID No.4: Target 1: 5'-CATCGATCATCCCTTTGTCGAGG-3'; SEQ ID No. 5: Target 2: 5'-CGCCCTGCATGAGAAGCTCGCGG-3'.

8. A method for accurately improving the amylose content of red rice, characterized in that: Inhibit or knock out the gene sequence fragment according to claim 1.

9. The method according to claim 8, characterized in that The inhibition or knockout of the gene sequence fragment according to claim 1 is performed by the method according to claim 5, and after gene editing, a mutant red rice plant is obtained, in which one or two of the target sequences on the red rice plant are mutated.

Images