Rice appearance quality gene identification and molecular marker-assisted breeding method

Abstract

The invention relates to the technical field of plant genetic engineering and molecular genetics, and discloses a rice appearance quality gene identification and molecular marker-assisted breeding method, which comprises the following steps: constructing a knockout material of a rice grain appearance regulation gene FN20; matching the mutant fn20 with a rice strain FN20 with normal rice grain appearance; a material containing a rice grain appearance quality regulation gene FN20 is constructed, and the rice appearance quality gene identification and molecular marker-assisted breeding method comprises the following steps: cloning the rice grain appearance quality regulation gene FN20 (OsPFPB) from a rice grain appearance quality regulation mutant fn20 by utilizing a map-based cloning technology; the method comprises the following steps: knocking out an FN20 (OsPFPB) gene in rice by using a gene editing system to obtain a homozygous strain with changed rice grain appearance quality; the FN20 (OsPFPB) gene can be applied to the field of rice breeding, and has important practical significance on removal of false hybrids in the early stage of hybrid seed production, namely seed purity identification and molecular-assisted selection breeding application of oriented rice grain appearance quality improvement.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering and molecular genetics, and in particular to a method for rice appearance quality gene identification and molecular marker-assisted breeding. Background Art

[0002] Rice (Oryza sativa L.) is one of the important food crops that humans depend on for survival. Starch is the main storage material in rice endosperm. According to the different ways of connecting its glucose molecules, it can be divided into amylose and amylopectin. The different proportions and structures of the two have different degrees of influence on the physicochemical properties, appearance quality and edible quality of rice. Amylose content (AC) is one of the important indicators for evaluating the taste quality of rice. Genetic studies have shown that rice AC is a complex trait, which is regulated by Wx and multiple quantitative trait loci (QTLs). Existing research results have shown that there may be QTL micro-effect loci that affect rice AC on all 12 chromosomes of rice. Moreover, there are obvious differences in the results obtained between different studies. Except for the Wx gene, most micro-effect QTL loci have low reproducibility under different environments. Therefore, analyzing the formation and genetic regulation mechanism of rice quality is an important research direction of rice, and improving rice quality is an important breeding goal for rice breeders; it is particularly important to explore practical improvement measures and technical solutions for improving rice quality.

[0003] Starch synthesis in rice endosperm is a complex biological process involving multiple synthases and multiple metabolic pathways. The synthesis of storage starch starts with ADPG, which synthesizes amylose and amylopectin under the action of multiple starch synthases and starch synthesis regulatory factors; in this process, mutations in genes encoding some key enzymes will lead to abnormal endosperm appearance, such as atrophy, powdery or chalky endosperm. Therefore, the coordination between different starch synthesis metabolic pathways plays a vital role in regulating the appearance quality of rice grains.

[0004] In addition, mutations in genes such as FLO10, FLO13, and FLO14, which are involved in energy conversion and supply, and FLO11, which mediates the transport function of plastid proteins, will form a powdery endosperm phenotype. Furthermore, there is a class of genes that regulate the appearance of rice grains, which bind to specific domains of key genes related to starch synthesis, change the function of proteins, and thus affect starch synthesis and endosperm development, such as FLO6 and FLO7. And by affecting Wx bThe shear efficiency of the precursor is reduced to reduce the content of amylose, thus affecting the phenotype of the endosperm. In the glycolysis / gluconeogenesis pathway, mutations in genes such as OsPK and OsPPDK affect the material flow and energy conversion in the glycolysis / gluconeogenesis pathway, causing the appearance of rice grains to decline and form an opaque white heart-shaped endosperm.

[0005] Pyrophosphate: D-fructose-1,6-bisphosphotransferase (PFP) is a key enzyme that connects pentose and hexose conversion in glycolysis / gluconeogenesis metabolism. It has two subunit types (α and β). Normally, pyrophosphate (PPi) is used as energy in the glycolysis pathway to facilitate PFP to catalyze the phosphorylation of fructose-6-phosphate (F6P) to form fructose-1,6-bisphosphate (FBP); however, under special conditions, PFP catalyzes the dephosphorylation of FBP to form F6P, providing a substrate for the formation of hexose. In addition, according to the allosteric type of the protein, PFP proteins can be divided into two types, namely allosteric enzyme type and non-allosteric enzyme type. Allosteric enzyme configurations are usually distributed in higher plants and exist in the form of heterotetramers (a2β2); non-allosteric enzyme configurations mainly exist in prokaryotes. In plant cells, PFP is composed of an α subunit with regulatory functions and a β subunit with catalytic activity. It has been reported that in plants such as castor and rice, these subunits (α and β) are encoded by different genes and have tissue-specific expression characteristics.

[0006] In recent years, there have been many reports on the PFP metabolic pathway. In the study of sugarcane, it was demonstrated that PFP plays an important regulatory role in the distribution of photosynthetic products, which is manifested by the negative correlation between PFP enzyme activity and the accumulation of sucrose in sugarcane stems. Overexpression of PFP genes in berries affects the content and ratio of sugar and organic acids in berry fruits. At the same time, during the development of rice endosperm, OsPFP mutations have important effects on grain filling and sugar distribution. These results indicate that PFP is involved in a variety of physiological processes, but the exact function and specific physiological significance of PFP are still unclear. Moreover, for seed plants, little is known about the effect of PFP on starch synthesis during seed filling. In the early stage, we screened and identified a mutant material fn20 that regulates the appearance of rice grains by EMS mutagenesis. And using map-based cloning technology, we cloned the regulatory gene FN20 that regulates the powdery endosperm. Through sequence analysis and gene knockout experiments, it was proved that FN20 is a new allelic variant gene encoding the pyrophosphate: D-fructose-1,6-bisphosphotransferase β subunit gene (OsPFPB). In addition, there are few reports on strategies for improving the appearance quality of rice grains. Therefore, it is urgent to explore new technologies and methods for improving the appearance quality of rice grains by using molecular-assisted selection breeding, which is particularly important and has important theoretical significance and production practice value. Summary of the invention

[0007] The object of the present invention is to provide a method for rice appearance quality gene identification and molecular marker-assisted breeding to solve the problems raised in the above background technology.

[0008] To achieve the above object, the present invention provides the following technical solution: a method for rice appearance quality gene identification and molecular marker-assisted breeding, the method comprising the following steps:

[0009] S1. Construction of knockout material of rice grain appearance regulatory gene FN20. The gene sequences of rice grain appearance regulatory mutant gene fn20 are SEQ NO.3 and SEQ NO.4.

[0010] S2, the mutant fn20 is mated with a rice line FN20 with normal rice grain appearance. If the genotype band of the F1 offspring is an individual of FN20, the plant is a pseudo-hybrid, and the pseudo-hybrid is removed to improve the efficiency of breeding, reduce the economic loss of seed production, and achieve the purpose of targeted improvement of rice grain appearance quality;

[0011] S3. Construct materials containing the rice grain appearance quality regulatory gene FN20.

[0012] Optionally, the physical location of the FN20 material in S3 is located in the interval 7654386-7648922 of rice chromosome 6.

[0013] Optionally, the molecular marker f07-10 located adjacent to the FN20 is characterized in that the forward primer sequence is 5'AAATGGTCACACACACACAC 3' (SEQ NO. 1), and the reverse primer sequence is 5'TATCAGAGGTGGCAGCTTAT 3' (SEQ NO. 2).

[0014] Optionally, the molecular marker PFP-5 located at the FN20 genetic regulatory site FN20 is characterized by: the forward primer sequence is 5'CAAGCAGTGTCAAACCCAA 3' (SEQ NO.3), and the reverse primer sequence is 5'TAGGGACAAGATTGAAACACC 3' (SEQ NO.4). The sequence product of the marker contains a HinfI restriction site.

[0015] Optionally, the rice grain appearance quality regulating gene FN20 is used in the process of hybrid F1 generation seed production purity identification, and the gene sequence characteristics are as described in the above SEQ NO.1 and SEQ NO.2.

[0016] Optionally, the rice grain appearance quality regulating gene FN20 is used in the seed production purity identification process of the F1 generation of rice hybrids.

[0017] Optionally, the rice grain appearance quality regulatory gene fn20 is used in molecular breeding for improving rice grain appearance quality traits.

[0018] Compared with the prior art, the present invention provides a method for rice appearance quality gene identification and molecular marker-assisted breeding, which has the following beneficial effects:

[0019] The method for identifying rice appearance quality genes and molecular marker-assisted breeding utilizes the map-based cloning technology to clone the rice grain appearance quality regulating gene FN20 (OsPFPB) from the rice grain appearance quality regulating mutant fn20; utilizes the gene editing system to knock out the FN20 (OsPFPB) gene in rice to obtain a homozygous strain with altered rice grain appearance quality; the FN20 (OsPFPB) gene can be applied to the field of rice breeding, and has important practical significance for removing false hybrids in the early stage of hybrid seed production, seed purity identification, and molecular-assisted selection breeding for directed improvement of rice grain appearance quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Schematic diagram of the analysis of the phenotype and filling characteristics of the mutant fn20 of the present invention; (A) is the phenotype of WT and fn20; (B) is the appearance phenotype of WT and fn20 brown rice; (C) is the cross section of WT and fn20 brown rice;

[0021] Figure 2 Statistical analysis diagrams of plant height, tiller number and ear length (n=20), thousand-grain weight (n=1000), grain length, grain width and grain thickness (n=30) of WT and fn20 of the present invention (AD; FI); (E, J) dynamic and developmental characteristics of seed filling of WT and fn20;

[0022] Figure 3 is the genetic location map of FN20 of the present invention;

[0023] Figure 4 Schematic diagram of phenotypic analysis of gene knockout mutants of FN20 of the present invention (A, B);

[0024] Figure 5 Schematic diagram of linkage analysis of the fn20 mutation site of the present invention; P1, Ningjing 20 (WT); P2, fn20 (mutant); P3, Nipponbare; P4, ZH11; P5, 9311; P6, Fengbazhan; P7, Huanghuazhan; 1-11 are homozygous exchange plants after improvement of F2 grain appearance; M, 2.0 kb marker. DETAILED DESCRIPTION

[0025] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0026] like Figure 1-Figure 5 As shown, the present invention provides a technical solution: a method for rice appearance quality gene identification and molecular marker-assisted breeding, the method comprising the following steps:

[0027] S1. Construction of knockout material of rice grain appearance regulatory gene FN20. The gene sequences of rice grain appearance regulatory mutant gene fn20 are SEQ NO.3 and SEQ NO.4.

[0028] S2, the mutant fn20 is mated with the rice line FN20 with normal rice grain appearance. If the genotype band of the F1 offspring is an individual of FN20, the plant is a false hybrid. The false hybrid is removed to improve the efficiency of breeding, reduce the economic loss of seed production, and achieve the purpose of targeted improvement of rice grain appearance quality;

[0029] S3, constructing a material containing the rice grain appearance quality regulating gene FN20. The physical location of the FN20 material is located in the interval of 7654386-7648922bp on chromosome 6 of rice.

[0030] The molecular marker f07-10 located next to FN20 is characterized by: a forward primer sequence of 5'AAATGGTCACACACACACAC 3' (SEQ NO. 1), and a reverse primer sequence of 5'TATCAGAGGTGGCAGCTTAT 3' (SEQ NO. 2).

[0031] The molecular marker PFP-5 located at the FN20 genetic regulatory site FN20 is characterized by: the forward primer sequence is 5'CAAGCAGTGTCAAACCCAA 3' (SEQ NO.3), and the reverse primer sequence is 5'TAGGGACAAGATTGAAACACC 3' (SEQ NO.4). The sequence product of the marker contains a Hinf I restriction site.

[0032] The invention discloses an application of a method for identifying rice appearance quality genes and molecular marker-assisted breeding, an application of a rice grain appearance quality regulating gene FN20 in the process of identifying the purity of hybrid F1 generation seed production, and a gene sequence feature such as SEQ NO.1 and SEQ NO.2; an application of a rice grain appearance quality regulating gene FN20 in the process of identifying the purity of hybrid F1 generation seed production. An application of a rice grain appearance quality regulating gene fn20 in molecular breeding for improving rice grain appearance quality traits.

[0033] As an application of this embodiment:

[0034] During the experiment, the japonica rice variety 'Ningjing 20' was used as the experimental material. The NILs population and improved variety strains were provided by the Key Laboratory of Plant Functional Genomics, College of Agriculture, Yangzhou University. The materials of each generation were selected through molecular marker-assisted selection, and the phenotype homozygous materials were selected, and the whole genome resequencing method was used to confirm and analyze the differences in the mutant gene sequences.

[0035] Isolation and genetic analysis of mutants. The local popular japonica rice cultivar 'Ningjing 20' was treated with mutagen EMS, and the mutant fn20 material with altered rice grain appearance was screened out from the offspring of the mutant population. After multiple generations of self-pollination and backcrossing, a mutant strain with relatively stable genetic traits was obtained.

[0036] Under conventional field management conditions, the main agronomic traits of 'Ningjing 20' (wild type) and fn20 (mutant) were investigated and analyzed. During the growth period of rice, the wild type and mutant had similar plant shapes; however, compared with the wild type, there was a significant difference in the appearance of the grains, which were opaque; cross-sectional observation of brown rice revealed that the fn20 endosperm had a large cavity in the middle and a distinct powdery texture ( Figure 1 C); Starch granules are loosely arranged and easy to fall off ( Figure 1 AC, Figure 2 AD). The thousand-grain weight of mature seeds of mutant fn20 was significantly lower than that of wild type ( Figure 2 F); In addition, although there were no differences in grain length and width, there were significant differences in grain thickness in the fn20 mutant ( Figure 2 GI). Moreover, the grain filling rate of fn20 was significantly higher than that of wild type ( Figure 2 E, J). Therefore, the grain filling process of fn20 mutants was restricted during endosperm filling, which may be the main reason for the affected thousand-grain weight and filling rate of the plants, and ultimately led to changes in the grain appearance phenotype.

[0037] The rice plant 'Ningjing 20' with normal grain appearance was used as the female parent and the mutant fn20 as the male parent for genetic matching; the mutant fn20 with abnormal grain appearance was used as the male parent for hybridization with indica rice varieties such as Huanghuazhan and Fengbazhan to obtain hybrid and backcross progenies. The results showed that the progeny (F2) obtained after self-pollination of F1 showed stable trait segregation; the segregation ratio was approximately wild type: mutant = 3:1. This shows that the powdery rice grain phenotype is controlled by a single recessive gene, and the segregation law in the progeny population conforms to the segregation characteristics of Mendel's single gene.

[0038] Fine positioning of the rice grain appearance regulatory gene FN20, 196 pairs of SSR markers and 105 pairs of In / Del markers that are approximately evenly distributed on 12 rice chromosomes were selected, and the linkage markers of the candidate genes were determined using the block segregation method (BSA). The linkage analysis results showed that the gene regulating rice appearance quality is located on chromosome 6 of rice, and RM274 is closely linked to the candidate gene, which was named FN20. Then, 1759 extremely recessive individual plants were selected and finely positioned between the molecular markers f07-10 and LD6-267 ( Figure 2 A). The physical distance between them is about 101.4 kb, and it contains 13 ORFs ( Figure 2 B).

[0039] Prediction of candidate genes regulating rice grain appearance and sequence comparison analysis. The mutant and its wild type were sequenced and the sequence comparison analysis results showed that in the candidate genes of the positioning interval in Example 2, there was a sequence variation characteristic that the 200th base G mutated to A on the 5th exon of LOC_Os06g13810. Through amino acid sequence comparison analysis, this single nucleotide mutation resulted in the substitution characteristic of aspartic acid (D200) to asparagine (N200) ( Figure 3 A, B).

[0040] Construction of FN20 gene knockout materials

[0041] Step 1 Construction of FN20 gene knockout vector

[0042] Based on the genome sequence of the FN20 gene, the target sequence with high gene editing efficiency was predicted using the online tool gene editing website (http: / / skl.scau.edu.cn). Through analysis and comparison, the target sequence 5'GTAGACCGACGCGAGCCTGG 3' was selected, and complementary primers with restriction endonuclease AarI (Thermo Fisher Scientific) cleavage sites were synthesized based on this target sequence:

[0043] Upstream primer: 5′ggcaGTAGACCGACGCGAGCCTGG 3′;

[0044] Downstream primer: 5′aaacCCAGGCTCGCGTCGGTCTAC 3′;

[0045] The vector SK-gRNA was cut with restriction endonuclease AarI (Thermo Fisher Scientific) to linearize the vector. The above fusion fragment was then connected to the linearized SK-gRNA vector. The correct plasmid was obtained after enzyme digestion identification and further sequencing was performed to determine that the target sequence had been correctly introduced into the vector (the vector was named SKg-RNA-fn20). The intermediate vector SK-gRNA-fn20 with the target target sequence was transformed into Escherichia coli DH5α for culture. Positive colonies with target site sequences were selected by PCR and gel electrophoresis, and plasmids were extracted. The intermediate vector SK-gRNA-fn20 was digested with restriction endonucleases Kpn I and Bgl II, and the fragment size of 500 bp was purified and recovered. The purified and recovered fragment was connected to the final expression vector pC1300-Cas9 (the connected vector was named pC1300-Cas9-fn20) that had been digested with restriction endonucleases Kpn I and BamHI. After sequencing verification, plasmid pC1300-Cas9-fn20 was extracted and transformed into Agrobacterium tumefaciens EHA105 (Shanghai Shenggong Biological Co., Ltd.). Referring to the scheme of Hiei et al., the final knockout vector with the target fragment was transformed into the callus of the japonica rice variety Nipponbare by infecting plant tissue using Agrobacterium tumefaciens-mediated technology (Hiei Y, Ohta S, Komari T, et al. Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA [J]. The Plant Journal, 1994, 6 (2): 271-282.).

[0046] Step 2 Molecular and phenotypic identification of transgenic rice

[0047] Tender leaves of T0 transgenic rice seedlings were selected and genomic DNA was extracted by CTAB method. The endogenous CR-fn20 (Ospfpb) gene of transgenic rice was amplified using CR-fn20 specific primers (upstream primer: 5'CCTCCATAGCCTTGGGTAAAC 3'; downstream primer: 5'ACCCACCCACCCCGACTGAGC 3'), and the PCR product was verified by sequencing.

[0048] The results showed that two different types of base insertion transformants had occurred in the OsPFPB gene, namely, homozygous transgenic lines with FN20 (OsPFPB) gene functional deletion were obtained and named pfpb-CR1 and pfpb-CR2 ( Figure 4 A, B). The seeds were sown in Yangzhou on May 15 and harvested in early to mid-October. The results of the identification of the transgenic lines showed that the appearance of the seeds of the pfpb-CR1 and pfpb-CR2 lines changed, and their relative opacity was significantly higher than that of the wild type ( Figure 4 B).

[0049] In summary, fn20 affects the distribution of photosynthetic products during the rice filling period, which hinders the distribution of photosynthetic products in the grains, thereby changing the appearance quality of the grains. Using molecular assisted selection breeding technology and hybrid screening of early generations can maximize the genetic breeding efficiency in the process of improving the appearance quality of rice grains, reduce the workload, and shorten the breeding period ( Figure 5 ). Such regulatory effects and early screening strategies for target traits indicate that it provides a new idea and approach for improving rice appearance quality. In addition, since the fn20 gene has the characteristics of increasing rice soluble sugar and reducing amylose content (AAC), this also suggests that the fn20 gene has important utilization value in breeding rice varieties that meet the requirements of new sugar production.

[0050] The above generally describes the present invention in detail, but it is obvious to a person skilled in the art that some modifications or improvements can be made to the present invention. Therefore, modifications or improvements that do not depart from the spirit of the present invention are within the scope of protection of the present invention.

Claims

1. A method for rice appearance quality gene identification and molecular marker-assisted breeding, characterized in that: The method comprises the following steps: S1. Construction of knockout material of rice grain appearance regulatory gene FN20; S2, the mutant fn20 is mated with a rice line FN20 with normal rice grain appearance. If the genotype band of the F1 offspring is an individual of FN20, the plant is a pseudo-hybrid, and the pseudo-hybrid is removed to improve the efficiency of breeding and reduce the economic loss of seed production; S3. Construct materials containing the rice grain appearance quality regulatory gene FN20.

2. The method for rice appearance quality gene identification and molecular marker-assisted breeding according to claim 1, characterized in that: The physical location of the FN20 material in the S3 is located in the interval of 7654386-7648922bp on chromosome 6 of rice.

3. The method for rice appearance quality gene identification and molecular marker-assisted breeding according to claim 2, characterized in that: The molecular marker f07-10 located next to the FN20 is characterized in that the forward primer sequence is 5'AAATGGTCACACACACACAC 3' (SEQ NO. 1), and the reverse primer sequence is 5'TATCAGAGGTGGCAGCTTAT 3' (SEQ NO. 2).

4. The method for rice appearance quality gene identification and molecular marker-assisted breeding according to claim 3, characterized in that: The molecular marker PFP-5 located at the FN20 genetic regulation site FN20 is characterized by: the forward primer sequence is 5'CAAGCAGTGTCAAACCCAA 3' (SEQ NO.3), and the reverse primer sequence is 5'TAGGGACAAGATTGAAACACC 3' (SEQ NO.4). The sequence product of the marker contains a HinfI restriction site.

5. An application of the method for rice appearance quality gene identification and molecular marker-assisted breeding according to any one of claims 1 to 4, characterized in that: The application of the rice grain appearance quality regulating gene FN20 in the hybrid F1 generation seed production purity identification process, the gene sequence characteristics are as shown in the above SEQ NO.1 and SEQ NO.

2.

6. The use of a method for identifying rice appearance quality genes and molecular marker-assisted breeding according to claim 5, characterized in that: The rice grain appearance quality regulating gene FN20 is used in the seed production purity identification process of the F1 generation of rice hybrids.

7. The use of a method for rice appearance quality gene identification and molecular marker-assisted breeding according to claim 5, characterized in that: The application of the rice grain appearance quality regulatory gene FN20 in molecular breeding for improving rice grain appearance quality traits.

Images