Method for synthesizing penoxinone through whole-cell transformation

Abstract

The invention provides a method for synthesizing penoxinone through whole-cell transformation. The method comprises the following steps: carrying out induced culture on a recombinant strain S2; and inoculating the thalli obtained by induced culture into a culture medium containing a substrate 1-(4-hydroxyphenol)-ethanol, and carrying out whole-cell transformation, thereby synthesizing to obtain the Qinxinone. The invention provides a biotransformation method capable of replacing a chemical synthesis method and a natural extraction method to synthesize the penoxinone, 1-(4-hydroxyphenol)-ethanol is subjected to whole-cell transformation by using the recombinant escherichia coli to generate the penoxinone, and the biotransformation method has the advantages of mild reaction conditions, low production cost, environmental protection and the like.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to a method for synthesizing cyanidinone through whole-cell transformation. Background Art

[0002] Qingxin ketone, also known as 3,4-dihydroxyacetophenone (3,4-DHAP), has obvious effects of dilating coronary arteries, reducing myocardial oxygen consumption, improving microcirculation, enhancing myocardial nutritional blood flow and dilating cerebral blood vessels. At the same time, it also has anti-platelet aggregation, anti-inflammatory, antioxidant, anti-melanin production and other effects. It also has certain clinical efficacy on pregnancy-induced hypertension.

[0003] At present, the methods for obtaining cyanidin include natural extraction and chemical synthesis. Among them, the natural extraction method is to separate and purify cyanidin from the leaves of plants such as Ilex baldii. This method will face some difficult-to-overcome difficulties in the actual operation process. For example, different extraction methods are not universal for obtaining plant raw materials for cyanidin, and some also require special instruments and process conditions, which greatly increases the extraction cost and process difficulty. In addition, the raw materials used for natural extraction often have low cyanidin content, and cyanidin is more volatile. Its content decreases significantly with the extension of the raw material storage time, resulting in the natural extraction of cyanidin. There are disadvantages such as large amount of processing materials, serious material waste, unstable output, and limited natural resource conditions.

[0004] The currently disclosed chemical synthesis method includes using anhydrous aluminum chloride as a catalyst and carbon disulfide as a reaction medium to prepare qingxin ketone by heating and reflux reaction, with a final yield of 37%; using acetic acid as an acetylation agent, boron trifluoride as a catalyst, and ether as a reaction medium, and reacting at 80°C for 4 hours to prepare qingxin ketone, with a final yield of 66.7%. Chemical synthesis is the main method for obtaining qingxin ketone at present, but there are problems such as toxic reaction reagents, difficult separation of reaction products, many reaction by-products, and difficult treatment of reaction wastes. Summary of the invention

[0005] The purpose of the present invention is to provide a biotransformation method for synthesizing chloranthene which can replace chemical synthesis and natural extraction methods, and utilizes recombinant Escherichia coli whole cells to transform 1-(4-hydroxyphenol)-ethanol / 4-hydroxyacetophenone to produce chloranthene, which has the advantages of mild reaction conditions, low production cost, and environmental protection.

[0006] In order to achieve the above-mentioned object, the present invention provides a method for synthesizing cyanidin by whole-cell transformation, characterized in that the method comprises: inducing the recombinant strain S2 to culture; and inoculating the bacteria obtained by the induced culture into a culture medium containing a substrate 1-(4-hydroxyphenol)-ethanol for whole-cell transformation to synthesize the cyanidin, wherein the recombinant strain S2 is obtained by transferring a plasmid containing the HPed gene and the HpaBC gene into Escherichia coli.

[0007] In a specific embodiment, the nucleotide sequence of the HPed gene is shown as SEQ ID NO:1, and the nucleotide sequence of the HpaBC gene is shown as SEQ ID NO:2.

[0008] In a specific embodiment, the induction culture conditions include: when OD 600 The induction is performed when the value is 0.4 to 0.8, the inducer is isopropyl thiogalactoside, and the final concentration of the inducer is 0.05 to 1.0 mmol·L -1 .

[0009] In a specific embodiment, the induction culture conditions also include: an induction temperature of 15 to 35° C. and an induction time of 12 to 20 hours.

[0010] In a specific embodiment, the concentration of the substrate 1-(4-hydroxyphenol)-ethanol is 5 to 15 mmol·L -1 The transformation temperature of the whole cell transformation is 25-45°C.

[0011] In a specific embodiment, the recombinant strain S2 is constructed by the following method:

[0012] Construction of pET-28a-Hped plasmid: using the Hped gene as a template, using the upstream primer P-Hped-F shown in SEQ ID NO:3 and the downstream primer P-Hped-R shown in SEQ ID NO:4, PCR amplification was performed to obtain the Hped gene fragment; firstly, the Hped gene fragment was recovered, and then the recovered fragment and the pET-28a expression vector were simultaneously digested with NcoI and XhoI, and finally, the two digested fragments were respectively connected to the pET-28a expression vector with T4 DNA ligase to obtain the pET-28a-Hped plasmid;

[0013] Construction of pET-28a-HpaBC plasmid: using HpaBC gene as template, using upstream primer P-HpaBC-F shown in SEQ ID NO:5 and downstream primer P-HpaBC-R shown in SEQ ID NO:6, PCR amplification is performed to obtain HpaBC gene fragment; firstly, the HpaBC gene fragment is recovered, and then the recovered fragment and pET-28a expression vector are simultaneously digested with NcoI and XhoI, and finally, the two digested fragments are respectively connected to the pET-28a expression vector with T4 DNA ligase to obtain pET-28a-HpaBC plasmid;

[0014] The pET-28a-Hped plasmid was digested with BamH I and Xho I, and the pET-28a-HpaBC plasmid was digested with Bgl II and Xho I to obtain the HpaBC fragment containing the T7 promoter, and the HpaBC fragment was connected with the pET-28a-Hped plasmid to obtain the pet-28a-Hped-HpaBC plasmid in a pseudo-operon configuration;

[0015] The pet-28a-Hped-HpaBC plasmid was introduced into E. coli BL21 (DE3) competent cells to obtain the recombinant strain S2.

[0016] The present invention also provides a method for synthesizing cyanidin by whole-cell transformation, the method comprising: inducing and culturing a recombinant strain S1; and inoculating the bacterial cells obtained by the induced culture into a culture medium containing a substrate 4-hydroxyacetophenone for whole-cell transformation to synthesize the cyanidin, wherein the recombinant strain S1 is obtained by transferring a plasmid containing the HpaBC gene into Escherichia coli.

[0017] In a specific embodiment, when OD 600 The induction is performed when the value is 0.4 to 0.8, the inducer is isopropyl thiogalactoside, and the final concentration of the inducer is 0.05 to 1.0 mmol·L -1 ;

[0018] In a specific embodiment, the induction culture conditions also include: an induction temperature of 15 to 35° C. and an induction time of 12 to 20 hours.

[0019] In a specific embodiment, the concentration of the substrate 4-hydroxyacetophenone is 5 to 15 mmol·L -1 The transformation temperature of the whole cell transformation is 25-45°C.

[0020] The beneficial effects of the present invention include at least:

[0021] 1. The present invention provides a method for synthesizing qingxin ketone by whole-cell transformation, the method comprising: inducing and culturing the recombinant strain S2; and inoculating the bacterial bodies obtained by the induced culture into a culture medium containing the substrate 1-(4-hydroxyphenol)-ethanol for whole-cell transformation, and synthesizing the qingxin ketone, wherein the recombinant strain S2 is obtained by transferring a plasmid containing the Hped gene and the HpaBC gene into Escherichia coli; the method can also be: inducing and culturing the recombinant strain S1; and inoculating the bacterial bodies obtained by the induced culture into a culture medium containing the substrate 4-hydroxyacetophenone for whole-cell transformation, and synthesizing the qingxin ketone, wherein the recombinant strain S1 is obtained by transferring a plasmid containing the HpaBC gene into Escherichia coli. The method for synthesizing qingxin ketone by whole-cell transformation provided by the present invention can replace the chemical synthesis method and the natural extraction method for synthesizing qingxin ketone, solve the defects of the existing technology for producing qingxin ketone, and has the advantages of mild reaction conditions (normal temperature and pressure), low production cost, and environmental protection.

[0022] 2. The use of Escherichia coli (E. coli) for the expression of Hped and HpaBC genes has the following advantages: on the one hand, the HpaBC enzyme protein comes from E. coli itself, and both E. coli and strain EbN1 are bacteria, so they have similar internal environments for gene expression, which is conducive to E. coli expressing active Hped and HpaBC enzyme proteins; on the other hand, the E. coli genome information is complete, molecular operations are simple, the growth cycle is short, harsh culture conditions are not required, and the transformed products are easy to separate, which is conducive to subsequent genetic modification and industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The roadmap for the synthesis of cyanidinone from 1-(4-hydroxyphenol)-ethanol using whole cells of the recombinant strain S2 is provided. Figure 1 Medium T7 , O, RBS and T7ter represent T7 promoter, operator, ribosome binding site and transcription terminator, respectively;

[0024] Figure 2 The results of the enzyme protein identification of the recombinant strain S2 provided in Example 2;

[0025] Figure 3 This is the liquid chromatogram of the chloranthone synthesized in Example 2;

[0026] Figure 4 It is a bar graph showing the different conversion times and the production amount of qingxin ketone when synthesizing qingxin ketone in Example 2;

[0027] Figure 5 The results of the identification of the enzyme protein of the recombinant strain S1 provided in Example 13;

[0028] Figure 6 This is the liquid chromatogram of the chloranthone synthesized in Example 13;

[0029] Figure 7 The mass spectrometry analysis results of the cyanidin synthesized in Example 13;

[0030] Figure 8 This is a bar graph showing the relationship between the conversion time and the production amount of chloranthone when chloranthone was synthesized in Example 13. DETAILED DESCRIPTION

[0031] The present invention is described in detail below with reference to the accompanying drawings and embodiments, but the present invention can be implemented in many different ways as limited and covered by the claims.

[0032] Please refer to Figure 1 The present invention provides a method for synthesizing cyanidin by whole-cell transformation, the method comprising: inducing and culturing a recombinant strain S2; and inoculating the bacteria obtained by the induced culture into a culture medium containing a substrate 1-(4-hydroxyphenol)-ethanol for whole-cell transformation to synthesize the cyanidin, wherein the recombinant strain S2 is obtained by transferring a plasmid containing the HPed gene and the HpaBC gene into Escherichia coli.

[0033] In the present invention, the Escherichia coli is E. coli BL21 (DE3).

[0034] In the present invention, the nucleotide sequence of the HPed gene is shown as SEQ ID NO:1, and the nucleotide sequence of the HpaBC gene is shown as SEQ ID NO:2.

[0035] Among them, SEQ ID NO.1:

[0036] ATGCTGCTGGAAGGCAAAACCGCGCTGGTTACCGGCGCGGGCAACGGCATCGGTCGTACCATTGCGCTGACCTACGCAGCTGAAGGCGCTAATGTTGTAGTGTCTGATATCTCTGACGAATGGGGTCGTGAAACTCTGGCACTGATTGAAGGTAAAGGTGGCAAAGCTGTTTTTCAGCACGCGGATACCGCTCACCCGGAAGATCACGATGAACTGATCGCAGCGGCGAAACGTGCCTTCGGTCGCCTGGATATCGCGTGTAACAACGCTGGTATTTCGGGTGAATTTACCCCGACCGCGGAAACCACTGATGCCCAGTGGCAGCGCGTTATTGGTATTAACCTGTCCGGTGTTTTCTACGGTGTTCGCGCGCAGATCCGTGCTATGCTGGAAACCGGTGGTGGCGCAATCGTCAACATCTCCAGCATTGCTGGTCAGATCGGTATTGAAGGTATCACCCCGTACACTGCTGCCAAGCACGGTGTAGTTGGTCTGACCAAAACGGTGGCGTGGGAATACGGCTCTAAAGGTATCCGTATCAACTCTGTAGGCCCGGCGTTCATTAATACCACTCTGGTGCAGAACGTTCCGCTGGAAACCCGTCGTCAGCTGGAACAGATGCATGCCCTGCGCCGTCTGGGTGAAACCGAAGAAGTTGCGAACCTGGTAGCATGGCTGTCCAGCGACAAAGCTTCCTT

[0037] CGTTACCGGTAGCTACTACGCGGTTGACGGCGGCTA

[0038] CTTAGCGCGCTAA

[0039] SEQ ID NO:2:

[0040]

[0041] Preferably, the recombinant strain S2 is obtained by transferring the pet-28a-Hped-HpaBC plasmid into E. coli BL21 (DE3).

[0042] Preferably, the recombinant strain S2 is constructed by the following method:

[0043] Step (1), constructing a pET-28a-Hped plasmid: using the HPed gene as a template, using the upstream primer P-Hped-F shown in SEQ ID NO:3 and the downstream primer P-Hped-R shown in SEQ ID NO:4, PCR amplification is performed to obtain an HPed gene fragment; firstly, the HPed gene fragment is recovered, and then the recovered fragment and the pET-28a expression vector are simultaneously digested with NcoI and XhoI, and finally, the two digested fragments are respectively connected to the pET-28a expression vector using T4 DNA ligase to obtain a pET-28a-Hped plasmid.

[0044] Preferably, the PCR amplification reaction system is 50 μL, including 1 μL template, 5 μL 10×PCR Buffer, and 10 mmol·L - 1 dNTP Mix 1μL, 10mmol·L -1 F and 10mmol·L -1 2 μL of each R primer, 0.5 μL of pfu DNA polymerase, and 38.5 μL of sterile deionized water.

[0045] Preferably, the PCR amplification reaction conditions are: pre-denaturation at 94°C for 3 min, 35 cycles (94°C for 30 s, 55°C for 30 s, 72°C for 1 min), and extension at 72°C for 5 min.

[0046] Among them, SEQ ID NO.3: 5'-CATG CCATGG GAATGCTGCTGGA AGGC-3'

[0047] SEQ ID NO:4: 5'-CCGCTCGAGTTAGGATCCTTAGCGCGCTAAGTAGCC-3'

[0048] It should be noted that the underline represents the restriction enzyme cutting site, CCATGG represents Nco I, CTCGAG represents Xho I, and GGATCC represents BamH I.

[0049] Step (2), constructing pET-28a-HpaBC plasmid: using HpaBC gene as template, using upstream primer P-HpaBC-F shown in SEQ ID NO:5 and downstream primer P-HpaBC-R shown in SEQ ID NO:6, PCR amplification is performed to obtain HpaBC gene fragment; firstly, the HpaBC gene fragment is recovered, and then the recovered fragment and pET-28a expression vector are simultaneously digested with NcoI and XhoI, and finally, the two digested fragments are respectively connected to the pET-28a expression vector with T4 DNA ligase to obtain pET-28a-HpaBC plasmid.

[0050] Preferably, the PCR amplification reaction system is 50 μL, including 1 μL template, 5 μL 10×PCR Buffer, and 10 mmol·L - 1 dNTP Mix 1 μL, 10 mmol·L -1 Upstream primer P-HpaBC-F and 10mmol·L -1 2 μL each of downstream primers P-HpaBC-R, 0.5 μL of pfu DNA polymerase, and 38.5 μL of sterile deionized water.

[0051] Preferably, the PCR amplification reaction conditions are: pre-denaturation at 94°C for 3 min, 35 cycles (94°C for 30 s, 55°C for 30 s, 72°C for 1 min), and extension at 72°C for 5 min.

[0052] Among them, SEQ ID NO.5: 5'-CATG CCATGG GCATGAAGCAGAATCTG-3'

[0053] SEQ ID NO:6:5'-CCG CTCGAG TCAACTAATGGTCATACC-3'

[0054] It should be noted that the underline represents the restriction enzyme cutting site, CCATGG represents Nco I, and CTCGAG represents Xho I.

[0055] It should be noted that in the present invention, there is no sequential order between step (1) and step (2).

[0056] Step (3), the pET-28a-Hped plasmid is digested with BamH I and Xho I, and the pET-28a-HpaBC plasmid is digested with Bgl II and Xho I to obtain the HpaBC fragment containing the T7 promoter, and the HpaBC fragment is connected to the pET-28a-Hped plasmid to obtain the pet-28a-Hped-HpaBC plasmid in a pseudo-operon configuration.

[0057] Step (4), introducing the pet-28a-Hped-HpaBC plasmid into E. coli BL21 (DE3) competent cells to obtain the recombinant strain S2.

[0058] The induction culture comprises: firstly inoculating the recombinant strain S2 into a LB liquid medium containing kanamycin and shaking the culture overnight, then inoculating the bacterial solution into a new LB liquid medium for shaking culture, and when the OD 600 When the value is 0.4-0.8, an inducer is added to the bacterial solution for induction culture.

[0059] Preferably, the induction culture conditions include: when OD 600 When the value is 0.4 to 0.8, the induction is performed, and the inducer is isopropylthiogalactoside (IPTG), and the final concentration of the inducer is 0.05 to 1.0 mmol·L -1 .

[0060] As an inducer, IPTG can promote the expression of enzyme protein as the concentration increases, but its toxicity to cells will also increase. When the final concentration is between 0.05 and 1.0 mmol·L -1 This concentration can produce a good induction effect while not affecting the growth of bacteria due to high concentration.

[0061] Preferably, the induction culture conditions also include: an induction temperature of 15 to 35° C. and an induction time of 12 to 20 h.

[0062] The induction temperature determines the quantity and quality of the enzyme protein expression. When the induction temperature rises within a certain range, the enzyme gene expression rate can be accelerated, and the enzyme protein quantity of its encoding can also increase thereupon, but because they are too late to fold, a large amount of inclusion bodies tend to be formed in the cell. On the contrary, when the induction temperature decreases within a certain range, the enzyme gene expression rate can be slowed down, and the time for the enzyme protein folding can be lengthened thereupon, but the quantity of the enzyme protein can reduce, and finally cause the generation amount of the product to reduce.

[0063] More preferably, the induction culture conditions include: when OD 600 The induction was performed when the value was 0.6, and the final concentration of the inducer was 0.1 mmol·L -1 , the induction temperature was 25°C and the induction time was 16h.

[0064] The induction culture is specifically as follows: the recombinant strain S2 is inoculated into 5 mL containing 10 mg·L -1 In LB liquid medium containing kanamycin, at 37°C and 225 r / min -1The next day, the bacterial solution was inoculated into a new 50 mL LB liquid medium at a ratio of 1:50 and incubated at 37°C and 225 r·min -1 Shaking culture under the conditions; when the bacterial solution OD 600 When the concentration of the inducer is 0.4-0.8, add the inducer IPTG to the bacterial solution to make the final concentration of the inducer 0.05-1.0 mmol·L -1 , and at 15~35℃, 225r·min -1 The induction culture was carried out under the conditions, and the bacteria were collected after 12 to 20 hours of induction culture.

[0065] In the present invention, the bacterial solution obtained after the induction culture is subjected to 5000 r·min -1 Centrifuge for 10 min to collect the bacteria.

[0066] Preferably, the concentration of the substrate 1-(4-hydroxyphenol)-ethanol is 5 to 15 mmol·L -1 .

[0067] Preferably, the conditions for whole-cell transformation include: a transformation temperature of 25 to 45° C., and a transformation time of 1 to 60 h; more preferably, the conditions for whole-cell transformation include: a transformation temperature of 35° C., and a transformation time of 60 h.

[0068] In the present invention, if the conversion temperature of the whole cell conversion is too high or too low, the catalytic activity of the enzyme protein will be affected. When the conversion temperature is in the range of 47.5-60°C, the Hped enzyme protein will be inactivated.

[0069] Preferably, the conditions for whole-cell transformation further include: after the bacteria are inoculated into the culture medium containing the substrate 1-(4-hydroxyphenol)-ethanol, adjusting the bacteria OD 600 The value is 1.

[0070] Preferably, the whole cell transformation conditions also include: a rotation speed of 200 r·min -1 ~300r·min -1 More preferably, the speed is 225 r / min -1 .

[0071] The whole cell transformation is specifically: -1 The cells were suspended in 50 mL of M9Y medium containing 1-(4-hydroxyphenol)-ethanol, and the OD 600 The value is adjusted to 1, at 25-45℃, 200-300r·min -1 The reaction mixture is transformed under the conditions for 1 to 60 hours to obtain a fermentation liquid including the cyanidin ketone.

[0072] The fermentation liquid was heated at 3000 r.min. -1 After centrifugation for 15 min, the supernatant was collected, which included cyanocobalamin.

[0073] The present invention also provides a method for synthesizing cyanidin by whole-cell transformation, the method comprising: inducing and culturing a recombinant strain S1; and inoculating the bacterial cells obtained by the induced culture into a culture medium containing a substrate 4-hydroxyacetophenone for whole-cell transformation to synthesize the cyanidin, wherein the recombinant strain S1 is obtained by transferring a plasmid containing the HpaBC gene into Escherichia coli.

[0074] In the present invention, the nucleotide sequence of the HpaBC gene is shown in SEQ ID NO:2.

[0075] Preferably, the recombinant strain S1 is obtained by transferring the pET-28a-HpaBC plasmid into E. coli BL21 (DE3).

[0076] Preferably, the recombinant strain S1 is constructed by the following method:

[0077] Step (1), using the HpaBC gene as a template, using the upstream primer P-HpaBC-F shown in SEQ ID NO:5 and the downstream primer P-HpaBC-R shown in SEQ ID NO:6, PCR amplification is performed to obtain the HpaBC gene fragment.

[0078] Preferably, the PCR amplification reaction system is 50 μL, including 1 μL template, 5 μL 10×PCR Buffer, and 10 mmol·L - 1 dNTP Mix 1 μL, 10 mmol·L -1 Upstream primer P-HpaBC-F and 10mmol·L -1 2 μL each of P-HpaBC-R primers, 0.5 μL of pfuDNA polymerase, and 38.5 μL of sterile deionized water.

[0079] Preferably, the PCR reaction conditions are: pre-denaturation at 94°C for 3 min, 35 cycles (94°C for 30 s, 55°C for 30 s, 72°C for 1 min), and extension at 72°C for 5 min.

[0080] Step (2), firstly recover the HpaBC gene fragment, then digest the recovered fragment and the pET-28a expression vector with NcoI and XhoI, and finally connect the two digested fragments to the pET-28a expression vector with T4 DNA ligase to obtain the pET-28a-HpaBC plasmid.

[0081] Step (3) The pET-28a-HpaBC plasmid that had been connected overnight was transformed into E. coli BL21 (DE3) competent cells by heat shock method and then cultured with 10 mg·L -1 The recombinant E. coli with resistance was screened on a kanamycin LB solid plate to obtain the recombinant strain S1.

[0082] The induction culture comprises: firstly inoculating the recombinant strain S1 into a LB liquid medium containing kanamycin and shaking the culture overnight, then inoculating the bacterial solution into a new LB liquid medium for shaking culture, and when the OD 600 When the value is 0.4-0.8, an inducer is added to the bacterial solution for induction culture.

[0083] Preferably, the induction culture conditions include: when OD 600 When the value is 0.4 to 0.8, the induction is performed, and the inducer is isopropylthiogalactoside (IPTG), and the final concentration of the inducer is 0.05 to 1.0 mmol·L -1 .

[0084] As an inducer, IPTG can promote the expression of enzyme protein as the concentration increases, but its toxicity to cells will also increase. When the final concentration is between 0.05 and 1.0 mmol·L -1 This concentration can produce a good induction effect while not affecting the growth of bacteria due to high concentration.

[0085] Preferably, the induction culture conditions also include: an induction temperature of 15 to 35° C. and an induction time of 12 to 20 h.

[0086] The induction temperature determines the quantity and quality of the enzyme protein expression. When the induction temperature rises within a certain range, the enzyme gene expression rate can be accelerated, and the enzyme protein quantity of its encoding can also increase thereupon, but because they are too late to fold, a large amount of inclusion bodies tend to be formed in the cell. On the contrary, when the induction temperature decreases within a certain range, the enzyme gene expression rate can be slowed down, and the time for the enzyme protein folding can be lengthened thereupon, but the quantity of the enzyme protein can reduce, and finally cause the generation amount of the product to reduce.

[0087] More preferably, the induction culture conditions include: when OD 600 The induction was performed when the value was 0.6, and the final concentration of the inducer was 0.1 mmol·L -1 , the induction temperature was 25°C and the induction time was 16h.

[0088] The induction culture is specifically as follows: the recombinant strain S1 is inoculated into 5 mL containing 10 mg·L -1 In LB liquid medium containing kanamycin, at 37°C and 225 r / min-1 The next day, the bacterial solution was inoculated into a new 50 mL LB liquid medium at a ratio of 1:50 and incubated at 37°C and 225 r·min -1 Shaking culture under conditions; when OD 600 When the concentration of the inducer is 0.4-0.8, add the inducer IPTG to the bacterial solution to make the final concentration of the inducer 0.05-1.0 mmol·L -1 , and at 15~35℃, 200~300r·min -1 The induction culture was carried out under the conditions, and the bacteria were collected after 12 to 20 hours of induction culture.

[0089] In the present invention, the bacterial solution obtained after the induction culture is subjected to 5000 r·min -1 Centrifuge for 10 min to collect the bacteria.

[0090] Preferably, the concentration of the substrate 4-hydroxyacetophenone is 5 to 15 mmol·L -1 .

[0091] Preferably, the conditions for whole-cell transformation include: a transformation temperature of 25 to 45° C., and a transformation time of 1 to 60 h; more preferably, the conditions for whole-cell transformation include: a transformation temperature of 35° C., and a transformation time of 60 h.

[0092] In the present invention, if the conversion temperature of the whole cell conversion is too high or too low, the catalytic activity of the enzyme protein will be affected. When the conversion temperature is in the range of 47.5-60°C, the Hped enzyme protein will be inactivated.

[0093] Preferably, the conditions for whole-cell transformation further include: after the bacteria are inoculated into the culture medium containing the substrate 4-hydroxyacetophenone, adjusting the OD of the bacteria 600 The value is 1.

[0094] Preferably, the whole cell transformation conditions also include: a rotation speed of 200 r·min -1 ~300r·min -1 More preferably, the speed is 225 r / min -1 .

[0095] The whole cell transformation is specifically: -1 Suspend the cells in 50 mL M9Y medium containing 4-hydroxyacetophenone and adjust the OD 600 The value is 1, at 25-45℃, 200r·min -1 ~300r·min -1 The reaction mixture is transformed under the conditions for 1 to 60 hours to obtain a fermentation liquid including the cyanidin ketone.

[0096] The fermentation liquid was heated at 3000 r.min. -1 After centrifugation for 15 min, the supernatant was collected, which included cyanocobalamin.

[0097] Example

[0098] 1. Materials and reagents

[0099] Materials and reagents used in the following examples, unless otherwise specified, can be obtained from commercial sources. Specifically: pfu DNA polymerase, 200 bp DNA Ladder, agarose gel DNA recovery kit, protein relative molecular mass standard (MP171211) and plasmid extraction kit were purchased from TIANGEN; restriction endonucleases NcoⅠ, XhoⅠ, BamH I and T4 DNA ligase were purchased from Thermo Scientific; SDS-PAGE kit and isopropyl β-D-Thiogalactoside (IPTG) were purchased from Shanghai Shenggong Biotechnology Co., Ltd.; kanamycin (Kana) was purchased from Hefei Bomei Biotechnology Co., Ltd.

[0100] 2. Description of strains and plasmids

[0101] The strains and plasmids used in the examples are listed in Table 1.

[0102] Table 1 Sources of strains and plasmids used in the examples

[0103] Strains / plasmids characteristic source strain BL21(DE3) F-,ompT,hsdS(rBB-mB-),gal,dcm(DE3) This laboratory keeps Recombinant strain S1 BL21(DE3) containing pet-28a-HpaBC plasmid This study constructs Recombinant strain S2 BL21(DE3) containing pet-28a-Hped-HpaBC plasmid This study constructs Control strain S3 BL21(DE3) containing pet-28a plasmid This study constructs Plasmids pet-28a-Hped <![CDATA[Plasmid containing the Hped gene, Kana R > This study constructs pet-28a-HpaBC <![CDATA[Plasmid containing the HpaBC gene, Kana R > This study constructs pet-28a-Hped-HpaBC <![CDATA[Plasmid containing two genes, Hped and HpaBC, Kana R > This study constructs pet-28a <![CDATA[Empty gene expression plasmid, Kana R > This laboratory keeps

[0104] 3. Culture medium description

[0105] Luria-Bertani (LB) medium was used for plasmid amplification, strain preparation and protein induced expression.

[0106] LB medium includes: 5 g L -1 Yeast extract, 10 g L -1 Tryptone and 10 g L -1 NaCl.

[0107] M9Y medium was used for whole-cell transformation experiments.

[0108] M9Y medium includes: 17.1 g L -1 Na2HPO4·12H2O,3g·L -1 KH2PO4, 0.5 g·L -1 NaCl, 1 g L -1 NH4Cl,2g·L -1 Glucose, 7 g L-1 Yeast extract, 2 g L -1 Tryptone, 1mM MgSO4, 0.1mM CaCl2.

[0109] Example 1

[0110] Construction of recombinant bacterial group S2

[0111] Step 1.1, using the HPed gene as a template, using the upstream primer P-Hped-F shown in SEQ ID NO:3 and the downstream primer P-Hped-R shown in SEQ ID NO:4, PCR amplification was performed, and the PCR amplification reaction system was 50 μL, including 1 μL template, 5 μL 10×PCR Buffer, and 10 mmol·L -1 dNTP Mix 1μL, 10mmol·L -1 P-Hped-F and 10mmol·L -1 2 μL of each P-Hped-R primer, 0.5 μL of pfu DNA polymerase, and 38.5 μL of sterile deionized water; PCR reaction conditions were: pre-denaturation at 94°C for 3 min, 35 cycles (94°C for 30 s, 55°C for 30 s, 72°C for 1 min), and extension at 72°C for 5 min.

[0112] The amplified Hped gene fragment was first recovered using an agarose gel DNA recovery kit, then the recovered fragment and the pET-28a expression vector were simultaneously digested with NcoI and XhoI, and finally the two digested fragments were ligated to the pET-28a expression vector using T4 DNA ligase to obtain the pET-28a-Hped plasmid.

[0113] Step 1.2: Using the HpaBC gene as a template, PCR amplification was performed using the upstream primer P-HpaBC-F shown in SEQ ID NO:5 and the downstream primer P-HpaBC-R shown in SEQ ID NO:6. The PCR amplification reaction system was 50 μL, including 1 μL template, 5 μL 10×PCR Buffer, and 10 mmol·L -1 dNTP Mix 1μL, 10mmol·L -1 P-HpaBC-F and 10mmol·L -1 2 μL of each P-HpaBC-R primer, 0.5 μL of pfu DNA polymerase, and 38.5 μL of sterile deionized water; PCR reaction conditions were: 94°C pre-denaturation for 3 min, 35 cycles (94°C for 30 s, 55°C for 30 s, 72°C for 1 min), and 72°C extension for 5 min.

[0114] The amplified gene fragment was first recovered using an agarose gel DNA recovery kit, then the recovered fragment and the pET-28a expression vector were simultaneously digested with NcoI and XhoI, and finally the two digested fragments were ligated to the pET-28a expression vector using T4 DNA ligase to obtain the pet-28a-HpaBC plasmid.

[0115] Step 1.3, the pET-28a-Hped plasmid was digested with BamH I and Xho I, and the pET-28a-HpaBC plasmid was digested with Bgl II and Xho I to obtain the HpaBC fragment containing the T7 promoter; since BamH I and Bgl II are homozygous enzymes, HpaBC was connected to pET-28a-Hped to obtain the pet-28a-Hped-HpaBC plasmid in a pseudooperon configuration.

[0116] Step 1.4: Introduce the pet-28a-Hped-HpaBC plasmid into E. coli BL21 (DE3) competent cells to obtain the recombinant strain S2.

[0117] Example 2

[0118] Transformation and synthesis of cyanidinone by whole cell of recombinant strain S2

[0119] 2.1 Expression of recombinant strain S2 enzyme protein

[0120] The recombinant strain S2 was inoculated into a medium containing 10 mg·L -1 In LB liquid medium containing kanamycin, at 37°C and 225 r / min -1 The next day, the bacterial solution was inoculated into a new 50 mL LB liquid medium at a ratio of 1:50 and incubated at 37°C and 225 r·min -1 Shaking culture under conditions; when OD 600 When the concentration of IPTG was 0.6, the inducer IPTG was added to the bacterial solution to make the final concentration 0.5 mmol·L -1 ; at 15℃, 225r·min -1 The induction culture was carried out under the conditions of 16 h, and 1 ml of bacterial solution was taken for enzyme protein identification. The other bacterial solutions were heated at 5000 r·min. -1 The cells were collected after centrifugation for 10 min.

[0121] 2.2 Enzyme protein identification

[0122] In the present invention, the expression of enzyme protein is identified by SDS-PAGE electrophoresis experiment.

[0123] The identification results are shown in Figure 2 , Figure 2This is the prokaryotic expression result of pet-28a-Hped-HpaBC. Figure 2 M is the protein relative molecular mass standard, and lanes 1 and 3 are the control strain S3 and the recombinant strain S2 after 0.5 mmol·L -1 The results of IPTG induction for 0 h, lanes 2 and 4 are the control strain S3 and the recombinant strain S2 induced by 0.5 mmol·L -1 The results of IPTG induction for 16 h. Figure 2 It can be seen that in addition to the expression band of HpaBC enzyme protein, there is also an expression band close to the theoretical molecular weight of Hped enzyme protein 27.6kDa in the cells of the recombinant strain S2, which proves that the recombinant strain S2 was successfully constructed.

[0124] Among them, the control bacterial group S3 was obtained by introducing the pET-28a vector into E. coli BL21 (DE3) competent cells.

[0125] 2.3 Whole-cell conversion of cyanidin

[0126] With 5mmol·L -1 (690.8mg·L -1 The cells were suspended in 50 mL of M9Y medium containing 1-(4-hydroxyphenol)-ethanol and the OD 600 The value is adjusted to 1; at 35℃, 225r·min -1 The reaction mixture was transformed under the conditions for 60 h to obtain a fermentation broth including cyanidin.

[0127] 2.4 Detection of chloranthone

[0128] During the whole-cell transformation, 5 mL of fermentation broth was taken from M9Y medium every 12 h and heated at 3000 r·min. -1 After centrifugation for 15 min, the supernatant was collected and freeze-dried. The freeze-dried product was then reconstituted with 2 mL of methanol and filtered through a 0.22 μm filter head. 20 μL of the filtrate was passed through a column equipped with a UV detector and a C18 column (ZORBAX SB, 4.6×250 mm 2 , 5μm) high performance liquid chromatography (HPLC, Shimadzu, Japan) was used for qualitative and quantitative analysis.

[0129] Among them, the molecular weight of the target product in the filtrate was analyzed by Xevo G2-XS QTof LC-MS / MS (Waters, USA). The HPLC analysis mobile phase of the recombinant strain A sample consisted of methanol: 0.1% phosphoric acid aqueous solution (10:90). The column temperature was maintained at 40°C, the constant flow rate was 1mL / min, and the target product was detected at 276nm. For mass spectrometry analysis, the positive ion mode was used, the drying gas flow rate was 6L / min, the nebulizer pressure was 40Psig, the nebulizing gas temperature was 325°C, the sheath gas temperature was 350°C, the sheath gas flow rate was 12L / min, the capillary voltage was 4000V, and the mass spectrometry acquisition range was 50-1000m / z.

[0130] The quantitative results of Example 2 and Examples 3 to 11 below after conversion for 36 h are shown in Table 2.

[0131] The qualitative analysis results of Example 6 are detailed in Figure 3 As shown, Figure 3 This is the liquid chromatogram of the chloranone synthesized in Example 6. Standard is a standard product, wherein 1 is a 1-(4-hydroxyphenol)-ethanol standard product, 2 is a chloranone standard product, and 3 is a 4-hydroxyacetophenone standard product; S2 is a BL21 (DE3) containing a pet-28a-Hped-HpaBC plasmid, and S3 is a BL21 (DE3) containing a pet-28a plasmid. The asterisk represents the chloranone generated by whole cell transformation.

[0132] The quantitative analysis results of Example 6 are detailed in Figure 4 As shown, Figure 4 This is a bar graph showing the relationship between the conversion time and the production of chloranthene in Example 6. Figure 4 It can be seen that the yield of chloranthone is positively correlated with the conversion time.

[0133] Embodiment 3 to Embodiment 11

[0134] Study on the Optimal Conditions for the Synthesis of Cyanocortin by Whole Cell Transformation

[0135] In Examples 3 to 11, cyanocobalamin was synthesized by changing the induction culture conditions and the whole-cell transformation conditions to investigate the effects of the four factors of inducer concentration, induction temperature, transformation temperature and substrate concentration on the cyanocobalamin yield.

[0136] The data corresponding to each factor of Examples 3 to 11 and the corresponding yield of qingxinone in each Example are shown in Table 2. It should be noted that the conversion time corresponding to the yield of qingxinone in Table 2 is 36 hours.

[0137] Table 2 Reaction conditions and results of Examples 2 to 11

[0138]

[0139] It should be noted that the concentration unit mM in the above text is mmol / L.

[0140] Through range analysis and variance analysis, it was found that the order of influence of various factors on the yield of chloranthene was conversion temperature > induction temperature > IPTG concentration > substrate concentration. The optimal conditions were: conversion temperature 35℃, IPTG concentration 0.1mmol·L -1 , induction temperature 25℃ and substrate concentration 10mmol·L -1 .

[0141] The optimal condition combination (i.e., Example 6) showed that the recombinant strain S2 could steadily convert 1-(4-hydroxyphenol)-ethanol to chloranone within the selected time period. The chloranone yield after 60 h was 255 mg·L -1 , with a yield of 18.5% (see Figure 4 ).

[0142] Example 12

[0143] Construction of recombinant bacterial group S1

[0144] Step (a), using the HpaBC gene as a template, PCR amplification was performed using the upstream primer P-HpaBC-F shown in SEQ ID NO:5 and the downstream primer P-HpaBC-R shown in SEQ ID NO:6. The PCR amplification reaction system was 50 μL, including 1 μL of template, 5 μL of 10×PCR Buffer, and 10 mmol·L -1 dNTP Mix 1 μL, 10 mmol·L -1 P-HpaBC-F and 10mmol·L -1 2 μL of each P-HpaBC-R primer, 0.5 μL of pfu DNA polymerase, and 38.5 μL of sterile deionized water; PCR reaction conditions were: 94°C pre-denaturation for 3 min, 35 cycles (94°C for 30 s, 55°C for 30 s, 72°C for 1 min), and 72°C extension for 5 min.

[0145] In step (b), the amplified HpaBC gene fragment is first recovered using an agarose gel DNA recovery kit, then the recovered fragment and the pET-28a expression vector are simultaneously digested with NcoI and XhoI, and finally the two digested fragments are ligated to the pET-28a expression vector using T4 DNA ligase to obtain the pet-28a-HpaBC plasmid.

[0146] Step (c), introducing the pet-28a-HpaBC plasmid into E. coli BL21 (DE3) competent cells to obtain the recombinant strain S1.

[0147] Example 13

[0148] Transformation and synthesis of cyanidinone by whole cell of recombinant strain S1

[0149] 13.1 Expression of recombinant strain S1 enzyme protein

[0150] The recombinant strain S1 was inoculated into a medium containing 10 mg·L -1 In LB liquid medium containing kanamycin, at 37°C and 225 r / min -1 The next day, the bacterial solution was inoculated into a new 50 mL LB liquid medium at a ratio of 1:50 and incubated at 37°C and 225 r·min -1 Shaking culture under conditions; when OD 600 When the concentration of IPTG was 0.6, the inducer IPTG was added to the bacterial solution to make the final concentration 0.5 mmol·L -1 ; at 16℃, 225r·min -1 The induction culture was carried out under the conditions of 16 h, and 1 ml of bacterial solution was taken for enzyme protein identification. The other bacterial solutions were heated at 5000 r·min. -1 The cells were collected after centrifugation for 10 min.

[0151] 13.2 Enzyme Protein Identification

[0152] In the present invention, the expression of enzyme protein is identified by SDS-PAGE electrophoresis experiment.

[0153] The identification results are shown in Figure 5 , Figure 5 This is the prokaryotic expression result of pet-28a-HpaBC. Figure 5 M is the protein relative molecular mass standard, and lanes 1 and 3 are the control strain S3 and the recombinant strain S1 after 0.5 mmol·L -1 The results of IPTG induction for 0 h, lanes 2 and 4 are the control strain S3 and the recombinant strain S1 induced by 0.5 mmol·L -1 The results of IPTG induction for 16 h. Figure 5 It can be seen that expression bands close to the theoretical molecular weight of the HpaBC enzyme protein appeared in the cells of the recombinant strain S1, with the large subunit being 58.9 kDa and the small subunit being 18.5 kDa, which proves that the recombinant strain S1 was successfully constructed.

[0154] The control bacterial group S3 was obtained by introducing the pET-28a vector into E. coli BL21 (DE3) competent cells, and its transformation method and screening method were the same as those of the recombinant strain S1.

[0155] 13.3 Whole-cell conversion of cyanidin

[0156] With 5mmol·L-1 (690.8mg·L -1 The cells were suspended in 50 mL of M9Y medium containing 1-(4-hydroxyphenol)-ethanol and the OD 600 The value is adjusted to 1; at 35℃, 225r·min -1 The transformation was carried out under the same conditions for 24 hours to obtain a fermentation broth including cyanidin.

[0157] 13.4 Detection of cypermethrin

[0158] During the whole-cell transformation, 5 mL of fermentation broth was taken from M9Y medium every 12 h and heated at 3000 r·min. -1 After centrifugation for 15 min, the supernatant was collected and freeze-dried. The freeze-dried product was then reconstituted with 2 mL of methanol and filtered through a 0.22 μm filter head. 20 μL of the filtrate was passed through a column equipped with a UV detector and a C18 column (ZORBAX SB, 4.6×250 mm 2 , 5μm) high performance liquid chromatography (HPLC, Shimadzu, Japan) was used for qualitative and quantitative analysis.

[0159] Among them, the molecular weight of the target product in the filtrate was analyzed by Xevo G2-XS QTof LC-MS / MS (Waters, USA). The HPLC analysis mobile phase of the recombinant strain S1 sample consisted of methanol: 0.1% phosphoric acid aqueous solution (10:90). The column temperature was maintained at 40°C, the constant flow rate was 1mL / min, and the target product was detected at 276nm. For mass spectrometry analysis, the positive ion mode was used, the drying gas flow rate was 6L / min, the nebulizer pressure was 40Psig, the nebulizing gas temperature was 325°C, the sheath gas temperature was 350°C, the sheath gas flow rate was 12L / min, the capillary voltage was 4000V, and the mass spectrometry acquisition range was 50-1000m / z.

[0160] The qualitative analysis results are detailed in Figure 6 and Figure 7 shown. Figure 6 This is the liquid chromatogram of the cyanidin synthesized in Example 13. Standard is the standard, where 1 is the cyanidin standard and 2 is the 4-hydroxyacetophenone standard. S1 is BL21 (DE3) containing the pet-28a-HpaBC plasmid, and S3 is BL21 (DE3) containing the pet-28a plasmid. The asterisk represents the cyanidin generated by whole-cell transformation. Figure 7 The mass spectrometry analysis results of the qingxin ketone synthesized in Example 13, wherein A is the standard mass spectrum of qingxin ketone; B is the mass spectrum of qingxin ketone transformed by the recombinant strain S1; 153.05 is the mass spectrum of qingxin ketone plus H + The m / z after that.

[0161] The quantitative analysis results are detailed in Figure 8 As shown, Figure 8 This is a bar graph showing the relationship between the conversion time and the production of chloranone when synthesizing chloranone in Example 13. Figure 8 It can be seen that the yield of chloranthone is positively correlated with the conversion time.

[0162] The above content is a further detailed description of the present invention in combination with specific preferred embodiments, and it cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions and substitutions can be made without departing from the concept of the present invention, which should be regarded as belonging to the protection scope of the present invention.

Claims

1. A method for synthesizing cyanidin by whole-cell transformation, characterized in that: The method comprises: inducing the recombinant strain S2 to culture; and inoculating the bacterial cells obtained by the induced culture into a culture medium containing a substrate 1-(4-hydroxyphenol)-ethanol to perform whole-cell transformation to synthesize the cyanidin, wherein the recombinant strain S2 is obtained by transferring a plasmid containing the Hped gene and the HpaBC gene into Escherichia coli.

2. The method for synthesizing cyanidin by whole-cell transformation according to claim 1, characterized in that: The nucleotide sequence of the Hped gene is shown in SEQ ID NO: 1, and the nucleotide sequence of the HpaBC gene is shown in SEQ ID NO:

2.

3. The method for synthesizing cyanidin by whole-cell transformation according to claim 1, characterized in that: The induction culture conditions include: when OD 600 The induction is performed when the value is 0.4 to 0.8, the inducer is isopropyl thiogalactoside, and the final concentration of the inducer is 0.05 to 1.0 mmol·L -1 .

4. The method for synthesizing cyanidin by whole-cell transformation according to claim 3, characterized in that: The induction culture conditions also include: an induction temperature of 15 to 35° C. and an induction time of 12 to 20 hours.

5. The method for synthesizing cyanidin by whole-cell transformation according to claim 1, characterized in that: The concentration of the substrate 1-(4-hydroxyphenol)-ethanol is 5 to 15 mmol·L -1 The transformation temperature of the whole cell transformation is 25-45°C.

6. The method for synthesizing cyanidin by whole-cell transformation according to claim 1, characterized in that: The recombinant strain S2 was constructed by the following method: Construction of pET-28a-Hped plasmid: using the Hped gene as a template, using the upstream primer P-Hped-F shown in SEQ ID NO:3 and the downstream primer P-Hped-R shown in SEQ ID NO:4, PCR amplification was performed to obtain the Hped gene fragment; firstly, the Hped gene fragment was recovered, and then the recovered fragment and the pET-28a expression vector were simultaneously digested with NcoI and XhoI, and finally, the two digested fragments were respectively connected to the pET-28a expression vector with T4 DNA ligase to obtain the pET-28a-Hped plasmid; Construction of pET-28a-HpaBC plasmid: using HpaBC gene as template, using upstream primer P-HpaBC-F shown in SEQ ID NO:5 and downstream primer P-HpaBC-R shown in SEQ ID NO:6, PCR amplification is performed to obtain HpaBC gene fragment; firstly, the HpaBC gene fragment is recovered, and then the recovered fragment and pET-28a expression vector are simultaneously digested with NcoI and XhoI, and finally, the two digested fragments are respectively connected to the pET-28a expression vector with T4 DNA ligase to obtain pET-28a-HpaBC plasmid; The pET-28a-Hped plasmid was digested with BamH I and Xho I, and the pET-28a-HpaBC plasmid was digested with Bgl II and Xho I to obtain the HpaBC fragment containing the T7 promoter, and the HpaBC fragment was connected with the pET-28a-Hped plasmid to obtain the pet-28a-Hped-HpaBC plasmid in a pseudo-operon configuration; The pet-28a-Hped-HpaBC plasmid was introduced into E. coli BL21 (DE3) competent cells to obtain the recombinant strain S2.

7. A method for synthesizing cyanidin by whole-cell transformation, characterized in that: The method comprises: inducing the recombinant strain S1 to culture; and inoculating the bacterial cells obtained by the induced culture into a culture medium containing a substrate 4-hydroxyacetophenone to perform whole-cell transformation to synthesize the cyanidinone, wherein the recombinant strain S1 is obtained by transferring a plasmid containing the HpaBC gene into Escherichia coli.

8. The method for synthesizing cyanidin by whole-cell transformation according to claim 7, characterized in that: The induction culture conditions include: when OD 600 The induction is performed when the value is 0.4 to 0.8, the inducer is isopropyl thiogalactoside, and the final concentration of the inducer is 0.05 to 1.0 mmol·L -1 .

9. The method for synthesizing cyanidin by whole-cell transformation according to claim 8, characterized in that: The induction culture conditions also include: an induction temperature of 15 to 35° C. and an induction time of 12 to 20 hours.

10. The method for synthesizing cyanidin by whole-cell transformation according to claim 7, characterized in that: The concentration of the substrate 4-hydroxyacetophenone is 5 to 15 mmol·L -1 The transformation temperature of the whole cell transformation is 25-45°C.

Images