SNP (Single Nucleotide Polymorphism) molecular marker located on pig chromosome 7 and related to pig waistline and application of SNP molecular marker

Abstract

The invention belongs to the technical field of molecular biology and molecular markers, and particularly relates to an SNP molecular marker located on a pig chromosome 7 and related to the waistline of a pig and application of the SNP molecular marker, and the SNP site of the SNP molecular marker located on the pig chromosome 7 and related to the waistline of the pig corresponds to Cgt at the 5332818bp position on a chromosome 7 of an international pig reference genome version 11.1; t mutation; the molecular marker is obtained through whole genome association analysis, and can significantly influence the waistline character of the pig. The invention further provides a primer pair for identifying the molecular marker, an efficient and accurate molecular marker assisted breeding technology can be established by utilizing the molecular marker and the primer pair, and the molecular marker assisted breeding technology is applied to genetic improvement of pig waistline characters, so that the pig waistline is increased, the enterprise profit is increased, and the core competitiveness is improved.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biotechnology and molecular markers, and specifically relates to a SNP molecular marker located on pig chromosome 7 and associated with pig waist circumference and an application thereof. Background Art

[0002] At present, the main breeding goal in my country is still to produce large-weight lean pigs, and waist circumference, as an important body size trait, is closely related to many economic traits of livestock and poultry, and is therefore also considered an important selection criterion in livestock and poultry breeding. A positive correlation between chest circumference and back fat thickness has been reported for Duroc pigs. In addition, chest circumference is also closely related to pig weight (r>0.7). Vargas et al. found that the live weight of goats was linearly related to chest circumference and abdominal circumference. Although there are almost no studies on waist circumference in livestock, it has been reported that waist circumference can predict non-abdominal fat, abdominal subcutaneous fat, and visceral fat in humans. Therefore, understanding the genetic structure of chest circumference, abdominal circumference, and waist circumference will help improve economic traits related to these conformational traits.

[0003] Duroc pigs are one of the most popular commercial pig breeds in the world and are widely used as the terminal sire of Duroc Changda commercial pigs. As the terminal sire, Duroc directly affects the production performance of Duroc Changda, and the production performance of commercial pigs directly affects the economic benefits of the farm. Therefore, if the waist circumference traits of the core group Duroc pigs can be improved using molecular marker assisted selection (MAS) technology, the advantages obtained from the improvement can be passed on to commercial pig offspring to a large extent, enhancing the production competitiveness of commercial pigs and thus improving the economic benefits of the farm. Summary of the invention

[0004] In order to overcome the deficiencies and shortcomings of the prior art, the primary purpose of the present invention is to provide a SNP molecular marker located on pig chromosome 7 and associated with pig waist circumference.

[0005] Another object of the present invention is to provide the application of the above-mentioned SNP molecular marker located on pig chromosome 7 and related to pig waist circumference.

[0006] Another object of the present invention is to provide a primer pair for identifying the SNP molecular marker located on pig chromosome 7 and associated with pig waist circumference.

[0007] The fourth object of the present invention is to provide the application of the above primer pair.

[0008] A fifth object of the present invention is to provide a method for genetic improvement of pigs.

[0009] The purpose of the present invention is achieved through the following technical solutions:

[0010] A SNP molecular marker located on chromosome 7 of pigs and associated with pig waist circumference, the SNP site of which corresponds to the C>T mutation at 5332818bp on chromosome 7 of the international pig reference genome version 11.1;

[0011] The nucleotide sequence of the SNP molecular marker on chromosome 7 associated with pig waist circumference is shown in SEQ ID NO.1, wherein M in the sequence is C or T, resulting in different pig waist circumferences;

[0012] The SNP site of the SNP molecular marker related to pig waist circumference on pig chromosome 7 is the nucleotide mutation C40-T40 at position 40 of the sequence annotation of SEQ ID NO:1 (the 40th nucleic acid single base mutation in the sequence fragment is named: g.5332818C>T);

[0013] The SNP molecular marker located on chromosome 7 and associated with pig waist circumference is used in identifying the waist circumference trait and genetic breeding of Duroc pigs;

[0014] A method for detecting pig waist circumference traits comprises the following steps:

[0015] Detecting the SNP molecular marker on pig chromosome 7 and related to pig waist circumference, and whether the single nucleotide at position 5332818 at the 5' end of the SNP molecular marker is C or T;

[0016] The pig is preferably an American Duroc pig;

[0017] A primer pair for identifying the above-mentioned SNP molecular marker located on pig chromosome 7 and associated with pig waist circumference comprises primers primer-F and primer-R, and the nucleotide sequence thereof is as follows:

[0018] Upstream primer primer-F: 5′-TAGAGATGGTAAGTGGCGCC-3′;

[0019] Downstream primer primer-R: 5′-GAAGACAGGTGAGGCAGAGT-3′;

[0020] Application of the primer pair in identifying traits affecting waist circumference of breeding pigs;

[0021] Application of the primer pair in pig molecular marker-assisted breeding;

[0022] Application of the primer pair in increasing waist circumference of breeding pigs;

[0023] A method for genetic improvement of pigs, comprising the following steps:

[0024] Determine the SNP molecular markers related to pig waist circumference on chromosome 7 of the breeding pigs in the breeding pig core group, and make corresponding selections based on the molecular markers: hybridize the CT genotype individuals in the core group, and select the breeding pigs with TT genotype and CT genotype at the 5332818bp position on chromosome 7 of the international pig reference genome version 11.1 for the subsequent breeding of the offspring breeding pigs, and eliminate the breeding pigs with CC genotype at this point, so as to increase the frequency of the allele T at this site generation by generation, thereby increasing the waist circumference of the offspring pigs;

[0025] The pig is preferably an American Duroc pig;

[0026] Compared with the prior art, the present invention has the following advantages and effects:

[0027] (1) The present invention studies and determines that the molecular markers that affect pig waist circumference are located on the nucleotide sequence of chromosome 7 of the pig, verifies its effect on the pig waist circumference trait, and ultimately establishes a molecular marker-assisted selection breeding technology for rapid improvement of the pig waist circumference trait, which greatly improves the Duroc breeding process, adapts to the needs of the live pig market, increases the price of meat pigs, increases sales profits for enterprises, and improves core competitiveness.

[0028] (2) The present invention provides a primer pair for a SNP molecular marker located on chromosome 7 of pigs and associated with pig waist circumference. Through this primer pair, an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select traits and accelerate the breeding process. It can be applied to the genetic improvement of the waist circumference trait of breeding pigs, thereby increasing the waist circumference of pigs, thereby increasing corporate profits and increasing core competitiveness.

[0029] (3) The present invention provides a method for pig breeding by optimizing the dominant allele of the molecular marker, which can accelerate the genetic progress of Duroc pigs and shorten the time for Duroc improvement, thereby effectively improving the economic benefits of breeding pigs and increasing the profits of enterprises. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is a genome-wide association study (GWAS) analysis of the waist circumference of American Duroc breed pigs on chromosome 7; the horizontal axis represents the chromosome number of the pig; the vertical axis represents the -logP value.

[0031] Figure 2 This is an analysis chart of waist circumference results of pigs with different genotypes. DETAILED DESCRIPTION

[0032] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0033] Experimental pigs: A total of 3479 American Duroc pigs were used in this experiment.

[0034] Example 1

[0035] (1) Experimental animals

[0036] The experimental pig group used in the present invention is 3479 purebred American Duroc pigs from the pig breeding branch of Guangdong Wen's Food Group Co., Ltd., which is the core group of the pig breeding branch and has detailed herd pedigree records. The pigs selected in this experiment are fed and watered freely under unified feeding standards.

[0037] (2) Sample collection

[0038] The ear tissues of the above experimental pigs were collected, immersed in a 75% ethanol solution, and stored in a -20°C refrigerator for later use.

[0039] (3) Pig genome-wide 50K SNP typing

[0040] The method for extracting DNA from ear tissues was based on the phenol-chloroform method for extracting whole-genome DNA. The DNA of the purebred American Duroc population was tested for quality and concentration using a Nanodrop-ND1000 spectrophotometer. The A260 / 280 ratio was between 1.8 and 2.0, and the A260 / 230 ratio was between 1.7 and 1.9, which were considered qualified. Finally, the qualified DNA samples were uniformly diluted to 50 ng / μl. Whole-genome 50K SNP genotyping of pigs: GeneSeek Genomic Profiler Porcine 50K SNP typing platform, using the instructions and standard procedures of Illumina Infinium for chip hybridization and result scanning. Finally, the genotype data were read using GenomeStudio software.

[0041] (4) Pig whole genome 50K chip genotype filling

[0042] In addition, we also used the SWIM database (http: / / 192.168.142.36:9088 / # / home) to fill in the genotype data and obtained the genotype filling data of American Duroc pigs. To ensure the accuracy and reliability of the subsequent whole genome association analysis results, this study used PLINK v1.9 to perform quality control on the obtained genotype data, and eliminated the detection rate <90%, the mimor allele frequency (MAF) <1% or the deviation from Hardy-Weinberg Equilibrium (HWE) test P≤10 -6The SNP markers with detection rate <95% and pedigree Mendelian error rate higher than 0.1 were excluded, as well as SNPs at unknown positions and on sex chromosomes. The remaining 7442761 SNP markers and 3479 samples were used for subsequent data analysis.

[0043] (5) Genome-wide association study (GWAS)

[0044] In order to eliminate the population stratification effect, the present invention uses linear mixed model single point regression analysis combined with R language GenABEL software package to perform GWAS analysis. The similarity of genomes between individuals is used to correct the stratification effect in the analysis model. The chromosome significance threshold in this study was set at 1.00×10 -5 .

[0045] GWAS analysis results Figure 1 As shown. Figure 1 It can be seen that in Duroc, there is a locus on chromosome 7 that significantly affects waist circumference, and the strongest associated SNP is g.5332818C>T (P=4.65×10 -6 )(nucleotide No. 40 in SEQ NO.1, corresponding to the C>T mutation at bp 5332818 on chromosome 7 of the International Pig Reference Genome Version 11.1).

[0046] (6) Correlation analysis between different genotypes and waist circumference phenotypes of breeding pigs:

[0047] According to Table 1, the molecular marker SNP site g.5332818C>T is extremely significantly correlated with the waist circumference trait (P<0.01), indicating that this molecular marker significantly affects the waist circumference of pigs. Through auxiliary selection of this SNP site in pigs, the waist circumference of the group can be increased, thereby accelerating the breeding process of lean meat pigs. In addition, according to Table 1, Figure 2 It can also be seen that the waist circumference of CT type is higher than that of CC, indicating that homozygous CC is not good for the waist circumference of breeding pigs. Waist circumference is an important indicator to measure the growth performance of breeding pigs. A large waist circumference indicates good growth performance of pigs. Therefore, the growth performance of pigs with CC genotype is relatively unfavorable. In the process of breeding, we need to gradually eliminate CC type breeding pigs and retain CT type breeding pigs to increase the frequency of allele T at this site generation by generation.

[0048] Table 1 Correlation between molecular marker SNP site g.5332818C>T and traits

[0049]

[0050] Example 2 Detailed explanation of the invention process of detecting SNP markers

[0051] (1) The target fragment containing the SNP site significantly associated with the waist circumference performance of American Duroc is a 211 bp nucleotide sequence in chromosome 7. The upstream and downstream primers for sequence amplification are primer-F and primer-R, and their nucleotide sequences are as follows:

[0052] Upstream primer primer-F: 5′-AGGTCAGAGTGGGGCAGTAA-3′;

[0053] Downstream primer primer-R: 5'-AATGGGATTGGATGCGGGTT-3'.

[0054] (2) PCR amplification system and condition settings

[0055] A 10 μL system was prepared, including 1 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O. The PCR conditions were 95°C pre-denaturation for 5 min, 95°C denaturation for 30 s, 64°C annealing for 30 s, and 72°C extension for 30 s, for a total of 35 cycles, and the final extension was 72°C for 5 min.

[0056] (3) DNA sequencing identification: Sequencing was performed at Shenzhen BGI Genomics Co., Ltd., and the gene fragments were tested for both positive and negative reactions. The measured sequence was compared with the NCBI genome sequence to obtain the mutation of the corresponding SNP site. The sequencing results are shown below:

[0057] TAGAGATGGTAAGTGGCGCCCAGAGAGCATACCCTTTAC M(C / T) TGCAAGCCCACCACCCCAGAGCCCACGCCCCAACCACCTTTTTTACTGGGCTCTCACGCCGCTGGGCCAGTACCCATCTGCCCAACTAGGGCCCGCCCTGTGGCCCAGCACCTGCTGAAACTATTCAACCCAGCGAATCCTAAACCCTGCCTACTCTGCCTCACCTGTCTTC

[0058] Note: The M marked in the sequence is the mutation site, which is displayed with an underline (the mutated base in brackets is the allele mutation), and the bold at the beginning and end of the sequence is the primer sequence binding position.

[0059] Example 3 Analysis of the effect of the SNP site g.5332818C>T of the molecular marker

[0060] The present invention provides a SNP molecular marker that can significantly increase the waist circumference of Duroc breeding pigs. Using the SNP molecular marker for marker-assisted selection can greatly accelerate the waist circumference breeding process of Duroc breeding pigs. According to Table 1, the frequency of the dominant allele T of the SNP site g.5332818C>T in the group is 0.018. Therefore, through molecular marker-assisted selection, the pigs with the genotype CC in the group are gradually eliminated, which can significantly increase the allele frequency of allele T, increase the waist circumference of breeding pigs, indirectly increase the weight of breeding pigs, accelerate the improvement of lean meat pigs, and effectively improve the economic benefits of breeding pigs.

[0061] The present invention detects the 40th base mutation site in the SEQ ID NO:1 sequence and preliminarily performs an application of the association analysis between its genotype and waist circumference, thus providing a new molecular marker for molecular marker-assisted selection of breeding pigs.

[0062] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A SNP molecular marker located on pig chromosome 7 and associated with pig waist circumference, characterized in that: Its SNP site corresponds to the C>T mutation at 5332818bp on chromosome 7 of the international pig reference genome version 11.1; The nucleotide sequence of the SNP molecular marker related to pig waist circumference located on pig chromosome 7 is shown in SEQ ID NO.1, wherein M in the sequence is C or T, resulting in different pig waist circumference traits.

2. Use of the SNP molecular marker associated with pig waist circumference located on pig chromosome 7 according to claim 1 in identifying the waist circumference trait and genetic breeding of Duroc pigs.

3. A method for detecting pig waist circumference traits, characterized in that: The following steps are included: Detect the SNP molecular marker on pig chromosome 7 as claimed in claim 1 and related to pig waist circumference, wherein the 5332818th single nucleotide at the 5' end of the SNP molecular marker is C or T.

4. The method for detecting pig waistline traits according to claim 3, characterized in that: The pig is American Duroc.

5. A primer pair for identifying the SNP molecular marker located on pig chromosome 7 and associated with pig waist circumference as claimed in claim 1, characterized in that: Contains primers primer-F and primer-R, and their nucleotide sequences are as follows: Upstream primer primer-F: 5′-TAGAGATGGTAAGTGGCGCC-3′; Downstream primer primer-R: 5'-GAAGACAGGTGAGGCAGAGT-3'.

6. Use of the primer pair according to claim 5 in identifying traits affecting waist circumference of breeding pigs.

7. Use of the primer pair described in claim 5 in pig molecular marker-assisted breeding.

8. Use of the primer pair according to claim 5 in increasing the waist circumference of breeding pigs.

9. A method for genetic improvement of pigs, characterized in that: The following steps are included: Determine the SNP molecular markers associated with pig waist circumference located on chromosome 7 of pigs as described in claim 1 for the breeding pigs in the breeding core group, and make corresponding selections based on the molecular markers: select breeding pigs with TT and TC genotypes at 5332818bp on chromosome 7 of the international pig reference genome version 11.1 for sub-breeding, eliminate breeding pigs with CC genotypes, increase the frequency of allele T at this site generation by generation, and increase the waist circumference of offspring pigs.

10. The method for genetic improvement of pigs according to claim 9, characterized in that: The pig is American Duroc.

Images