Rhodotorula glutinis and application thereof in fermentation production of carotenoid and lipid

Abstract

The invention relates to rhodotorula glutinis and application thereof in fermentation production of carotenoid and lipid, and belongs to the technical field of saccharomycetes. The rhodotorula glutinis provided by the invention is preserved in the General Microbiological Culture Collection Center of the China Committee for Culture Collection of Microorganisms, and the preservation number is CGMCC NO.31398. The rhodotorula glutinis provided by the invention has the advantages that the rhodotorula glutinis can be used for preparing the rhodotorula glutinis; the strain can be used for fermentation production of carotenoid and lipid, provides a new choice for industrial production of carotenoid and grease, and has good application prospects and economic benefits. In addition, the rhodotorula glutinis extract metabolite has an anti-inflammatory effect and can be used in the fields of anti-inflammatory drugs, cosmetics or foods.

Description

Technical Field

[0001] The invention relates to the technical field of yeast, and more specifically to a strain of red yeast and application thereof in fermentation production of carotenoids and lipids. Background Art

[0002] Carotenoids are a class of terpene compounds synthesized by higher plants and microorganisms, and are one of the most common pigments in nature. As a precursor of vitamin A, carotenoids have antioxidant effects, enhance immune response, prevent cardiovascular diseases, eye diseases and cancer, and are widely used in medicine, pharmaceuticals, cosmetics, food and feed industries. The carotenoid market is huge and has high commercial value.

[0003] At present, in order to meet the growing demand for carotenoids, they can be easily produced by chemical synthesis. However, due to the increasing concern of consumers about food safety, the production of natural carotenoids by microbial fermentation is becoming an attractive alternative to chemical synthesis. Compared with plant extraction and chemical synthesis, the production of carotenoids by yeast is natural and organic, and people prefer to construct new and highly safe carotenoids produced by microbial cell factories through synthetic biology and other means.

[0004] Red yeast is a type of pigment-producing yeast that is widely found in nature. Its most notable feature is the single-cell lipid droplets containing carotenoids. The production of carotenoids by red yeast has the advantages of simple nutritional requirements, short culture cycle, and the fact that the bacteria contain rich proteins, amino acids and vitamins that can be comprehensively utilized. As one of the red yeast flora, Rhodotorula glutinis can use various low-cost agricultural and industrial wastes as substrates to complete the production of carotenoids. Compared with chemical production, it has a series of additional advantages, such as short production cycle, environmental friendliness, and easy cultivation. It is a very promising platform microorganism, and therefore has a wide range of potential applications in food processing, beverage production and other related fields. However, the current research on the synthesis of carotenoids by red yeast is still in its infancy. In view of the above advantages of Rhodotorula glutinis, it is particularly urgent to develop red yeast strain resources with economic value to meet market demand. Summary of the invention

[0005] Based on the above technical problems existing in the prior art, the present invention provides a Rhodotorula glutinis QYH-2023 which has high carotenoid and lipid production and anti-inflammatory effects.

[0006] The invention provides a red yeast (Rhodotorula glutinis) QYH-2023 which is screened and separated from rice root soil, is easy to culture and has a vermilion color, and the preservation number is CGMCC NO.31398.

[0007] Biological deposit information

[0008] The deposit date is July 22, 2024, and it is deposited in the General Microbiology Center of China Microorganism Culture Collection (CGMCC), address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Building 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101.

[0009] The present invention also provides the use of the red yeast QYH-2023 described in the above technical solution in any one or more of the following A1-A2:

[0010] A1. Preparation of carotenoids

[0011] A2. Preparation of lipid substances

[0012] The application comprises the following steps: culturing the above-mentioned red yeast QYH-2023 in SOC medium at 28-35° C. for 24-72 hours.

[0013] Preferably, the components of the SOC medium include: 20 g / L tryptone, 5 g / L yeast extract, 5 g / L sodium chloride, 5 g / L potassium chloride, 9.5 g / L magnesium chloride, and 36 g / L glucose.

[0014] Preferably, the pH of the culture medium is 7.0.

[0015] Preferably, the culture medium has a culture temperature of 30°C and a culture time of 60 hours.

[0016] The present invention also provides a red yeast extract metabolite, which is obtained by culturing and extracting the red yeast QYH-2023 described in the above technical solution in a YPD culture medium.

[0017] Preferably, the ingredients of the YPD medium include: 10 g / L yeast extract, 20 g / L tryptone, and 20 g / L glucose.

[0018] The present invention also provides the use of the metabolites extracted from the red yeast QYH-2023 in the preparation of anti-inflammatory health products, cosmetics and foods.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention screens and separates a red yeast (Rhodotorula glutinis) QYH-2023 that is easy to culture and has a vermilion color from the soil of rice roots. The red yeast QYH-2023 of the present invention has high carotenoid and lipid production, short production cycle, environmental friendliness, and is easy to culture. Its metabolites have anti-inflammatory effects and can be applied to food processing, pharmaceutical and health products, skin care products industry and other related fields. It has practical significance for developing red yeast strain resources with economic value and promoting the research and application of red yeast metabolites. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the colony morphology of Rhodotorula glutinosus QYH-2023;

[0022] Figure 2 This is an electron micrograph of a single cell of Rhodotorula glutinosus QYH-2023;

[0023] Figure 3 This is the phylogenetic tree of Rhodotorula glutinosus QYH-2023;

[0024] Figure 4 This is the toxicological experiment diagram of Rhodotorula glutinosus QYH-2023;

[0025] Figure 5 The anti-inflammatory experiment of Rhodotorula glutinosus QYH-2023 (A) and the content of inflammatory factors after Rhodotorula glutinosus QYH-2023 treated cells;

[0026] Figure 6 Carotenoid standard (A) and carotenoid production by fermentation of Rhodotorula glutinosus QYH-2023 (B).

[0027] Figure 7 This is an analysis of the types of lipids produced by the fermentation of Rhodotorula glutinosus QYH-2023 in Example 7. DETAILED DESCRIPTION

[0028] Many specific details are set forth in the following description to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways than those described herein, and those skilled in the art can make similar modifications without violating the connotation of the present invention, so the present invention is not limited to the specific implementation disclosed below.

[0029] The red yeast QYH-2023 of the present invention is collected and separated from the root soil of rice plants at the scientific research and practice base of the Institute of Hemp, Chinese Academy of Agricultural Sciences in Changsha, Hunan Province.

[0030] The diameter of the colony formed by the red yeast QYH-2023 of the present invention is about (1.9±0.1) cm (specifically, Figure 1), the colony is pink in color, smooth and moist in texture. Under a scanning electron microscope, it usually appears as round or oval cells (specifically Figure 2 ), the reproduction mode is budding. The cell size is about 3 to 6 μm, slightly larger than that of ordinary yeast.

[0031] The red yeast QYH-2023 of the present invention can produce carotenoids when cultured in SOC medium at 28-35° C. for 48-72 hours. When the inoculation amount is 1.0 v / v%, the time is 60 hours, and the pH is 7.0, the produced carotenoids reach 1340 μg / g.

[0032] The scheme of the present invention will be explained below with reference to examples. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art of the present invention; the culture medium and analytical methods used in the specific implementation process are conventional methods, and the reagents and instruments used are commercially available conventional products.

[0033] The culture medium formula involved in the example is:

[0034] YPD medium: yeast extract 10 g / L, tryptone 20 g / L, glucose 20 g / L.

[0035] SOC medium: tryptone 20 g / L, yeast extract 5 g / L, sodium chloride 5 g / L, potassium chloride 5 g / L, magnesium chloride 9.5 g / L, glucose 36 g / L.

[0036] Example 1 Strain screening, isolation and morphological observation

[0037] It was screened and isolated from the rice root soil at the scientific research and practice base of the Institute of Hemp, Chinese Academy of Agricultural Sciences, Changsha, Hunan Province. Add 1g of soil sample to 5mL of sterile physiological saline and culture it in a shaking incubator at 30℃ for 30min. After centrifugation, take the supernatant and use the plate dilution coating method to isolate the strain in YPD solid culture medium. Place it in a 30℃ incubator and culture it for 2-3 days. Single colonies producing pigments were selected based on colony morphology and color. After culture three times, a purified strain was obtained and named QYH-2023. A single colony was inoculated into 15mL YPD liquid culture medium. After cultured in a shaker at 30℃ and 200rpm for 36 hours, the colony photo is shown in the figure. Figure 1 ; The strains were collected by centrifugation (4000×g, 4°C, 10 minutes), then immediately frozen with liquid nitrogen and stored in a -80°C freezer for subsequent extraction of genomes and metabolites. The dried yeast powder was fixed on the sample stage with conductive double-sided carbon glue and coated with gold palladium on a sputtering coater, and then observed with a scanning electron microscope (Hitachi-SU-3500, Japan). The results are shown in Figure 2 .

[0038] Example 2 Strain ITS sequence analysis

[0039] The ITSD1 / D2 region sequence of strain QYH-2023 was analyzed and sequenced by Beijing Qingke Biotechnology Co., Ltd. The ITSD1 / D2 gene sequence is preferably as shown in SEQ ID NO.1, specifically:

[0040] ACCTGCGGAAGGATCATTAGTGAACATAGGACGTCCAACTTAACT

[0041] TGGAGTCCGAACTCTCACTTTCTAACCCTGTGCATTTGTTTGGGG

[0042] TAGTAGCCTTTCGGGGCGAATCCCTATTCACTTATAAACACAAAG

[0043] TCTATGAATGTATTTAATTTTATAACAAAATAAAACTTTCAACAAC

[0044] GGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGA

[0045] TAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGA

[0046] ACGCACCTTGCGCTCCATGGTATTCCGTGGAGCATGCCTGTTTGA

[0047] GTGTCATGAATACTTCAACCCTCCTCTTTCTTTATGATCGAAGAGG

[0048] TGTTTGGATTCTGAGCGTTTTGCTGGCCTCACGGTCGAGCTCGCT

[0049] CGTAATGCATTAGCATCCGCAATCGAACTTCGGATTGACTTGGCGT

[0050] AATAGACTATTCGCTGAGGAATTCTAGTCTTCGGACTAGAGCCGG

[0051] GTTGGATTAAAGGAAGCTCCTAATCCTAATGTCTATTTTTAAGATT

[0052] AGATCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCA

[0053] AAAAGGCGGAGGA

[0054] The sequencing results were compared using the NCBI database Blast, and the highest similarity sequence provided by GenBank was selected to construct the following Figure 3 The phylogenetic tree shown in the figure shows that it is most closely related to Rhodotorula glutinis. Combined with the colony characteristics on the plate and the above-mentioned physiological and biochemical characteristics, the isolated strain of the present invention was identified as Rhodotorula glutinis, named QYH-2023, and deposited in the General Microbiology Center of China Microorganism Culture Collection Administration (CGMCC) on July 22, 2024, with the deposit number CGMCC NO.31398.

[0055] Example 3 Toxicological test of Rhodotorula glutinosus QYH-2023

[0056] 0.2 g of the cells of Rhodotorula glutinosus QYH-2023 cultured in Example 1 were collected and placed in a 50 mL centrifuge tube, 20 mL of PBS solution was added for ultrasonic crushing for 30 min, the supernatant was collected by centrifugation, and the cells were removed with a 0.22 μm filter membrane to prepare a QYH-2023 metabolic extract mother liquor with a mass concentration of 10 mg / mL. The effect of QYH-2023 extracted metabolites on RAW264.7 cells was then detected by CCK-8 method. After being treated with QYH-2023 extracted metabolites of different mass concentrations, the proliferation of RAW264.7 cells was promoted and inhibited to varying degrees, and showed obvious dose dependence.

[0057] Results Figure 4 , it was calculated that when the concentration of the QYH-2023 strain extract was 0 to 900 ng / mL, the cell survival rate reached more than 100%. Among them, the RAW264.7 treatment with a concentration of 62.5 ng / mL had the best treatment effect, with a cell survival rate of 130%. Compared with the CK group (treatment concentration of 0 ng / mL), it can significantly promote cell growth, indicating that the red yeast QYH-2023 of the present invention is safe and non-toxic. Based on the above results, the metabolites extracted from the QYH-2023 strain with concentrations of 31.25 ng / mL and 62.5 ng / mL were selected as the concentrations for subsequent experiments.

[0058] Example 4 Detection of anti-inflammatory effect of Rhodotorula glutinosus QYH-2023

[0059] The same batch of RAW264.7 cells were inoculated into 96-well plates. LPS (final concentration of 3 μg mL –1 ) After incubation for 24 h, different concentrations (15.625 ng / mL, 31.25 ng / mL, 62.5 ng / mL, 125 ng / mL, 250 ng / mL) of metabolic extracts of Rhodotorula glutinosus QYH-2023 were added to the experimental groups and incubated for 24 h. 10 μL of CCK-8 solution (final concentration of 0.5 mg·mL –1 ), incubated at 37°C for 2 h. The absorbance of each well was measured at 450 nm on an ELISA reader. After treatment under the same experimental conditions, the supernatant was taken according to the instructions of the ELISA kit (Solarbio, China), and the absorbance of each well was measured at 450 nm on an ELISA reader. The concentration of inflammatory factors corresponding to the optical density of each well was calculated according to the standard curve.

[0060] like Figure 5 As shown in A, the survival rate of LPS-treated cells after 48 hours was only 24.35%, while the survival rate of LPS-stimulated cells treated with QYH-2023 strain extract was significantly restored, and at a concentration of 62.5 ng / mL, the survival rate of LPS-stimulated cells reached about 60%. The levels of inflammatory factors were detected using ELISA kits, and the results were as follows Figure 5 As shown in Figure B, under LPS stimulation, the inflammatory factor IFN-γ released by RAW264.7 cells was significantly increased (234 pg / mL) compared with the CK group (182 pg / mL), while the metabolites of Rhodotorula glutinosus QYH-2023 in the 62.5 ng / mL group (191.54 pg / mL) could significantly inhibit the production of cytokines (P<0.01), indicating that the Rhodotorula glutinosus QYH-2023 of the present invention can inhibit the occurrence of inflammation, and is safe and non-toxic, and its metabolic extracts can be used in anti-inflammatory health products, cosmetics and food.

[0061] Another batch of RAW264.7 cells were inoculated into 96-well plates. LPS (final concentration of 3 μg mL –1 ) After incubation for 24 h, different concentrations of carotenoids (12.5 μg / mL, 6.25 μg / mL, 3.125 μg / mL, 1.5625 μg / mL) were added to the experimental groups and incubated for 24 h. 10 μL of CCK-8 solution (final concentration of 0.5 mg·mL) was added to each well. –1), incubated at 37°C for 2 h. The absorbance of each well was measured at 450 nm on an ELISA reader. After treatment under the same experimental conditions, the supernatant was taken according to the instructions of the ELISA kit (Solarbio, China), and the absorbance of each well was measured at 450 nm on an ELISA reader. The concentration of inflammatory factors corresponding to the optical density of each well was calculated according to the standard curve.

[0062] like Figure 5 As shown in Figure C, the survival rate of LPS-treated cells was 42.75% after 48 hours, and the survival rate of LPS-stimulated cells treated with carotenoids was also restored, but the improvement was not significant compared with the effect of QYH-2023 treatment. The levels of inflammatory factors were detected using ELISA kits, such as Figure 5 As shown in D, under LPS stimulation, the inflammatory factor IFN-γ released by RAW264.7 cells was significantly increased compared with the CK group, while the carotenoids in the 12.5 μg / mL group could inhibit the production of cytokines (P<0.01), but the anti-inflammatory effect was far inferior to the QYH-2023 metabolite of the present invention. More importantly, natural and pure carotenoids are expensive and cost-effective. The production process of QYH-2023 metabolites is relatively simple, and it performs well in both dose dependence and efficiency, with extremely high cost-effectiveness. This discovery not only provides new ideas for the research and development of anti-inflammatory drugs, but also provides strong support for solving the problems of high cost and limited efficacy in the current anti-inflammatory drug market.

[0063] Example 5 Detection of carotenoid content in Rhodotorula glutinosus QYH-2023

[0064] Pick a single colony of QYH-2023 and inoculate it into SOC medium. The culture temperature is 30℃, the speed is 200rpm, and the culture is carried out for 60h. The bacteria are collected by centrifugation and fully ground into powder in liquid nitrogen. Weigh about 50mg of the ground bacteria and add them to the extract (a mixed solution of n-hexane / acetone / ethanol (1:1:1, v / v / v), and add 0.1% BHT with a concentration of 100mg / mL), vortex thoroughly, place on ice for 30min for extraction, centrifuge at 12000r for 5min at 4℃ to take the supernatant, repeat the extraction once, centrifuge and combine the supernatant, filter the obtained extract through a 0.22μm filter membrane, and store it in a brown injection bottle for liquid phase analysis.

[0065] The specific liquid phase conditions are as follows:

[0066] Chromatographic column: C18 column from Symmetry (USA) (particle size 5 μm, dimensions 150 × 4.6 mm);

[0067] Mobile phase: methanol: tetrahydrofuran (9:1, V / V), after preparation, pass through a 0.45 μm filter membrane, flow rate: 1.0 mL / min;

[0068] Column temperature: 30°C, sample volume: 20 μL, UV detection wavelength: 455 nm.

[0069] Standards were purchased from Fluka Chemical Co. (Buchs, Switzerland), and all solvents used as mobile phases were HPLC grade solvents provided by Aldrich (Steinheim, Germany).

[0070] Test results such as Figure 6 As shown, the carotenoid content produced by Rhodotorula glutinosus QYH-2023 after being cultured in SOC medium for 60 h was 1340 μg / g.

[0071] Example 7 Detection of lipid components of Rhodotorula glutinosus QYH-2023

[0072] A single colony of QYH-2023 was picked and inoculated into SOC medium, cultured at 30°C, 200 rpm, and cultured for 60 h. 50 μg of Rhodotorula glutinosus QYH-2023 was collected by centrifugation. Subsequently, 1 mL of lipid extraction solvent (methyl tert-butyl ether volume: methanol volume = 5:1) was added to the precipitate, vortexed for 2 minutes, and then the mixture was sonicated for 5 minutes. After sonication, 200 μL of sterile water was added to the mixture, and the fresh mixture was vortexed for another 1 minute and centrifuged for 10 minutes. Then, the supernatant was transferred to a clean vial and evaporated to dryness in a vacuum concentrator. The dried extract was then redissolved in 100 μL of dichloromethane / methanol (1:1, v / v) for LC-MS / MS analysis.

[0073] The specific liquid phase conditions are as follows:

[0074] Chromatographic column: The QYH-2023oAccucoreTM C30 column (particle size 2.6μm, size 2.1mm×100mmi.d.)

[0075] Mobile phase: Phase A, acetonitrile / water (60 / 40, V / V) (containing 0.1% formic acid, 10 mmol / L ammonium formate); Phase B, acetonitrile / isopropanol (10 / 90, V / V) (containing 0.1% formic acid, 10 mmol / L ammonium formate)

[0076] Column temperature: 45°C; sample volume: 2 μL; flow rate: 0.35 ml / min.

[0077] Test results such as Figure 7As shown, a total of 316 major lipids were detected in Rhodotorula glutinosae QYH-2023 in this study, mainly including bile acid, acylcarnitine, ceramide, diacylglycerol, glycosphingolipids, lysophosphatidylcholine, lysophosphatidylethanolamine, phosphatidylcholine, phosphatidylethanolamine, sphingomyelin and triglycerides, indicating that this strain is a typical lipid-producing yeast.

[0078] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0079] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A strain of Rhodotorula glutinis, deposited in the General Microbiological Center of China Microorganism Culture Collection Administration, with the deposit number of CGMCC NO.31398.

2. Use of the Rhodotorula glutinosus according to claim 1 in fermentation production of carotenoids and / or lipids.

3. The use according to claim 2, characterized in that: The method is achieved by the following steps: culturing the red yeast of claim 1 in SOC medium at 28-35° C. for 24-72 hours.

4. The use according to claim 2, characterized in that: The components of the SOC medium include: 2 g tryptone, 0.5 g yeast extract, 0.5 g NaCl, 2.5 mM KCl, 10 mM MgCl, 210 mM MgSO4, and 20 mM D-glucose.

5. A red yeast extract metabolite obtained by culturing and extracting the red yeast according to claim 1 in a YPD medium.

6. The Rhodotorula glutinosus extract metabolite according to claim 5, characterized in that The components of the YPD culture medium include: 10 g / L yeast extract, 20 g / L tryptone, and 20 g / L glucose.

7. Use of the Rhodotorula glutinosus extract metabolite according to claim 5 or 6 in the preparation of anti-inflammatory health products, cosmetics or foods.

Images