Application of inhibitor targeting LRP6 in regulation of residual feed intake of animals

Abstract

The invention discloses application of an inhibitor targeting LRP6 in regulation of residual feed intake of animals, and relates to the technical field of biology, the inhibitor is miRNA-96-5p, and the sequence of the miRNA-96-5p is as shown in SEQ ID No.1. The invention discloses an action mechanism of miRNA-96-5p targeting LRP6 for inhibiting proliferation of duck primary cells and promoting apoptosis, and the miRNA-96-5p can inhibit proliferation of duck primary cells and promote apoptosis through targeting inhibition of expression of LRP6. Therefore, the proliferation of animal primary hepatocytes is inhibited, the apoptosis of the animal primary hepatocytes is promoted, the lipid metabolism capability of the animal is improved, the residual feed intake of the animal is reduced, and a reference basis is provided for researching the function of miRNA in regulating the lipid metabolism and residual feed intake of poultry.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to application of an inhibitor targeting LRP6 in regulating the residual feed intake of animals. Background Art

[0002] Residual feed intake (RFI) is an indicator to measure animal feed efficiency, reflecting the difference in the amount of feed required by animals under the same production performance. In livestock and poultry, RFI is affected by multiple biological processes and plays a key role in regulating feed utilization efficiency. For example, adipose tissue growth, extracellular matrix formation, inflammation and immune response are all important factors affecting RFI. The liver is the core organ of poultry lipid metabolism and undertakes about 90% of lipid metabolism activities. The growth state of hepatocytes directly determines the efficiency and capacity of lipid metabolism in poultry. Hepatocyte cell lines cultured in vitro or primary hepatocytes directly isolated from poultry livers can exhibit most of the physiological functions of the liver.

[0003] MicroRNAs (miRNAs) are small non-coding RNAs with a size of about 19-24 nt. They are a class of small, endogenous, evolutionarily conserved RNAs. MiRNAs mainly work by binding to complementary target sequences in messenger RNA (mRNA) and interfering with the translation mechanism, thereby preventing or altering the production of protein products and widely regulating gene expression in animals, plants, and protozoa. MiRNAs play a key role in lipid processes, including adipocyte differentiation, lipid metabolism, cholesterol metabolism, insulin resistance, and immune response. At present, research on miRNA-96-5p mainly focuses on its role in tumorigenesis and development. In terms of lipid metabolism, Kang et al. found that miR-96-5p can promote adipogenesis by specifically inhibiting Smad7 expression. Desgagné V et al. found that miR-96-5p was negatively correlated with intracellular lipid and cholesterol levels by selectively regulating SREBP2. At the same time, a high-fat diet (HFD) leads to a decrease in the expression of miR-96-5p, indicating that miRNA-96-5p can promote fat metabolism. At present, the molecular mechanism by which miRNA-96-5p regulates duck primary hepatocytes is still unclear.

[0004] Low-density lipoprotein receptor-related protein 6 (LRP6) is a member of the low-density lipoprotein receptor (LDLR) family. It has a unique structure and ligand binding function and plays a vital role in lipoprotein endocytosis. When Tomaszewski et al. explored whether common genetic variations in LRP6 were related to low-density lipoprotein cholesterol, they found that LRP6 was a potential regulator of lipid metabolism and a new target for drug intervention. LRP6 plays a key role in the activation of the WNT classical signaling pathway, inhibiting adipogenesis and stimulating osteoblastogenesis. At the same time, related studies have shown that LRP6 can weaken the activity of GSK3β, which is a negative regulator of mTOR signaling. mTOR signaling is an important pathway for regulating adipogenesis. It can be seen that LRP6 also has a relevant role in lipid production. In summary, LRP6 and signaling pathways jointly regulate the generation and metabolism of adipocytes. However, there is no report on the regulatory relationship between miRNA-96-5p and LRP6.

[0005] Therefore, the present invention aims to analyze the molecular mechanism of miRNA-96-5p regulating duck primary hepatocytes and its regulatory relationship with LRP6 at the cellular level through the study of the molecular mechanism of proliferation and apoptosis of duck primary hepatocytes, so as to provide a reference for exploring the function of miRNA in regulating poultry lipid metabolism and residual feed intake of poultry. Summary of the invention

[0006] The purpose of the present invention is to provide an application of an inhibitor targeting LRP6 in regulating the residual feed intake of animals, aiming to provide a reference for exploring the function of miRNA in regulating poultry lipid metabolism and residual feed intake of poultry.

[0007] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0008] As a first aspect of the present invention, provided is the use of an inhibitor targeting LRP6 in regulating the residual feed intake of animals, wherein the inhibitor is miRNA-96-5p, and the sequence of miRNA-96-5p is shown in SEQ ID No.1.

[0009] As a further optimization scheme of the present invention, the miRNA-96-5p inhibits the proliferation of primary hepatocytes of animals, promotes apoptosis of primary hepatocytes of animals, and improves the lipid metabolism capacity of animals, thereby reducing the residual feed intake of animals.

[0010] As a further optimized solution of the present invention, the animal is poultry.

[0011] As a further optimization scheme of the present invention, the animal is a duck.

[0012] The second aspect of the present invention further provides a composition for regulating the residual feed intake of animals, comprising miRNA-96-5p, wherein the sequence of the miRNA-96-5p is shown in SEQ ID No.1.

[0013] The third aspect of the present invention also provides a kit for regulating the residual feed intake of animals, the kit comprising the composition as described above.

[0014] First, the present invention conducted a conservation analysis on miRNA-96-5p from duck and miRNA-96-5p from other species, and found that miRNA-96-5p is relatively conservative in species such as humans, zebrafish, pigs, and rabbits, while the sequence of miRNA-96-5p from duck shows obvious differences. Subsequently, through miRNA-96-5p target gene prediction and screening, the LRP6 gene was selected as the target gene of miRNA-96-5p for subsequent experiments.

[0015] Next, the present invention found that miRNA-96-5p and LRP6 were expressed to different degrees in the liver of meat ducks with high and low residual feed intake (high residual feed intake HRFI; low residual feed intake LRFI), among which the expression of miRNA-96-5p in the liver tissue of low residual feed intake was significantly higher than that in the liver tissue of high residual feed intake, while the expression of LRP6 in the liver tissue of high residual feed intake was significantly higher than that in the liver tissue of low residual feed intake, and it was found that the expression of miRNA-96-5p in the liver tissue was negatively correlated with LRP6. The liver is an important place for lipid metabolism, and LRP6 plays a vital role in lipoprotein endocytosis, indicating that miRNA-96-5p is related to LRP6 and lipid metabolism regulation.

[0016] Next, the present invention constructed LRP6-WT (wild-type plasmid) and LRP6-MT (mutant plasmid) and co-transfected them with miRNA-96-5p mimics (overexpression plasmid) and mimics NC in 293T cells respectively to identify the targeting relationship between miRNA-96-5p and LRP63′-UTR. It was found that transfection of miRNA-96-5p overexpression plasmid significantly reduced the luciferase activity of LRP6-WT, indicating that miRNA-96-5p exerts its physiological effect by targeting LRP63′-UTR.

[0017] Next, the present invention transfected duck primary hepatocytes with miRNA-96-5p mimics and miRNA-96-5p inhibitor, and detected the expression level of LRP6 gene mRNA in duck primary hepatocytes. It was found that miRNA-96-5p mimics extremely significantly inhibited the expression of LRP6 gene, and miRNA-96-5p inhibitor extremely significantly increased the expression of LRP6 gene. Western Blotting was used to detect the expression amount of LRP6 protein. With miRNA-96-5p mimics, the translation of LRP6 protein was inhibited and the protein content was relatively reduced, while with miRNA-96-5p inhibitor, the expression of LRP6 protein was increased, indicating that miRNA-96-5p targetedly regulated the expression of LRP6.

[0018] Next, the present invention co-transfects miRNA-96-5p mimics, miRNA-96-5p inhibitor and LRP6 siRNA, and detects changes in duck primary hepatocyte proliferation by CCK-8 method. miRNA-96-5p mimics extremely significantly inhibits duck primary hepatocyte proliferation, and miRNA-96-5p inhibitor extremely significantly promotes duck primary hepatocyte proliferation. The results show that miRNA-96-5p regulates duck primary hepatocyte proliferation; LRP6 siRNA extremely significantly inhibits cell proliferation. Cell apoptosis is detected by flow cytometry. miRNA-96-5p mimics extremely significantly promotes duck primary hepatocyte apoptosis, miRNA-96-5p inhibitor significantly inhibits duck primary hepatocyte apoptosis, and miRNA-96-5p can inhibit duck primary hepatocyte proliferation by targeting LRP6 and promote duck primary hepatocyte apoptosis.

[0019] Finally, the present invention found that after overexpression of miRNA-96-5p in duck primary hepatocytes, the expression levels of TC and TG decreased extremely significantly (P<0.01); after inhibition of miRNA-96-5p, the expression level of TC increased extremely significantly (P<0.01), and the expression level of TG increased significantly (P<0.05); after knocking down LRP6, the expression levels of TC and TG decreased extremely significantly (P<0.01). After overexpression of miRNA-96-5p in duck primary hepatocytes, the expression levels of SREBP1c, FASN and ACC1 were extremely significantly decreased (P<0.01), while after inhibition of miRNA-96-5p, the expression level of SREBP1c was significantly increased (P<0.05), and the expression levels of FASN and ACC1 were extremely significantly increased (P<0.01); after overexpression of miRNA-96-5p, the expression levels of FOXO1 and PPARγ were extremely significantly increased (P<0.01), while after inhibition of miRNA-96-5p, the expression levels of FOXO1 and PPARγ were extremely significantly decreased (P<0.01); after knockdown of LRP6, the expression levels of SREBP1c, FASN and ACC1 were extremely significantly decreased (P<0.01), the expression level of FOXO1 was extremely significantly increased (P<0.01), and the expression level of PPARγ was significantly increased (P<0.05).

[0020] In summary, the beneficial effects of the present invention are:

[0021] The present invention discovered that miRNA-96-5p targets the expression of LRP6 at the level of duck primary hepatocytes, providing a reference for exploring the function of miRNA in regulating poultry lipid metabolism and residual feed intake of poultry. Specifically, miRNA-96-5p inhibits the expression of LRP6 gene by targeting, thereby inhibiting the proliferation of duck primary hepatocytes, promoting the apoptosis of duck primary hepatocytes, and reducing the residual feed intake of ducks. Based on the fact that the growth state of poultry primary hepatocytes directly determines the lipid metabolism capacity of livestock and poultry bodies, and the level of lipid metabolism capacity directly reflects the level of residual feed intake of poultry, it can be concluded that miRNA-96-5p regulates the lipid metabolism capacity of ducks by targeting the expression of LRP6, and can achieve the regulation of the residual feed intake of ducks, providing a reference for the regulatory function of miRNA in the residual feed intake of livestock and poultry. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the conservation analysis of miRNA-96-5p in different species in Example 1;

[0023] Figure 2 The expression of miRNA-96-5p and LRP6 in the liver of ducks with high and low residual feed intake in Example 2 (in the figure, (a) is miRNA-96-5p; (b) is LRP6);

[0024] Figure 3The relative expression of miRNA-96-5p in different tissues provided in Example 2 of the present invention;

[0025] Figure 4 is the plasmid map of psiCHECK-2 in Example 3;

[0026] Figure 5 are the wild-type and mutant binding sites in Example 3;

[0027] Figure 6 The sequencing results of the wild-type plasmid and the mutant plasmid in Example 3 (in the figure, (a) target gene mutant; (b) target gene wild type);

[0028] Figure 7 The dual luciferase activity detection in Example 3;

[0029] Figure 8 The duck primary hepatocytes (100×) in Example 4 (in the figure, (a) to (f) are duck primary hepatocytes cultured for 0 days, 1 day, 2 days, 3 days, 4 days, and 5 days);

[0030] Fig. 9 The effect of miRNA-96-5p on LRP6 expression in Example 5 (in the figure, (a) miRNA-96-5p expression after overexpression of miRNA-96-5p; (b) miRNA-96-5p expression after inhibition of miRNA-96-5p; (c) LRP6 expression after overexpression and inhibition of miRNA-96-5p; (d) L RP6 protein expression after overexpression and inhibition of miRNA-96-5p);

[0031] Fig.10 This is the screening of siRNA knockdown efficiency in Example 6 (in the figure, (a) untransfected duck primary hepatocytes; (b) transfected duck primary hepatocytes);

[0032] Fig.11 for the identification of siRNA in Example 6 (100×);

[0033] Fig.12 The effect of miRNA-96-5p on the proliferation of duck primary hepatocytes in Example 6;

[0034] Fig.13 The effect of LRP6 on the proliferation of duck primary hepatocytes in Example 6;

[0035] Fig.14 The effect of miRNA-96-5p on apoptosis of duck primary hepatocytes in Example 6 (in the figure, (a) the effect of overexpression of miRNA-96-5p on apoptosis of duck primary hepatocytes; (b) the effect of inhibition of miRNA-96-5p on apoptosis of duck primary hepatocytes);

[0036] Fig.15 The effect of miRNA-96-5p on lipid indicators TC and TG in Example 7 (in the figure, (a) is TC; (b) is TG);

[0037] Fig.16 The effect of miRNA-96-5p on lipid-related gene expression in Example 7 (in the figure, (a) is SR EBP1c gene; (b) is FASN gene; (c) is ACC1 gene; (d) is FOXO1 gene; (e) is PPARγ gene);

[0038] Fig.17 The effect of knocking down LRP6 on lipid indicators TC and TG in Example 7 (in the figure, (a) is TC; (b) is TG);

[0039] Fig.18 The effect of knocking down LRP6 on the expression of lipid-related genes in Example 7 (in the figure, (a) is the SREBP 1c gene; (b) is the FASN gene; (c) is the ACC1 gene; (d) is the FOXO1 gene; (e) is the PP ARγ gene);

[0040] Note: In the above figures, * indicates significant difference at P<0.05, and ** indicates extremely significant difference at P<0.01. DETAILED DESCRIPTION

[0041] The present application is further described in detail below in conjunction with the accompanying drawings. It is necessary to point out here that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technical personnel in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0042] 1. Materials and Methods

[0043] The meat duck tissues used in the following examples were collected from the National Core Breeding Farm of Huangshan Qiangying Duck Industry Co., Ltd. The meat ducks were collected at 42 days of age and had complete pedigree records.

[0044] The duck primary hepatocytes used were isolated and cultured from 15-day-old duck embryos by the Poultry Biological Breeding and Healthy Farming Team of the College of Animal Science and Technology of Anhui Agricultural University. Before hatching the duck embryos, the surface was first wiped with 75% alcohol and cotton, placed on a clean egg tray to dry, and incubated at a constant temperature of 37.8% and 65% relative humidity. After 15 days of incubation, duck embryos with normal embryonic development were selected for the isolation and culture of duck primary hepatocytes.

[0045] The experimental animal sampling and related experimental procedures were carried out in strict accordance with the experimental animal license and ethical requirements of Anhui Agricultural University (SYXK 2016-007).

[0046] In the following examples, if no specific experimental methods are specified, all experimental methods can be carried out according to conventional methods. The materials, reagents, etc. used can be obtained through commercial channels unless otherwise specified.

[0047] Example 1 Conservative analysis of miRNA-96-5p and prediction of its binding site with target gene LRP6

[0048] 1.1. Conservation analysis of miRNA-96-5p in different species

[0049] The sequences of miRNA-96-5p of different species such as human (Homo sapiens), zebrafish (D anio rerio), pig (Sus scrofa), and chicken (Gallus gallus) were queried in the RNAcentral (https: / / rnacentral.org / ) database, and then the conservation of miRNA-96-5p among different species was observed based on the sequence of miRNA-96-5p (as shown in SEQ ID No.1).

[0050] Sequence comparison revealed that miRNA-96-5p is relatively conserved in species such as humans, zebrafish, pigs, and rabbits. Figure 1 The mature sequence is TTGGCACTAGCACATTTTTG, while in ducks the conserved sequence is TTGGCACT, showing obvious differences.

[0051] 1.2 Prediction of binding sites between miRNA-96-5p and target gene LRP6

[0052] To evaluate the targeting relationship between miRNA-96-5p and the target gene LRP6, the NCBI (www.ncbi.nim.nih.gov) website was accessed according to the GenBank accession number of LRP6 (XM_038172428.1) to obtain its sequence information, and according to the sequence of miRNA-96-5p (as shown in SEQ ID No. 1), the RNAhybrid software was used to predict and analyze the binding sites between miRNA-96-5p and the target gene LRP6. By analyzing the prediction results of RNAhybrid, the specific binding sites between miRNA-96-5p and LRP6, as well as the binding energy and complementarity of these sites were obtained.

[0053] Table 1 Binding sites of miRNA-96-5p and target genes

[0054]

[0055] As shown in Table 1 , the lower the binding energy, the higher the degree of complementarity, indicating that the binding between miRNA and target gene is more stable and the targeting relationship is more likely to be established. Therefore, LRP6 gene was selected as the target gene of miRNA-96-5p for subsequent experiments.

[0056] Example 2 Expression analysis of miRNA-96-5p and LRP6 in liver tissues of high and low RFI ducks

[0057] 2.1 Total RNA extraction

[0058] Six liver tissue samples were randomly selected from 42-day-old high and low RFI ducks, and six liver, thymus, pectoral muscle and spleen tissue samples were randomly selected from 42-day-old ducks (similar weight, healthy and strong individuals) for total RNA extraction. The total RNA was extracted using the Kangwei Century Ultrapure RNA Kit (DNase I) and the quality of the extracted total RNA was detected by agarose gel electrophoresis and Nanodrop spectrophotometer.

[0059] 2.2 Design of primers for miRNA-96-5p and target genes

[0060] According to the miRNA-96-5p sequence, the primer sequence was designed, and the internal reference gene was U6. The target gene LRP6 sequence was retrieved from the NCBI (www.ncbi.nim.nih.gov) website, and the primers were designed using Primer 5.0 software, and the internal reference gene was the β-actin gene. All primers were synthesized by Sangon Biotechnology Co., Ltd. (Shanghai), and the sequence design is shown in Table 2.

[0061] Table 2 Reverse transcription primers

[0062]

[0063] 2.3 cDNA Synthesis

[0064] The full gold reverse transcription kit EasyScript One-Step gDNA Removal and cDNASynthesis SuperMix (Cat. No.: AE-311) was used, with a total system of 20 μL, and the components are shown in Table 3. After mixing the components, incubate them in a 42°C water bath for 1 h to obtain the first-strand cDNA, and dilute the reverse transcribed cDNA 2.5-5.0 times with H2O for subsequent fluorescent quantitative PCR reaction.

[0065] Table 3 Reverse transcription system

[0066]

[0067] 2.4 Fluorescence quantitative PCR

[0068] The expression level was analyzed by using the SYBR Green I real-time fluorescence quantitative PCR method using the full-scale gold TransStart Green qPCR SuperMix (Cat. No.: AQ131-01), and the reaction system was 20 μL. Three replicates were performed for each sample. The specific reaction system and amplification procedure are shown in Tables 4 and 5.

[0069] Table 4 Reaction system

[0070]

[0071] Table 5 Real-time fluorescence quantitative PCR amplification program

[0072]

[0073] 2.5 Statistical analysis

[0074] The results of fluorescence quantification in the experiment were preprocessed and sorted using Excel 2021. According to the Ct value of the target gene and the Ct value of the internal reference gene obtained in the experiment, 2 -ΔΔCt Statistical analysis was performed using the calculation method. Data analysis and graphics were completed using GraphPad Prism 6 software. * indicates significant difference (P<0.05), ** indicates extremely significant difference (P<0.01).

[0075] The results are as follows Figure 2 As shown, miRNA-96-5p and LRP6 were expressed in the liver tissues of high and low RFI ducks. The expression of miRNA-96-5p in low RFI (calculated as LRFI) was higher than that in high RFI (calculated as HRFI), and the difference was extremely significant (P<0.01). The expression of LRP6 in the liver tissue of high RFI ducks was higher than that in the liver tissue of low RFI ducks, and the difference was extremely significant (P<0.01).

[0076] The relative expression of miRNA-96-5p in liver, thymus, spleen and pectoral muscle was also detected. Figure 3 The relative expression level of miRNA-96-5p in the liver was higher, and the difference was extremely significant (P<0.01). The results showed that hepatocytes could be used for subsequent experiments.

[0077] Example 3 Dual luciferase assay

[0078] 3.1 Construction of dual luciferase expression vector of miRNA and target gene

[0079] (1) Select psiCHECK-2 plasmid as the vector. Figure 4, according to the sequences on both sides of the binding site of miRNA-96-5p and the target gene LRP6 wild type and mutant, such as Figure 5 , and the restriction sites at both ends to design primer sequences, see Table 6;

[0080] (2) Amplifying the fragment PCR product by PCR, recombining the wild-type (WT) and mutant (MT) target fragments into the target vector psiCHECK-2 (XhoI--NotI restriction enzyme digestion vector) by multi-segment recombination, and recovering and purifying the obtained product by 0.8% agarose gel electrophoresis;

[0081] (3) Digest the vector with restriction endonucleases. The entire test process was performed on ice. The double enzyme digestion reaction system is shown in Table 7; the ligation system is shown in Table 8. After adding the relevant reagents, mix them thoroughly and place them in a constant temperature environment of 52°C for 30 minutes.

[0082] (4) Recombinant plasmid transformation: Pipette 1-3 μL of plasmid with a concentration of about 100 ng / μL into 100 μL of competent cells, gently shake and rotate to mix, place on ice for 3 min, then place in a 42°C water bath for 90 s, place in an ice bath for about 3 min, add 500-800 μL of 37°C pre-warmed LB medium to each tube, and gently shake at 37°C at 200 rpm for 40 min;

[0083] (5) Screening and identification of positive clones: Prepare agar plates containing corresponding resistance, take 100 μL of bacterial solution and spread it on the agar plate containing corresponding resistance, use a sterile glass spreader to gently spread the bacteria on the surface of the plate, place the plate at 37℃ for 15 minutes, invert the plate and culture it at 37℃ for 12-16 hours until colonies appear, shake the bacteria at 37℃ at 250rpm for 14 hours, and use the bacterial solution for PCR identification, primer 0.5 μL, template bacterial solution 2 μL, polymerase buffer 0.5 μL, buffer 3 μL, ddH2O 14 μL. Cycle parameters: 96℃ pre-denaturation for 3 minutes; 95℃ for 15 seconds, 58℃ for 15 seconds, 72℃ for 20 seconds, 23 cycles; 72℃ final extension for 1 minute. Send the positive clone bacterial solution to a biological company for sequencing.

[0084] (6) Use the instructions of the plasmid mini-extraction kit of General Biotechnology (Anhui) Co., Ltd. to extract the plasmid, and determine whether the plasmid is successfully constructed based on the sequencing results. Figure 6 The designed sequence was consistent with the sequencing result, and the results showed that the wild-type and mutant recombinant plasmids of the target gene were successfully constructed.

[0085] Table 6 Target gene primer sequences

[0086]

[0087]

[0088] Table 7 Double enzyme digestion system

[0089]

[0090] Table 8 Connection system

[0091]

[0092] 3.2293T cell transfection

[0093] 293T cells were routinely cultured in DMEM medium containing 10% fetal bovine serum (BI) in a 37°C, 5% CO2 saturated humidity incubator. After culturing 293T cells, the miRNA-96-5p sequence was obtained, and miRNA-96-5p mimics, inhibitors, mimics NC and inhibitor NC were designed. The sequences are shown in Table 9. The above sequences were synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd. When 293T cells were cultured to 80%-90%, transfection was performed, and the vectors psiCHECK-2, LRP6-WT and LRP6-MT were co-transfected with miRNA-96-5p mimics and mimics NC, respectively.

[0094] Table 9 miRNA-96-5p mimics and inhibitor sequence information

[0095]

[0096]

[0097] 3.3 Dual luciferase activity analysis

[0098] Discard the old culture medium in the cell culture plate, wash twice with PBS, and discard the supernatant. Add 100μL of 1×Cell Lysis Buffer to the culture wells, passively lyse the cells, gently shake the culture plate at room temperature for 5-10min, centrifuge at 12000rpm for 2min, transfer the lysate supernatant to a 96-well black ELISA plate, 20μL per well, and 3 replicates for each sample. Start the multifunctional microplate reader, set the parameters and sensitivity, read the plate for 5s, and complete the test within 5min. Add 100μL of LRB II reagent to each well to detect the firefly luciferase activity (Firefly value), remove the test plate, add 100μL of Renilla reagent to each well, and detect the Renilla luciferase activity (Renilla value). Determine the relative luciferase activity based on the ratio of firefly luciferase activity to Renilla luciferase activity.

[0099] The results are as follows Figure 7When the overall experimental system of 293T cells was stable and reliable, after the introduction of miRNA-96-5p mimics, the LRP6 wild-type plasmid (LRP6-WT) significantly inhibited the expression of luciferase due to the binding of LRP6 to miRNA-96-5p (P<0.05). The results showed that there was a targeting relationship between miRNA-96-5p and LRP6.

[0100] Example 4 Isolation and culture of duck primary cells

[0101] Duck embryos hatched to 15 days old were used to isolate and culture duck primary hepatocytes using type IV collagenase, and then cultured in a cell culture incubator at 37°C and 5% CO2. The morphology of duck primary hepatocytes was observed and photographed. Figure 8 In the early stage of culture, duck primary hepatocytes were translucent, spherical or elliptical, with clear boundaries and large nuclei. As the culture time went on, the cells began to adhere to the wall. After 48 hours of culture, the number of cells attached to the wall increased, showing a typical epithelial cell-like polygonal morphology, the cells became flat and thin, the volume increased, and island connections began to appear between cells.

[0102] Example 5 Effect of miRNA-96-5p on LRP6

[0103] 5.1 Transfection of duck primary hepatocytes

[0104] Duck primary hepatocytes were seeded in 12-well cell culture plates at a cell density of 5×10 5 cells / well, and when the cell confluence reached 70%, lipofectamine 2000 was used for transfection. Experimental groups: miRNA-96-5p mimics NC and miRNA-96-5p mimics; miRNA-96-5p inhibitor NC and miRNA-96-5p inhibitor. The specific steps are as follows:

[0105] (1) Dilute 2.5 μL of mimics (final concentration 50 nM) and 5 μL of inhibitor (final concentration 100 nM) in 100 μL Opti-MEM, and mix by gently pipetting 3 to 5 times;

[0106] (2) Gently invert to mix the transfection reagent. Dilute 2.5 μL Lipofectamine 2000 with 100 μL Opti-MEM. Gently pipette 3 to 5 times to mix. Let stand at room temperature for 5 min.

[0107] (3) Mix the transfection reagent dilution and each group of mimics and inhibitor dilutions separately, pipette gently 3 to 5 times to mix well, and let stand at room temperature for 15 minutes;

[0108] (4) Add the transfection complex to each well (207.5 μL / well), add 800 μL Opti-ME M to each well, shake the cell culture plate gently to mix evenly, change the medium after 6-8 hours, and add 1 mL of complete medium to each well;

[0109] (5) The cell culture plate was placed in a 37° C., 5% CO 2 incubator for incubation. After 48 h, the cells were collected for fluorescence quantitative PCR detection.

[0110] 5.2 Fluorescence quantitative PCR

[0111] After transfection of miRNA-96-5p mimics and inhibitors for 48 hours, the culture medium of duck primary hepatocytes was discarded, 500 μL trypsin was added to each well for 2 min digestion, 500 μL complete culture medium was added to each well to terminate digestion, centrifuged at 2000 rpm for 5 min, the supernatant was discarded, the cell pellet was washed twice with PBS, and finally the cell pellet was retained and resuspended in 100 μL PBS. 1 mL Trizol was added to each cell, and the fluorescence quantitative PCR steps were the same as 2.4.

[0112] 5.3 Western blotting to detect the expression of LRP6 protein after transfection of miRNA-96-5p mimics and inhibitor

[0113] (1) Sample collection and processing: The cell density was 1×10 6 cells / well, 5μL of mimics and 10μL of inhibitor were diluted with 200μL Opti-MEM, and the cells were plated in 6-well plates. The number of cells inoculated, the transfection reagent and the transfected RNA dose were all ×2 times.

[0114] (2) Protein electrophoresis PAGE gel preparation: Use 8% separation gel and 5% stacking gel for protein electrophoresis. The configuration of 8% separation gel includes 1.3 mL 30% Acrylamide, 1.3 mL 1.5 M Tris-HCL (P h8.8), 0.05 mL 10% SDS, 0.05 mL 10% ammonium persulfate, 0.003 mL TEMED, and 2.3 mL H2O. The configuration of 5% stacking gel includes 0.33 mL 30% Acrylamide, 0.25 mL 1.5 M Tris-HCL (Ph 6.8), 0.02 mL 10% SDS, 0.02 mL 10% ammonium persulfate, 0.002 mL TEMED, and 1.4 mL H2O.

[0115] (3) SDS-PAGE protein electrophoresis and transfer: After boiling and cooling, the protein sample is centrifuged instantly, and the liquid on the tube wall is centrifuged to the bottom of the tube. About 25 μL of the sample is added to the loading well, and the concentrated gel is run at 80V constant voltage for 20 minutes. The voltage is adjusted to 120V and the running is continued until all the loading buffer runs out of the PAGE gel. After the electrophoresis is completed, the PAGE gel is removed and cut according to the molecular weight of the target protein and the internal reference. At the same time, the PVDF membrane is cut to the same size as the PAGE gel. Before transfer, the PVDF membrane is soaked in 100% formaldehyde for about 20-30 seconds to activate the membrane. This experiment used a PVDF membrane with a pore size of 0.45μm. From cathode to anode, the transfer tank was prepared in the sandwich order of filter paper (3-5 layers of 3M filter paper)---PAGE gel---PVDF membrane---filter paper (3-5 layers of 3M filter paper), placed in the transfer tank, added transfer buffer, and used a wet transfer system (semi-dry transfer equipment). 300mA constant current transfer was used for 35-40min. The transfer time of different proteins is related to their molecular weight. The larger the molecular weight, the longer the transfer time. The transferred membrane was taken out to observe whether the transfer was thorough (observed according to the pre-stained color protein Mark), and rinsed twice with 0.5‰ TBST to seal the transferred membrane.

[0116] (4) Western blotting and ECL exposure photography: Place the transferred PVDF membrane in blocking solution and block overnight at 4°C or 1-2h at 37°C. The blocking solution is a 2%-5% BSA solution prepared in TBST (mass volume ratio, 5g BSA + 100mL TBST). Both TBST and PBST can be used, as above and below; Incubate the primary antibody: Use the blocking solution to dilute the target protein primary antibody Anti-LRP6 (rabbit polyclonal antibody: 180KD) to 1:2000, and the internal reference GAPDH (rabbit polyclonal antibody: 36KD) to 1:5000, and incubate at 4°C overnight; Wash: Wash 5 times with TBST, and wash vigorously on a horizontal shaker for 3min / time; Incubate the secondary antibody: Use the blocking solution to dilute the HRP-labeled secondary antibody (goat anti-rabbit IgG antibody) to 1:3000, and incubate at room temperature for 1-2h; Wash: Wash 5 times with TBST, and wash vigorously on a horizontal shaker for 3mi n / times; Mix 500μL ECL luminescent liquid A and 500μL ECL luminescent liquid B together and mix well. Add the mixture drop by drop to the parallel position where the PVDF membrane protein is located, let it stand for about 20s, put the PVDF membrane into the chemiluminescence detection instrument, adjust the exposure time, and take pictures for storage.

[0117] The results are as follows Fig. 9, indicating that the expression of miRNA-96-5p was significantly increased after transfection of miRNA-96-5p mimics, i.e., overexpression of miRNA-96-5p (P<0.01); the expression of miRNA-96-5p was significantly decreased after transfection of miRNA-96-5 inhibitor, i.e., inhibition of miRNA-96-5p (P<0.05); the expression of LRP6 was significantly inhibited after overexpression of miRNA-96-5p (P<0.01), and the expression of LRP6 was significantly promoted after inhibition of miRNA-96-5p (P<0.01);

[0118] Western Blotting was used to detect the expression of LRP6 protein. After overexpression of miRNA-96-5p, the translation of LRP6 protein was inhibited and the protein content was relatively reduced. After inhibiting miRNA-96-5p, the expression of LRP6 protein increased, which was consistent with the trend of fluorescence quantitative PCR, indicating that miRNA-96-5p targeted LRP6 at the level of duck primary hepatocytes.

[0119] Example 6 Effects of miRNA-96-5p and LRP6 on duck primary hepatocytes

[0120] 6.1 siRNA efficiency detection and identification

[0121] According to the LRP6 sequence information, the siRNA sequences were designed and synthesized, and they were named siRNA-1, siRNA-2 and siRNA-3. The sequence information is shown in Table 10. There were two control groups, one negative control siRNA, named siRNA NC, and the other control group was siRNA with FAM fluorescent label, named FAM-siRNA. The sequences were synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd. Duck primary hepatocytes were inoculated in 12-well cell culture plates at a cell density of 5×10 5 cells / well. When the cell confluence reaches 70%, use liposome Lipofectamine 2000 for transfection. The transfection steps are as follows:

[0122] (1) Dilute 10 μL of each siRNA with 100 μL Opti-MEM (final concentration 200 nM), pipette gently 3 to 5 times to mix, gently invert to mix the transfection reagent, dilute 2.5 μL Lipofectamine 2000 with 100 μL Opti-MEM, pipette gently 3 to 5 times to mix, and let stand at room temperature for 5 min;

[0123] (2) Mix the transfection reagent dilution and each siRNA dilution separately, pipette gently 3 to 5 times to mix well, and let stand at room temperature for 15 minutes;

[0124] (3) Add the transfection complex to each well (212.5 μL / well), add 800 μL Opti-ME M to each well, shake the cell culture plate back and forth to mix evenly, change the medium after 6-8 hours, and add 1 mL of complete culture medium to each well. Place the cell culture plate in a 37°C, 5% CO2 incubator and culture the cells after 48 hours for fluorescence quantitative PCR to detect the interference efficiency of each siRNA.

[0125] Fluorescence quantitative PCR was used to detect the knockdown efficiency of each siRNA. The steps of fluorescence PCR detection were the same as those in 2.4. The results were as follows: Fig.10 , the proportion of duck primary hepatocytes emitting green fluorescence accounted for more than 80%. The results showed that the transfection efficiency was good and subsequent experiments could be carried out. siRNA-1 and siRNA-2 extremely significantly reduced the expression level of LRP6 (P<0.01), and siRNA-3 significantly reduced the expression level of LRP6 (P<0.05). Among them, the expression levels of siRNA-1, siRNA-2 and siRNA-3 were 82%, 46% and 84%, respectively. The knockdown efficiencies of the three siRNA test groups were calculated to be 18%, 54% and 16%, respectively. Fig.11 The results showed that siRNA-2 was the best interference sequence.

[0126] Table 10 siRNA sequence information

[0127]

[0128] 6.2 Detection of duck primary cell proliferation by CCK-8 method

[0129] In this study, CCK-8 method was used to detect the changes in the proliferation capacity of duck primary hepatocytes after transfection of miRNA-96-5p mimics, inhibitors and siRNAs in each group. The cells were inoculated in 96-well culture plates, 2-3×10 4 cells / well. Transfection was performed when the cell confluence reached 70%. The specific steps are as follows:

[0130] (1) Use Opti-MEM to dilute mimics NC, mimics, inhibitor NC, and inhibitor, i.e., mimics group: 35 μL Opti-MEM + 1.75 μL mimics RNA, the final concentration is 50 nM, inhibitor group: 35 μL Opti-MEM + 3.5 μL inhibitor RNA, the final concentration is 100 nM;

[0131] (2) Gently invert the transfection reagent and dilute 1.75 μL Lipofectamine 2000 with 35 μL Opti-MEM in each group. Gently pipette 3 to 5 times to mix well and let stand at room temperature for 5 min. Prepare 4 tubes of the same reagent in total.

[0132] (3) Mix the transfection reagent diluent and each group of dilutions separately to form a transfection complex, gently pipette 3 to 5 times to mix, and let stand at room temperature for 15 minutes;

[0133] (4) First, add 90 μL / well of fresh DMEM medium (containing 10% FBS) to each well, then add the transfection complex to each well at 10 μL / well, gently shake the cell culture plate back and forth to mix evenly, and place the cell culture plate in a 37°C, 5% CO2 incubator for 48 h;

[0134] (5) 48 h after transfection, add 10 μL of CCK-8 reagent to each well (including 6 blank control wells), gently tap the culture dish to mix, place it in a 37°C incubator, continue to culture for 1 h, read the results at a wavelength of 450 nm on a microplate reader, and save the data.

[0135] The results are as follows Fig.12 , overexpression of miRNA-96-5p significantly inhibited the proliferation of duck primary hepatocytes (P<0.01), and inhibition of miRNA-96-5p significantly promoted the proliferation of duck primary hepatocytes (P<0.01); Fig.13 The results showed that knockdown of LRP6 significantly inhibited cell proliferation (P<0.01).

[0136] 6.3 Detection of apoptosis in duck primary hepatocytes by flow cytometry

[0137] The cell inoculation and transfection process are the same as 6.2. The cell density is 5×10 5 cells / well, 2.5μL of mimics and 5μL of inhibitor were diluted with 100μL Opti-MEM, and the cells were plated in 12-well plates. After 48h of transfection, the cells were collected by trypsin digestion. Annexin V-FITC / PI cell apoptosis detection kit (Lianke Bio, AP101-100) was used to perform flow cytometry to detect the changes in the apoptosis ability of duck primary hepatocytes after transfection with mimics and inhibitors. The steps are as follows:

[0138] (1) 48 hours after transfection, aspirate the cell culture medium into a suitable centrifuge tube, wash the cells once with PBS, and digest the cells with an appropriate amount of trypsin;

[0139] (2) After cell digestion, add the collected cell culture medium and mix briefly, transfer to a centrifuge tube, centrifuge at 1000 g for 5 min, discard the supernatant, collect the cells, gently resuspend the cells in PBS and count them;

[0140] (3) Take 1 to 5 × 10 5 The resuspended cells were centrifuged at 1000 g for 5 min, the supernatant was discarded, and 500 μL 1× Binding Buffer (the stock solution was 5×, which was diluted to 1× with deionized water) was added to gently resuspend the cells;

[0141] (4) Add 5 μL Annexin V-FITC and 10 μL PI to each group and mix gently;

[0142] (5) Incubate at room temperature (20-25°C) in the dark for 10 min;

[0143] (6) Flow cytometry was then performed. Annexin V-FITC was detected through the FITC detection channel (Ex=488 nm; Em=530 nm) and PI was detected through the PI detection channel (Ex=535 nm; Em=615 nm) on the flow cytometer.

[0144] The results are as follows Fig.14 Overexpression of miRNA-96-5p significantly promoted apoptosis of duck primary hepatocytes (P<0.01), while inhibition of miRNA-96-5p significantly inhibited apoptosis of duck primary hepatocytes (P<0.05).

[0145] 6.4 Data analysis and significance test were completed using SPSS 19.0 software to ensure the accuracy and reliability of the results, and the graphics were completed using GraphPad Prism 6 software. * indicates a significant difference (P < 0.05), and ** indicates an extremely significant difference (P < 0.01).

[0146] Example 7

[0147] 7.1 Detection of the effects of miRNA-96-5p on lipid indicators TC and TG and lipid-related genes

[0148] 7.1.1 Detection of the effect of miRNA-96-5p on lipid indicators TC and TG

[0149] The cell inoculation and transfection process was the same as 6.2. The cell density was 1×106 cells / well. 5μL of mimics and 10μL of inhibitor were diluted with 200μL Opti-MEM, and the cells were plated on a 6-well plate. 48h after transfection, the cells were trypsinized and washed with PBS. Finally, the cell pellets were collected and tested according to the instructions of the total cholesterol (TC) and triglyceride (TG) detection kit (Nanjing Jiancheng Bioengineering Institute).

[0150] like Fig.15As shown, after overexpression of miRNA-96-5p, the expression levels of TC and TG in duck primary hepatocytes were extremely significantly decreased (P<0.01). After inhibition of miRNA-96-5p, the expression level of TC in duck primary hepatocytes was extremely significantly increased (P<0.01) and the expression level of TG was significantly increased (P<0.05). The results showed that miRNA-96-5p promoted lipid metabolism.

[0151] 7.1.2 Detection of the effect of miRNA-96-5p on lipid-related genes

[0152] The cell inoculation and transfection process were the same as in 5.1. The cell density was 5×10 5 cells / well, 2.5μL of mimics and 5μL of inhibitor were diluted with 100μL Opti-MEM, and the cells were plated in 12-well plates. 48h after transfection, the cells were collected by trypsin digestion, and the genes SREBP1c, ACC1, FASN, PPARγ and FOXO1 were detected by fluorescence quantitative PCR, with β-actin as the internal reference. The primer sequences are shown in Table 11, and the fluorescence quantitative PCR steps are the same as 5.2.

[0153] Table 11 Primer sequence information

[0154]

[0155]

[0156] like Fig.16 As shown, the expression levels of SREBP1c, FASN and ACC1 in duck primary hepatocytes overexpressing miRNA-96-5p were extremely significantly decreased (P<0.01), while the expression levels of SREBP1c in duck primary hepatocytes inhibiting miRNA-96-5p were significantly increased (P<0.05), and the expression levels of FASN and ACC1 were extremely significantly increased (P<0.01); the expression levels of FOXO1 and PPARγ in duck primary hepatocytes overexpressing miRNA-96-5p were extremely significantly increased (P<0.01), while the expression levels of FOXO1 and PPARγ in duck primary hepatocytes inhibiting miRNA-96-5p were extremely significantly decreased (P<0.01). The results again indicated that miRNA-96-5p promoted lipid metabolism.

[0157] 7.2 Detection of the effects of LRP6 on lipid indicators TC and TG and lipid-related genes

[0158] 7.2.1 Detection of the effect of LRP6 on lipid markers TC and TG

[0159] Duck primary hepatocytes were seeded in 6-well cell culture plates at a cell density of 1×10 6cells / well. When the cell confluence is 70%, use liposome Lipofectamine 2000 for transfection. The specific steps are as follows:

[0160] (a) Dilute siRNA-220 μL with 200 μL Opti-MEM to a final concentration of 200 nM, and pipette gently 3 to 5 times to mix;

[0161] (b) Gently invert to mix the transfection reagent, dilute 5 μL Lipofectamine 2000 with 200 μL Opti-MEM, pipette gently 3 to 5 times to mix, and let stand at room temperature for 5 min;

[0162] (c) Mix the transfection reagent dilution and each siRNA dilution separately, pipette gently 3 to 5 times to mix well, and let stand at room temperature for 15 minutes;

[0163] (d) Add the transfection complex to each well (425 μL / well), add 1600 μL Opti-ME M to each well, shake the cell culture plate gently to mix evenly, change the medium after 6-8 hours, and add 2 mL complete medium to each well;

[0164] (e) The cell culture plate was placed in a 37°C, 5% CO2 incubator for culture. 48 h after transfection, the cells were trypsinized and washed with PBS. Finally, the cell pellets were collected and tested according to the instructions of the TC and TG detection kits (Nanjing Jiancheng Bioengineering Institute).

[0165] like Fig.17 As shown in the figure, the expression levels of TC and TG in duck primary hepatocytes were significantly decreased after knocking down LRP6 (P<0.01), which was consistent with the expression trend of TC and TG in duck primary hepatocytes after overexpression of miRNA-96-5p, indicating that miRNA-96-5p can promote lipid metabolism by targeting LRP6.

[0166] 7.2.2 Detection of the effect of LRP6 on lipid indexes TC and TG

[0167] The transfection steps are the same as 6.1, and the steps for detecting lipid-related genes are the same as 7.1.2.

[0168] like Fig.18 As shown in the data, after knocking down LRP6, the expression levels of SREBP1c, FASN and ACC1 were extremely significantly decreased (P<0.01), the expression level of FOXO1 was extremely significantly increased (P<0.01), and the expression level of PPARγ was significantly increased (P<0.05), which was consistent with the expression trend of SREBP1c, FASN, ACC1, FOXO1 and PPARγ in duck primary hepatocytes after overexpression of miRNA-96-5p, once again indicating that miRNA-96-5p can promote lipid metabolism by targeting LRP6.

[0169] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. Application of an inhibitor targeting LRP6 in regulating the residual feed intake of animals, characterized in that: The inhibitor is miRNA-96-5p, and the sequence of miRNA-96-5p is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that: The miRNA-96-5p inhibits the expression of LRP6 gene through targeted inhibition, thereby inhibiting the proliferation of primary hepatocytes of animals, promoting apoptosis of primary hepatocytes of animals, and improving the lipid metabolism capacity of animals to reduce the residual feed intake of animals.

3. The use according to claim 1, characterized in that: The animals are poultry.

4. The use according to claim 1, characterized in that: The animal is a duck.

5. A composition for regulating the residual feed intake of animals, characterized in that: The composition includes miRNA-96-5p, and the sequence of the miRNA-96-5p is shown as SEQ ID No.

1.

6. A kit for regulating the residual feed intake of an animal, characterized in that: The kit comprises the composition of claim 5.

Images