Alkali-resistant mortierella deformation strain D5-7 for promoting plant growth, bacterial fertilizer, soil conditioner and application of alkali-resistant mortierella deformation strain D5-7

Abstract

The invention provides an alkali-resistant mortierella anomala strain D5-7, a bacterial fertilizer, a soil conditioner and an application of the alkali-resistant mortierella anomala strain D5-7, and belongs to the technical field of microorganisms. The preservation number of the alkali-resistant mortierella deformation strain D5-7 is CGMCC (China General Microbiological Culture Collection Center) No. 41142. The alkali-resistant mortierella deformation strain D5-7 promotes agglomeration of saline-alkali soil by secreting an extracellular polymer uronic acid, so that the saline-alkali environment for plant survival is effectively improved; the alkali-resistant mortierella deformation strain D5-7 can also improve the stress resistance of the plant to a saline-alkali environment and promote the growth of the plant; in addition, the alkali-resistant mortierella mutabilis strain D5-7 has relatively strong alkali resistance, can be applied to farmland with medium saline-alkali degree, and is relatively wide in application range.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to an alkali-resistant Linnemannia amoeboidea strain D5-7 for promoting plant growth, a bacterial fertilizer, a soil conditioner and applications thereof. Background Art

[0002] China has rich and widely distributed saline soil resources. The physical and chemical properties of saline-alkali soil are poor, and the utilization rate is low. Excessive alkaline salt makes it difficult for nutrients to be absorbed by crops, which is not conducive to plant growth. Therefore, promoting the reduction of saline-alkali barriers and plant growth is of great significance to improving the utilization rate of saline-alkali land. At present, microorganisms are widely studied and used in improving soil and promoting plant growth. However, in the prior art, the biological activity of most microorganisms in saline-alkali environments is severely restricted and cannot play a role in saline-alkali environments. Therefore, screening strains that still have the effect of improving soil and promoting plant growth in saline-alkali environments has positive significance.

[0003] Mortierella is a typical representative of the phylum Mortierella, which plays a key role in agriculture. Existing related studies have reported that Mortierella fungi can promote plant growth, but the potential of this genus in alleviating soil salinity has not been reported. Summary of the invention

[0004] The purpose of the present invention is to provide an alkali-resistant Mortierella deformans strain D5-7, which has strong alkali resistance and can effectively improve the soil saline-alkali environment and also improve the stress resistance of plants to the saline-alkali environment.

[0005] The invention provides an alkali-resistant Linnemannia amoeboidea strain D5-7, and the preservation number of the alkali-resistant Linnemannia amoeboidea strain D5-7 is CGMCC No.41142.

[0006] The present invention provides a fermentation product and / or metabolite of the alkali-resistant Mortierella deformans strain D5-7.

[0007] The invention provides a bacterial fertilizer, comprising the alkali-resistant Mortierella deformans strain D5-7 or the fermentation product and / or metabolite and auxiliary materials.

[0008] The invention provides a soil conditioner, comprising the alkali-resistant Mortierella deformans strain D5-7 or the fermentation product and / or metabolite and auxiliary materials.

[0009] The present invention provides the use of the alkali-resistant Mortierella deformans strain D5-7, the fermentation product and / or metabolite, the bacterial fertilizer or the soil conditioner in improving the plant living environment and / or plant planting.

[0010] Preferably, the improving the plant living environment includes promoting soil aggregation and / or reducing the soluble ion concentration (EC) in the environment.

[0011] Preferably, the plant planting includes promoting plant growth and / or improving plant resistance to salt and alkali.

[0012] Preferably, the promoting plant growth includes promoting the growth of plant roots.

[0013] Preferably, the method of improving the salt-alkali resistance of plants comprises at least one of the following: increasing the proline content, superoxide dismutase content and malondialdehyde content in the roots of plants.

[0014] Preferably, the plants include food crops and / or cash crops.

[0015] Beneficial effects:

[0016] The invention provides an alkali-resistant Linnemannia amoeboidea strain D5-7, with a deposit number of CGMCC No. 41142. The alkali-resistant Linnemannia amoeboidea strain D5-7 has strong alkali resistance and can still maintain a high growth rate when the pH value is 10.33; the alkali-resistant Linnemannia amoeboidea strain D5-7 can promote the aggregation of saline-alkali soil by secreting extracellular polymer uronic acid, and promote the formation of large aggregates of saline-alkali soil; the alkali-resistant Linnemannia amoeboidea strain D5-7 can significantly promote the discharge of Na ions, reduce the pH of the soil solution, and improve the plant growth environment; the alkali-resistant Linnemannia amoeboidea strain D5-7 is inoculated into the plant growth environment, which can improve the plant's resistance to the saline-alkali environment and promote the growth of the plant.

[0017] The present invention provides the application of the alkali-resistant deformed Mortierella strain D5-7, the fermented product and / or metabolite, the bacterial fertilizer or the soil conditioner in improving the living environment of plants and / or plant planting. The present invention is carried out by inoculating the alkali-resistant deformed Mortierella strain D5-7 into the soil experiment. The results show that the inoculation of the alkali-resistant deformed Mortierella strain D5-7 can significantly increase the content of extracellular polymer uronic acid in the soil, and significantly increase the proportion of large aggregates in the soil, improve the aggregate MWD and GWD index, indicating that the inoculation of the alkali-resistant deformed Mortierella strain D5-7 promotes the formation of large aggregates in saline-alkali soil by secreting extracellular polymer uronic acid. This another embodiment determines the effect of the alkali-resistant deformed Mortierella strain D5-7 on the sodium ion content in the soil environment, and the results show that the alkali-resistant deformed Mortierella strain D5-7 can significantly reduce the concentration of soluble Na ions in the soil environment. In addition, the present invention also determines the effect of the alkali-resistant Mortierella strain D5-7 on plant growth in saline-alkali soil. The results show that the alkali-resistant Mortierella has strong alkali resistance, can be applied to farmland with medium saline-alkali degree, has the ability to promote the growth of rice roots in a saline-alkali environment, can increase the fresh weight of rice roots, and improve the stress resistance of rice by increasing the proline content, superoxide dismutase content and malondialdehyde content. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The morphological diagram of the alkali-resistant Mortierella deformans strain D5-7 on PDA medium, wherein a is the front view and b is the back view;

[0019] Figure 2 The microstructure of alkali-resistant Mortierella deformans D5-7, where the scale bar in a is 100 μm, the scale bar in b is 50 μm, and the scale bar in c is 20 μm;

[0020] Figure 3 The phylogenetic tree of the alkali-resistant Mortierella vulgaris strain D5-7 constructed based on the ITS sequence;

[0021] Figure 4 The morphological diagram of the alkali-resistant Mortierella deformans strain D5-7 on the funnel soil culture medium, wherein a is the indigenous microorganisms of the control group, and b is the alkali-resistant Mortierella deformans strain D5-7;

[0022] Figure 5 The diagram shows the salt excretion process of saline-alkali soil in different treatment groups, where a is the blank control and b is the alkali-resistant Mortierella deformans strain D5-7.

[0023] Biomaterial Deposit Information

[0024] The alkali-resistant Linnemannia amoeboidea strain was deposited in the General Microbiology Center of the China Culture Collection Administration on April 2, 2024. The unit is abbreviated as the Institute of Microbiology, Chinese Academy of Sciences, and the address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit number is CGMCCNo.41142 and the strain number is D5-7. DETAILED DESCRIPTION

[0025] The invention provides an alkali-resistant Linnemannia amoeboidea strain D5-7, whose preservation number is CGMCC No.41142.

[0026] In the present invention, the alkali-resistant Mortierella strain D5-7 is isolated from saline-alkali farmland soil. The alkali-resistant Mortierella strain D5-7 grows on potato dextrose agar (PDA) medium and has typical colony morphology characteristics of Mortierella. It can form lotus-shaped colonies ( Figure 1 The diameter of hyphae varies greatly, asexual spores are abundant, and the middle end of the hyphae is significantly enlarged, which is the developing thick-walled spores. No zygospores are found ( Figure 2The ITS sequence of the strain D5-7 is shown in SEQ ID NO: 1 (AAAAACATCAGTGTTTTTATGGCACTTTCAAAATCCATATCCACCTTGTG). The morphological characteristics and molecular identification results showed that the strain D5-7 was an alkali-resistant Linnemannia amoeboidea.

[0027] The present invention provides a fermentation product and / or metabolite of the alkali-resistant Mortierella deformans strain D5-7.

[0028] In the present invention, the fermented product is preferably prepared by the following method: the alkali-resistant Mortierella strain D5-7 is inoculated into a potato dextrose agar (PDA) medium for static culture to obtain an activated mycelium block, and the activated mycelium block is cultured in potato dextrose water (PD) to obtain a fermented product. The temperature of the static culture and the culture is preferably 23-28°C, more preferably 24-26°C, and most preferably 25°C, and the time is preferably 3-8d, more preferably 4-6d, and most preferably 5d. The components of the PDA medium preferably include 180-220g of potatoes, 18-22g of glucose, and 18-22g of agar per 1000mL of deionized water, and more preferably include 200g of potatoes, 20g of glucose, and 20g of agar; the pH value of the PDA medium is preferably 6-9, more preferably 6-8, and most preferably 7. The components of the PD are preferably based on the components of the PDA medium without agar. The metabolite is preferably prepared by the following method: filtering the fermented product and separating the liquid phase, wherein the liquid phase is the metabolite. The effective viable count of the alkali-resistant Mortierella deformans strain D5-7 per milliliter of the fermented product is preferably not less than 10 4 The copy number is preferably 10 5 ~10 8 The copy number is preferably 10 6 Copy number.

[0029] The alkali-resistant Mortierella strain D5-7 of the present invention has strong alkali resistance and can still maintain a high growth rate when the pH value is 10.33; the alkali-resistant Mortierella strain D5-7 can promote the agglomeration of saline-alkali soil by secreting extracellular polymer uronic acid, and promote the formation of large aggregates of saline-alkali soil; inoculating the alkali-resistant Mortierella strain D5-7 into a matrix can reduce the sodium ion content in the matrix and improve the plant growth environment; inoculating the alkali-resistant Mortierella strain D5-7 into a plant growth environment can improve the plant's resistance to saline-alkali environment and promote plant growth.

[0030] Based on the property of the strain D5-7 in promoting plant growth, the present invention provides a bacterial fertilizer, comprising the alkali-resistant Mortierella deformans strain D5-7 or the fermentation product and / or metabolite and auxiliary materials.

[0031] In the present invention, the effective viable count of the alkali-resistant Mortierella deformans strain D5-7 per gram of the bacterial fertilizer is preferably not less than 10 4 The copy number is preferably 10 5 ~10 8 The copy number is preferably 10 6The number of copies; the preparation method of the bacterial fertilizer is not particularly limited, and the preparation scheme of the bacterial fertilizer well known in the art can be adopted, for example, the activated and expanded alkali-resistant deformed Mortierella strain D5-7 is mixed with auxiliary materials. The present invention does not specifically limit the components of the auxiliary materials, and the auxiliary materials of the bacterial fertilizer well known in the art can be adopted, such as macroelements, secondary elements, trace elements, and components that promote soil aggregate formation, improve soil compaction, etc.

[0032] Based on the property of strain D5-7 in improving the plant growth environment, the present invention provides a soil conditioner, comprising the alkali-resistant Mortierella deformans strain D5-7 or the fermentation product and / or metabolite and auxiliary materials.

[0033] In the present invention, the effective viable count of the alkali-resistant Mortierella deformans strain D5-7 per gram of the soil conditioner is preferably not less than 10 4 The copy number is preferably 10 5 ~10 8 The copy number is preferably 10 6 The present invention has no particular limitation on the method for preparing the soil conditioner, and a soil conditioner preparation scheme known in the art can be used, for example, the activated and expanded alkali-resistant Mortierella deformans strain D5-7 is mixed with auxiliary materials to obtain the soil conditioner.

[0034] The present invention provides the use of the alkali-resistant Mortierella deformans strain D5-7, the fermentation product and / or metabolite, the bacterial fertilizer or the soil conditioner in improving the plant living environment and / or plant planting.

[0035] In the present invention, the plants preferably include food crops and / or cash crops. The food crops preferably include any one of the following: wheat, rice, corn, oats, rye, barley, millet, sorghum and highland barley. The cash crops preferably include any one of the following: vegetable crops, fiber crops, oil crops, sugar crops, oil crops and medicinal crops. The pH value of the plant's living environment or planting matrix is ​​preferably 5 to 9.2, more preferably 8 to 9.2, and most preferably 9. The salt content of the plant's living environment or planting matrix preferably includes 0.05% to 0.2%, more preferably 0.08% to 0.12%, and most preferably 0.1%.

[0036] In the present invention, the improving the plant living environment preferably includes promoting soil aggregation and / or reducing the concentration of soluble ions in the environment.

[0037] In the present invention, the matrix of the plant living environment preferably includes ordinary soil and saline-alkali soil. The saline-alkali soil preferably contains the following components: total nitrogen 0.45-0.5g / kg, alkaline nitrogen 40-50mg / kg, available phosphorus 15-20mg / kg, available potassium 140-160mg / kg, organic matter 10-11g / kg, salt concentration 0.9-1.1g / kg, pH=8.5-9.5; more preferably: total nitrogen 0.47g / kg, alkaline nitrogen 46.50mg / kg, available phosphorus 17.50mg / kg, available potassium 153mg / kg, organic matter 10.58g / kg, salt concentration 1.08g / kg, pH=9.16.

[0038] One embodiment of the present invention determines the effect of alkali-resistant deformed Mortierella strain D5-7 on soil agglomeration, and the results show that compared with the control, the alkali-resistant deformed Mortierella strain D5-7 significantly increases the proportion of large aggregates in the soil, and improves the aggregate MWD and GWD index, indicating that the inoculation of alkali-resistant deformed Mortierella strain D5-7 has a significant effect on promoting soil agglomeration. The present embodiment further determines the content of extracellular polymers in the soil after inoculation of alkali-resistant deformed Mortierella strain D5-7. The results show that compared with the control, the alkali-resistant deformed Mortierella strain D5-7 can significantly increase the content of uronic acid in the soil, indicating that the strain promotes the formation of large aggregates in saline-alkali soil to a certain extent by secreting extracellular polymer uronic acid. One embodiment of the present invention determines the sodium ion content in the environment of the alkali-resistant deformed Mortierella strain D5-7, and the results show that compared with the control, the alkali-resistant deformed Mortierella strain D5-7 can significantly reduce the soluble ion concentration and sodium ion content in the environment.

[0039] In the present invention, the promoting of plant planting preferably includes promoting plant growth and / or improving plant resistance to salt and alkali. The promoting of plant growth preferably includes promoting the growth of plant roots.

[0040] In the present invention, the method of improving the salt-alkali resistance of plants preferably includes at least one of the following: increasing the proline content, superoxide dismutase content and malondialdehyde content in the roots of plants.

[0041] One embodiment of the present invention determines the effect of alkali-resistant Mortierella strain D5-7 on rice growth in saline-alkali soil, and the results show that the fresh weight of rice roots inoculated with alkali-resistant Mortierella strain D5-7 is significantly increased compared with the control group, indicating that the alkali-resistant Mortierella strain D5-7 can promote the growth of roots in saline-alkali environments. The content of proline, malondialdehyde and superoxide dismutase in the rice root system inoculated with alkali-resistant Mortierella strain D5-7 is significantly increased compared with the control group, indicating that the alkali-resistant Mortierella strain D5-7 improves the salt-alkali resistance of the rice root system.

[0042] In the present invention, the method for using the alkali-resistant deformed Mortierella strain D5-7, the fermented product and / or metabolite, the bacterial fertilizer or the soil conditioner in improving the plant living environment and / or plant planting is preferably: applying the fermented product and / or metabolite of the alkali-resistant deformed Mortierella strain D5-7, the bacterial fertilizer or the soil conditioner to the roots of plants. The effective viable bacterial count of the alkali-resistant deformed Mortierella strain D5-7 is preferably not less than 10 4 The number of copies / g is preferably 10 5 ~10 8 The number of copies / g is preferably 10 6 Copy number / g.

[0043] In order to further illustrate the present invention, the embodiments provided by the present invention are described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be understood as limiting the protection scope of the present invention.

[0044] Medium composition and preparation of mycelial blocks

[0045] Preparation of potato dextrose agar (PDA) medium: 200 g of potato, 20 g of glucose and 20 g of agar were included in every 1000 mL of deionized water.

[0046] The preparation method of the mycelial block of the alkali-resistant Mortierella strain D5-7 is as follows: the mycelium of the alkali-resistant Mortierella strain D5-7 is selected in the clean bench and placed in a PDA plate culture medium with a pH of 7.0 for activation, and cultured upright at 25° C. in the dark for 5 days, and a hole puncher of corresponding size is used to punch holes to obtain the mycelial block.

[0047] Preparation method of blank agar block: Pour the prepared PDA culture medium into the culture dish, and after condensation, an agar block with a thickness of 0.3 cm is obtained. The PDA flat culture dish is cultured upright at 25°C in the dark for 5 days to obtain a blank agar block. Use a puncher of corresponding size to punch holes to obtain a blank agar block.

[0048] The preparation method of Laburnicola dactylidis D1-1 mycelium block is the same as the preparation method of the alkali-resistant Mortierella strain D5-7 mycelium block, except that the mycelium picked is the Laburnicola dactylidis mycelium block.

[0049] Preparation method of Mortierella elongata mycelium block: The method is the same as the preparation method of the mycelium block of the alkali-resistant Mortierella deformans strain D5-7, except that the mycelium picked is the Mortierella elongata mycelium block.

[0050] The Laburnicola dactylidis D1-1 strain and the Mortierella elongata strain were isolated from saline-alkali soil and preserved for a long time by the Green Regulation of Farmland Productivity and Functional Fertilizer Research Group of the College of Resources and Environment of Henan Agricultural University.

[0051] Example 1

[0052] Method for screening alkali-resistant Mortierella deformans strains

[0053] Strain D5-7 was isolated from saline-alkali farmland soil. Strain D5-7 had typical colony morphology of Mortierella on PDA plates and could form lotus-shaped colonies under single inoculation conditions ( Figure 1 The diameter of hyphae varies greatly, asexual spores are abundant, and the middle end of the hyphae is significantly enlarged, which is the developing thick-walled spores. No zygospores are found ( Figure 2 ).

[0054] Molecular identification of strain D5-7: DNA of strain D5-7 was extracted and amplified by PCR using primers ITS-F and ITS-R. The ITS sequence was sequenced and shown in SEQ ID NO: 1 (AAAAACATCAGTGTTTTTATGGCACTTTCAAAATCCATATCCACCTTGTG). The sequence was compared with the sequence in the GenBank database by BLAST and its phylogenetic tree was constructed by the neighbor-joining method in Mega 7 software. The phylogenetic tree is shown in FIG. Figure 3 shown.

[0055] Combined with phylogenetic tree analysis, morphological analysis and physiological and biochemical characteristics of the strain, strain D5-7 was identified as alkali-resistant Linnemannia amoeboidea. Linnemannia amoeboidea strain D5-7 was sent to the General Microbiological Center of China Microbiological Culture Collection on April 2, 2024, with the deposit number CGMCC No.41142. The address of the collection center is Institute of Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0056] Example 2

[0057] Growth rate of alkali-resistant Mortierella deformans strain D5-7 at different pH values

[0058] 1) Prepare soil culture medium with different pH values

[0059] Prepare the culture medium with the supernatant of different saline-alkali soils to obtain culture medium with different pH values. The specific operation is: select 200g of soda-alkali soil with low, medium and high salinity, add it to 1500mL of distilled water, stir for 30 minutes, and filter the supernatant. Use the supernatant to prepare PDA culture medium. The formula is as follows: 200g of potato, 20g of glucose, 20g of agar, and obtain culture medium with pH values ​​of 8.02, 9.33, and 10.33. Pack it in a triangular bottle, mark and classify it, seal it with sealing film and newspaper, and sterilize it with high-pressure steam at 121℃ for 15 minutes. In the clean bench, pour the culture medium with different pH values ​​into a 70mm diameter plate, control the thickness of the culture medium to be basically consistent, and cool it until solidified.

[0060] 2) Inoculation of alkali-resistant Mortierella

[0061] The mycelium block of alkali-resistant deformed Mortierella strain D5-7 with a diameter of 0.8 cm was inoculated into the center of the culture medium with different pH values ​​and cultured in the dark at 25°C. Three groups of replicates were made for each treatment. The mycelium block of Mortierella elongata was used as the control of Mortierella strain. When the colony was about to fill the plate, its diameter was measured, and the culture time was recorded to calculate the growth rate of the fungus. SPSS20.0 statistical software was used for analysis. The experimental data were expressed as "mean ± standard error". Tukey sb (K) was used to test the homogeneity of the data. The statistical results of mycelium growth rate under different pH conditions are shown in Table 1. It can be seen from Table 1 that the growth rate of alkali-resistant deformed Mortierella strain D5-7 first decreased with the increase of pH. Compared with the treatment of pH = 9.31, the growth rate of Mortierella fungi increased in the treatment of pH = 10.29. Compared with the Mortierella strain control, the decline in mycelium growth rate was very small. Therefore, the Mortierella fungi in the present invention have strong alkali resistance.

[0062] Table 1 Mycelial growth rate under different pH conditions

[0063] deal with D5-7 mycelium growth rate mm / h Mortierella hyphae growth rate mm / h pH 8.02 0.0824±0.0059a 0.088±0.073a pH 9.33 0.0580±0.0016b 0.047±0.043b pH 10.33 0.0676±0.0055b 0.010±0.050c

[0064] Note: Different letters represent significant differences at the P=0.05 level.

[0065] Example 3

[0066] Effect of alkali-resistant Mortierella deformans strain D5-7 on promoting aggregate formation in saline-alkali soil

[0067] Preparation of soil matrix: Saline-alkali soil with a pH value of 9.16 was passed through a 100-mesh sieve, and corn stalks were passed through a 75-mesh sieve and sterilized with high-pressure steam. The sterilized saline-alkali soil and corn stalks were mixed in a clean bench at a mass ratio of 100:1, and distributed onto flat plates (15 g per plate). The moisture content was adjusted to 60% to simulate field water holding capacity to obtain the soil matrix.

[0068] Experimental group: A 1-cm-diameter agar mycelium block of the alkali-resistant Mortierella deformans strain D5-7 was inoculated in the center of the soil matrix, 0.5 mL of PD culture solution was dripped around the mycelium block, and cultured under sterile constant temperature conditions at 25°C.

[0069] Blank control: The treatment method is the same as the experimental group, the only difference is that the soil matrix is ​​not sterilized during preparation, and a blank agar block is implanted in the center of the non-sterilized soil matrix containing indigenous microorganisms.

[0070] D1-1 strain control: The treatment method was the same as the experimental group, the only difference being that a Laburnicoladactylidis D1-1 agar mycelium block was inoculated in the center of the soil matrix.

[0071] Twenty plates were used for each treatment, and the soil aggregate content and the amount of extracellular polymers produced in each treatment group were measured after 20 days of cultivation.

[0072] The determination method of soil aggregate content in each treatment group is as follows:

[0073] After 20 days of cultivation, 15 plates were randomly selected from each treatment group for natural air drying. The air-dried soil culture medium was randomly divided into three groups and placed in ziplock bags for aggregate component screening. The method was as follows: 50.00g of soil sample was accurately weighed, placed on a 1mm sieve, and distilled water was added to cover the soil sample and then allowed to stand for 3 minutes. The soil sample was vibrated for two minutes with an amplitude of 3cm, and the sieve was moved up and down once, with a frequency of 30 times / min. Then the soil sample on the sieve was transferred, and then sieved and transferred through 0.25mm and 0.053mm sieves in turn (the above operation was repeated three times in parallel). The sieved components were dried and weighed, and the data was recorded. The average weight diameter was calculated according to formula I, and the geometric mean diameter was calculated according to formula II.

[0074]

[0075] Where MWD is the mean weight diameter, is the average diameter of the i-th level soil aggregates (mm); W i is the mass percentage (%) of the corresponding size aggregates in the total aggregates; n is the number of separated aggregates.

[0076]

[0077] Where GWD is the geometric mean diameter, is the average diameter of soil aggregates of the ith particle size (mm); W i is the mass percentage of the corresponding size aggregates in the total aggregates (%); n is the number of separated aggregates

[0078] SPSS20.0 statistical software was used for analysis, and the experimental data were expressed as "mean ± standard error". The results of soil aggregate content determination in each treatment group are shown in Table 2. As shown in Table 2, the proportion of large aggregates in the experimental group increased by 74.1% compared with the D1-1 strain control. At the same time, the average mass diameter (MWD) and geometric mean diameter (GWD) of aggregates in the experimental group increased significantly compared with the blank control and the D1-1 strain control, indicating that the inoculation of the alkali-resistant Mortierella strain D5-7 has a significant effect on promoting soil aggregation.

[0079] Table 2 Determination of soil aggregate content in each treatment group

[0080]

[0081] Note: Different small letters represent significance at the p≤0.05 level.

[0082] The method for determining the extracellular polymer production capacity of each treatment group is as follows:

[0083] (1) Extraction of extracellular polymers: After 20 days of cultivation, 3 g of fresh soil samples from 5 plates were taken from each treatment group and placed in a 50 mL polypropylene centrifuge tube. 30 mL of 0.1 M CaCl2 solution was added and mixed evenly to remove soluble organic matter in the soil. The centrifuge tube was placed in ice, vibrated back and forth at 120 rpm for 2 h, and centrifuged at 3200 g for 30 min. The supernatant was discarded, and 15.98 g of sodium ion exchange resin CER and 25 mL of buffer were added to the precipitate. The supernatant containing extracellular polymers was transferred to a new test tube, quickly frozen in liquid nitrogen, and stored at -80 °C for later use. Three parallel experiments were repeated.

[0084] The buffer solution is prepared by containing 0.76 g Na3PO4·12H2O, 0.552 g NaH2PO4·H2O, 0.526 g NaCl, and 0.0746 g KCl per 1 L of sterile water, adjusting the pH value to 7.0 with 1 M HCl solution, and precooling at 4° C.

[0085] (2) Determination of extracellular polymer uronic acid: Take 200 μL of the supernatant containing extracellular polymers, add 1.2 mL of 0.0125 M sodium tetraborate solution (prepared with concentrated sulfuric acid), and vortex for 45 seconds. Place in a 100°C water bath for 5 minutes and cool on ice. After 3 minutes, add 20 μL of 0.15% (v / v) m-m-hydroxybiphenyl solution (the solvent is 0.5% sodium hydroxide solution). Gently shake the solution until it is mixed and let it stand for 4 minutes. Take a sample of 200 μL and use an ELISA reader to measure the absorbance at 520 nm.

[0086] Method for preparing the standard curve: 0, 4, 20, 60, 100 and 200 μL of 25 μg / mL D-glucronic acid stock solution were respectively drawn, and the volume was supplemented to 200 μL with deionized water for reaction and colorimetry.

[0087] (3) Determination of extracellular polymer humic acid: prepare two plates, marked as A and B plates. Add 100 μL of the supernatant containing extracellular polymers to each well of A plate, then add 100 μL of A solution, and use a pipette to vertically aspirate and mix the solution; add the same volume of B solution to B plate, and perform other operations the same as A plate. Repeat 3 times for each sample in A and B plates. After placing the two plates in a dark environment for 10 minutes, immediately add 100 μL of Folin phenol reagent to terminate the reaction to reduce time error. After standing for 30 minutes, use an ELISA reader to measure the absorbance at 750 nm.

[0088] Prepare Folin phenol solution: dilute 2N Folin phenol solution 10 times with deionized water for later use. Prepare Solution A: weigh 3.5 g of copper sulfate pentahydrate and dissolve it in 100 mL of water to obtain Solution (a); weigh 7.0 g of potassium sodium tartrate and dissolve it in 100 mL of water to obtain Solution (b); weigh 70 g of sodium carbonate and dissolve it in 1 L of 0.35 N sodium hydroxide solution to obtain Solution (c); mix Solution (a), Solution (b) and Solution (c) in a ratio of 1:1:100 (5 mL, 5 mL, 500 mL) to obtain Solution A.

[0089] Prepare Solution B by mixing 5 mL, 5 mL and 500 mL of deionized water, Solution (b) and Solution (c).

[0090] The humic acid content was calculated according to formula III.

[0091] Humic acid content = 1.25Abs B-0.25Abs A Formula III

[0092] Where Abs B represents the absorbance of plate B, and AbsA represents the absorbance of plate A.

[0093] Method for preparing humic acid standard curve: 0.04g humic acid was diluted to 100mL with deionized water. Three replicates were set for each group. 0μL, 25μL, 50μL, 75μL, and 100μL of bovine serum albumin solution and humic acid solution were added to different wells of two plates, and the buffer was added to 100μL. The other steps were repeated for the sample determination, and the reaction and colorimetry were performed.

[0094] SPSS20.0 statistical software was used for analysis, and the experimental data were expressed as "mean ± standard error". The results of the determination of the extracellular polymer content of each group are shown in Table 3. As shown in Table 3, after the inoculation of the alkali-resistant Mortierella strain D5-7, the content of uronic acid in the soil was significantly higher than that of the blank control and the D1-1 strain control, with an increase of 75.43% compared with the blank control; while the humic acid content was not significantly different from the blank control and the D1-1 strain control, indicating that the bacteria promoted the formation of large aggregates in saline-alkali soil to a certain extent by secreting extracellular polymer uronic acid.

[0095] Table 3 Determination of extracellular polymer content in soil of each treatment group

[0096] deal with Uronic acid content (mg / kg) Humic acid content (mg / kg) Experimental Group 100.59±5.40a 107.99±66.45a Blank control 57.34±0.60b 171.35±18.73a D1-1 strain control 54.56±7.13b 163.67±12.78a

[0097] Note: Different small letters represent significance at the p≤0.05 level.

[0098] Example 4

[0099] Function of alkali-resistant Mortierella deformans strain D5-7 in promoting salt removal from saline-alkali soil

[0100] Preparation of culture medium: Plug the neck of the short-necked funnel with absorbent cotton, seal the upper opening with sealing film and newspaper, put it in a plastic bag and seal it with high-pressure steam sterilization (121℃, 5min). After sterilization, seal the bottom of the funnel tightly with sealing film in the clean bench to make the funnel in a fully sealed and sterile state. Complete the packaging of sterile soil samples in the clean bench, add 20g of straw and sterilized soil samples (the mass ratio of saline-alkali soil: corn straw is 100:1) to each funnel. After packaging, carefully drop 6mL of sterile water for balance and standby.

[0101] Experimental group: The agar mycelium block of the alkali-resistant Mortierella deformans strain D5-7 was inoculated into the prepared culture medium with an inoculation spatula, 0.5 mL of PD culture solution was added around the inoculated mycelium block, the funnel was sealed and cultured at a constant temperature of 25°C for 10-15 days, and four replicates were set.

[0102] Blank control: The treatment method is the same as the experimental group, the only difference is that the culture medium is not sterilized during preparation and blank agar blocks are inoculated.

[0103] After the incubation, air-dry to constant weight without disturbance (see Figure 4 ), put it on a 100mL measuring bucket, add 50mL of distilled water at one time, let it stand for 30 minutes, open the sealing film under the funnel, and the water will automatically flow downward under the action of gravity (see Figure 5 ). When the water stops flowing downward, record the water volume of each sample and calculate the change of the maximum water holding capacity in the field. Collect the solution in the bucket, measure the pH value and EC value, and use a flame photometer to measure the Na ion content after the filtrate passes through a 0.45μm membrane. After drying the soil in the funnel, measure the soil EC value.

[0104] SPSS 20.0 statistical software was used for analysis. The experimental data were expressed as “mean ± standard error”. The pH values, EC and sodium ion content of the filtrate and soil of each treatment group are shown in Tables 4 and Figure 4 .Depend on Figure 4 It can be seen that Mortierella deforma D5-7 can grow well on saline-alkali soil. As shown in Table 4, after inoculation of Mortierella fungus D5-7, the pH of the filtrate in the experimental group was significantly lower than that of the blank control, while the EC value and sodium ion content in the filtrate were significantly higher than those in the comparative example, wherein the filtrate EC value increased by 68.80%, and the filtrate sodium ion content increased by 26.88%. The soil EC value in the experimental group was significantly lower than that in the blank control, reduced by 22.50%. It is thus inferred that the growth of the strain in the embodiment affects the adsorption of cations by the soil, and promotes the conversion of some non-free sodium into free sodium, indicating that the inoculation of the bacteria promotes the salt discharge process of saline-alkali soil to a certain extent.

[0105] Table 4 Filtrate and soil pH, EC and sodium ion content

[0106]

[0107] Note:" * "Indicates that the difference is significant at the P = 0.05 level." ** ” means that the difference reached significance at the P=0.01 level.

[0108] Example 5

[0109] Effects of alkali-tolerant Mortierella deformans on rice growth in saline-alkali soil

[0110] Preparation of liquid culture medium: The soil sample was selected from Northeast saline-alkali soil, with a total nitrogen content of 0.47 g / kg, alkaline nitrogen content of 46.50 mg / kg, available phosphorus content of 17.50 mg / kg, available potassium content of 153 mg / kg, organic matter content of 10.58 g / kg, pH = 9.16, and soil salt content of 1.08 g / kg. Pass through a 20-mesh sieve, weigh 40 g of soil sample, put it into a 250 mL conical flask, add 100 mL of sterile water, seal the upper opening with sealing film and newspaper, and sterilize with high-pressure steam (121°C, 5 min).

[0111] Experimental group: In the clean bench, inoculate agar mycelium blocks of Mortierella D5-7 with a diameter of 0.8 cm in the soil liquid culture matrix. After sealing, shake the flask for ten seconds and place it on the table at room temperature of 25°C for incubation. Incubate at room temperature for 13 days with three parallel sets.

[0112] Blank control: No mycelium blocks were inoculated into the soil liquid culture matrix, and the other conditions were the same as those of the experimental group.

[0113] D1-1 strain control: Agar mycelium blocks of Laburnicola dactylidis D1-1 were inoculated in the soil liquid matrix, and the rest were the same as the experimental group.

[0114] After the culture is completed, the supernatant in the culture medium is carefully collected in a clean bench to measure the pH and EC. The supernatant is then carefully drained and the remaining soil is sealed with a sealing film for rice cultivation.

[0115] Disinfection and germination of rice: Select Songliao 186 rice, select 50 rice seeds, soak and disinfect them in 30% hypochlorous acid for 10 minutes, and rinse them with sterile water 5 times. Completely wash away the residual hypochlorous acid solution. Soak the rice seeds in distilled water for 3 days at 37 degrees and avoid light for germination.

[0116] Rice inoculation and cultivation: In a clean bench, germinated rice seeds were planted in triangular bottles, with 3 germinated seeds in each bottle. After sealing with sealing film, they were placed in a constant temperature incubator for cultivation. The daytime was set to 16 hours, 28°C, and the light intensity was 30,000 lm (level 10, 30,000 lumens); the night was set to 8 hours, 20°C, and dark. The cultivation lasted for 14 days. On the 5th day, 100 mL of sterile distilled water was added. When the plant height was 10 cm, the seedlings were removed, and 1 seedling was left in each pot. After 14 days of cultivation, root scanning, plant height, aboveground biomass, root proline, root malondialdehyde, root catalase, and root superoxide dismutase were determined. The superoxide dismutase, malondialdehyde, catalase, and proline contents of rice roots were determined using superoxide dismutase, malondialdehyde, catalase, and proline kits, respectively (Suzhou Keming Biotechnology Co., Ltd.).

[0117] After the incubation, the supernatant was removed and the remaining soil was dried to determine the soil exchangeable sodium and alkalinity. SPSS statistical software was used for analysis, and the experimental data were expressed as "mean ± standard deviation".

[0118] The properties of soil suspension in each treatment group are shown in Table 5, the rice biomass parameters in each treatment group are shown in Table 6, and the content of rice root stress resistance index in each treatment group is shown in Table 7. According to the data in Tables 5, 6 and 7, the contents of superoxide dismutase and catalase in rice roots in the experimental group were significantly higher than those in the control group, among which the superoxide dismutase content increased by 72.96% compared with the blank control, and the catalase content increased by 22.92% compared with the blank control; and the malondialdehyde content was extremely significantly higher than the blank control, with an increase of 60.61%, indicating that the D5-7 strain of the genus Mortierella can improve the antioxidant capacity of rice, but its growth-promoting ability is limited, only higher than the blank control, and there is no significant difference between it and the D1-1 strain control.

[0119] Table 5 Properties of soil suspension in each treatment group

[0120] deal with pH EC(μs / cm) Experimental Group 7.10±0.27 1711.33±254.23 Blank control 7.38±0.08 1966.33±224.07 D1-1 strain control 7.98±0.03 1967.00±89.76

[0121] Table 6 Rice biomass parameters of each treatment group

[0122] deal with Root fresh weight (g) Fresh weight of aboveground parts (g) Plant height(cm) Experimental Group 0.087±0.033 0.116±0.010a 22.758±3.367 Blank control 0.069±0.018 0.101±0.015b 20.950±1.010 D1-1 strain control 0.099±0.027 0.117±0.020a 21.276±0.231

[0123] Note: Different small letters represent significance at the p≤0.05 level.

[0124] Table 7 Contents of stress resistance indexes of rice roots in each treatment group

[0125]

[0126] Note: Different small letters represent significance at the p≤0.05 level.

[0127] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. Other embodiments can be obtained based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An alkali-resistant Linnemannia amoeboidea strain D5-7, characterized in that The deposit number of the alkali-resistant Mortierella deformans strain D5-7 is CGMCC No.41142.

2. A fermentation product and / or metabolite of the alkali-resistant Mortierella deformans strain D5-7 according to claim 1.

3. A bacterial fertilizer, characterized in that: The method comprises the alkali-resistant Mortierella deformans strain D5-7 described in claim 1 or the fermentation product and / or metabolite and auxiliary materials described in claim 2.

4. A soil conditioner, characterized in that: The method comprises the alkali-resistant Mortierella deformans strain D5-7 described in claim 1 or the fermentation product and / or metabolite and auxiliary materials described in claim 2.

5. Use of the alkali-resistant Mortierella deformans strain D5-7 according to claim 1, the fermentation product and / or metabolite according to claim 2, the bacterial fertilizer according to claim 3 or the soil conditioner according to claim 4 in improving the living environment of plants and / or plant planting.

6. The use according to claim 5, characterized in that: The improving the plant living environment includes promoting soil aggregation and / or reducing the concentration of soluble ions in the environment.

7. The use according to claim 5, characterized in that: The plant planting includes promoting plant growth and / or improving plant resistance to salt and alkali.

8. The use according to claim 7, characterized in that: The promoting plant growth includes promoting the growth of plant roots.

9. The use according to claim 7, characterized in that: The method of improving the salt-alkali resistance of plants comprises at least one of the following: improving the proline content, superoxide dismutase content and malondialdehyde content in the roots of plants.

10. The use according to any one of claims 5 to 9, characterized in that: The plants include food crops and / or cash crops.

Images