Clustered regularly interspaced short palindromic repeats (CRISPR / LbCas12a) system-based geminivirus infection inhibition vector as well as construction method and application thereof

Abstract

The invention discloses a carrier for inhibiting geminivirus infection based on a CRISPR / LbCas12a system as well as a construction method and application of the carrier. A geminivirus is TYLCCNV and a satellite virus TYLCCNB accompanied by the TYLCCNV; comprising at least one of a pCambia1300: LbCas12-fgY10A vector and a pCambia1300: T5exo-LbCas12-fgY10A vector, a pCambia1300: LbCas12-fgY10b vector and a pCambia1300: T5exo-LbCas12-fgY10b vector, and a pCambia1300: T5exo-LbCas12-fgY10b vector, wherein the pCambia1300: LbCas12-fgY10A vector and the pCambia1300: T5exo-LbCas12-fgY10b vector are constructed according to the replication key sites of the TYLCCNV, the The crRNA is designed aiming at the replication key site of the geminivirus, and has better disease-resistant activity compared with the CRISPR / Cas9 system which is commonly used at present.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular to a vector, construction method and application of a vector for inhibiting geminivirus infection based on a CRISPR LbCas12a system. Background Art

[0002] Geminiviruses are a class of single-stranded circular DNA viruses that are widely distributed worldwide. They can infect economic and food crops including tobacco, tomatoes, cotton, corn, wheat, soybeans, cassava, etc., seriously affecting the yield and quality of crops, and causing huge economic losses worldwide. When plants are infected with Geminiviruses, especially Solanaceae plants infected with TYLCCNV / TYLCCNB, they will show serious symptoms including plant dwarfing, leaf shrinkage, yellowing, and stem bending, resulting in huge yield losses. At present, Geminiviruses are mainly prevented in the field, and the occurrence of viral diseases is reduced by strengthening management and controlling the transmission pathways. However, in the past few decades, the economic losses caused by Geminiviruses have reached tens of billions of dollars, so the development of highly effective antiviral varieties is crucial to prevent the occurrence of diseases.

[0003] LbCas12a is a class II type V CRISPR nuclease, a type of nuclease mediated by a single crRNA. Unlike the Cas9 protein, LbCas12a can specifically recognize and cut thymine (T)-rich PAM sites, and by producing sticky ends, it causes the deletion of larger fragments of the genomic sequence near the target, indicating that the virus is difficult to recombine after the cut and cannot achieve effective infection.

[0004] At present, the prevention and control measures for Geminiviruses in actual field production are very limited, and there are the following limitations and problems:

[0005] (1) Currently, the prevention and control of geminiviruses mainly focuses on the use of chemical pesticides to control geminivirus-transmitting insects. The large-scale use of chemical pesticides not only increases the resistance of the virus-transmitting vector, Bemisia tabaci, but also causes great harm to non-target organisms and the field ecological environment, resulting in pesticide residues;

[0006] (2) In the field, prevention and control measures are taken, such as timely removal of diseased plants and application of fertilizers to improve growth. These field measures waste a lot of labor and time;

[0007] (3) The current use of traditional hybridization technology to select crop varieties resistant to geminiviruses is slow and can easily cause changes in the agronomic traits of offspring plants, reducing crop quality and yield;

[0008] (4) The anti-geminivirus of the currently widely used CRISPR / Cas9 system can only knock out a small fragment of the target viral sequence, which poses a risk of viral sequence mutation escaping editing and recombining into new viruses, posing a greater biosafety hazard.

[0009] The Geminivirus genome contains many key replication sites, and these motifs are essential for the replication of Geminiviruses. Therefore, the present invention uses LbCas12a to perform targeted editing, and by knocking out the Geminivirus genome sequence on a larger scale, the Geminivirus replication process is destroyed, thereby achieving enhanced anti-Geminivirus effects. Summary of the invention

[0010] The purpose of the present invention is to provide a vector and construction method and application for inhibiting Gemini virus infection based on the CRISPR LbCas12a system. The present invention designs a specific crRNA for the key replication motif of TYLCCNV / TYLCCNB, and constructs an Agrobacterium-infectious cloning vector using LbCas12a to resist Gemini virus.

[0011] Specifically, the technical solution adopted by the present invention is as follows:

[0012] A vector for inhibiting geminivirus infection based on the CRISPR / LbCas12a system, wherein the geminivirus is TYLCCNV / TYLCCNB; the vector is pCambia1300:LbCas12-fgY10A, pCambia1300:LbCas12-fgY10b, pCambia1300:T5exo-LbCas12-fgY10A, pCambia1300:T5exo-LbCas12-fgY10b and pCambia1300:T5exo-LbCas12-Y10*4.

[0013] The construction method includes the following steps:

[0014] (1) Selecting a PAM site in the TYLCCNV sequence and designing crRNA; including two crRNA chains required for the pCambia1300:LbCas12-fgY10A vector target: fgY10A-F1 / R1; the sequence of which is shown in SEQ ID NO: 1-2;

[0015] fgY10A-F1:AGATTATGTGGACACCAAATGGCATAA

[0016] fgY10A-R1:GGCCTTATGCCATTTGGTGTCCACATA

[0017] (2) Selecting a PAM site in the TYLCCNB sequence and designing crRNA; including two crRNA chains required for one target site of the pCambia1300:LbCas12-fgY10b vector: fgY10b-F1 / R1; the sequence of which is shown in SEQ ID NO: 3-4;

[0018] fgY10b-F1:AGATATCTCAGAGGTAAATAATTGGGA

[0019] fgY10b-R1:GGCCTCCCAATTATTTACCTCTGAGAT

[0020] (3) synthesizing the single-stranded crRNA described in steps (1) and (2) into a double-stranded crRNA, the specific method is as follows:

[0021] ① Dilute the above single-stranded gRNA to 10μM / μL;

[0022] ② According to 10×reaction buffer A: 1.5μL; T4 Polynucleotide Kinase: 1.5μL; 10mMATP: 1μL; T4 Polynucleotide Kinase: 1μL; Primer F: 4μL; Primer R: 4μL; ddH2O: 3.5μL, make a 15μL system;

[0023] ③ Boil in boiling water bath for 5 min, cool naturally to room temperature, and store at -20℃;

[0024] (4) Construction of pCambia1300:LbCas12-fgY10A vector:

[0025] ① 1 μg pCambia1300 plasmid, 1 μL BamHI and 1 μL BcuI, 5 μL 10×FastDigest GreenBuffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 30min, then purify the DNA and store at -20℃;

[0026] ② The LbCas12a nucleotide sequence was amplified with primer pair 1300-LbCas12a-F1 / R1 to obtain a specific PCR band; after agarose gel electrophoresis, the specific PCR target band was recovered and purified by gel cutting; the sequences of LbCas12a and 1300-LbCas12a-F1 / R1 are shown in SEQ ID NOs: 6, 8-9;

[0027] ③ 3 μL of the backbone of the pCambia1300 plasmid digested with BamH I and Bcu I, 1 μL of the fragment amplified from 1300-LbCas12a-F1 / R1, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50°C for 30 min;

[0028] ④ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector;

[0029] Identification primer 35S-F / LbCas12a-R1, wherein the sequences of 35S-F and LbCas12a-R1 are shown in SEQ ID NOs: 10-11;

[0030] The correct clone was expanded and cultured, and the plasmid was extracted and sequenced using the Nos-R1 primer. The sequence is shown in SEQ ID NO: 12;

[0031] So far, the pCambia1300-ccdb-LbCas12 vector is obtained.

[0032] ⑤1μg pENTR4 plasmid, 1μL SmaI and 1μL EcoR I, 5μL 10×FastDigest Green Buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 30min, then purify the DNA and store at -20℃;

[0033] ⑥ Amplify the nucleotide sequence of 35S-HH-crRNA-BsaⅠ-HDV with primer pair 35s-HDV-F1 / R1 to obtain a specific PCR band; perform agarose gel electrophoresis and recover and purify the specific PCR target band by cutting the gel; the sequences of 35S-HH-crRNA-BsaⅠ-HDV and 35s-HDV-F1 / R1 are shown in SEQ ID NOs: 13-15:

[0034] 35s-HDV-F1: AAAAAGCAGGCTCCACCATGGatggccccgggcctgcagg

[0035] 35s-HDV-R1:CTCGAGTGGCGGCCGCGAATTCccgatctagtaacatagatgacaccg

[0036] ⑦ 3 μL of pENTR plasmid backbone digested with Sma I and EcoR I, 1 μL of 35s-HDV-F1 / R1 amplified fragment, 5 μL of 2×MultiF Seamless Assembly Mix; react at 50℃ for 30 min;

[0037] ⑧ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector;

[0038] Identification primer 35S-F / Y16-R1, wherein the sequence of Y16-R1 is shown in SEQ ID NO: 16;

[0039] The correct clones were expanded, plasmids were extracted, and sequenced using Nos-R1 primers;

[0040] Thus, the pENTR-Y16 vector was obtained.

[0041] ⑨1μg pENTR-Y16 plasmid, ApaⅠ1μL, 10×FastDigest Green Buffer 5μL; the remaining system was supplemented with ddH2O; enzyme digestion was performed at 37℃ for 30min, then the DNA was purified and cloned into pCambia1300-ccdb-LbCas12 through Gateway's LR reaction to obtain the pCambia1300:LbCas12 vector.

[0042] ⑩1μg pCambia1300:LbCas12 plasmid, 1μL Bsa I-HF, 5μL 10×cutsmart buffer; the remaining system was supplemented with ddH2O; enzyme digestion at 37℃ for 60min, then DNA was purified and stored at -20℃;

[0043] 10×T4 DNA ligase buffer 2μL, pCambia1300:LbCas12 vector 80ng after enzyme digestion, double-stranded gRNA 1μL, T4 DNA ligase 1μL, ddH2O fixed to 20μL; PCR instrument controlled at 22℃ for 15min;

[0044] 10 μL of the ligation product was transformed into E. coli DH5α, and kanamycin was used for resistance screening. Single clones were selected for colony PCR identification and sequencing to confirm whether the target site was connected to the vector;

[0045] Primers fgY10A-F1 / Y16-R1 were identified, the correct clones were expanded, plasmids were extracted, and sequenced with Y16-R1 primers to obtain pCambia1300:LbCas12-fgY10A vector;

[0046] (5) Construction of pCambia1300:LbCas12-fgY10b vector:

[0047] ① 1μg pCambia1300:LbCas12 plasmid, 1μL Bsa I-HF, 5μL 10×cutsmart buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 60min, then purify the DNA and store at -20℃;

[0048] ②10×T4 DNAligase buffer 2μL, pCambia1300:LbCas12 vector 80ng after enzyme digestion, double-stranded gRNA 1μL, T4 DNAligase 1μL, ddH2O fixed volume to 20μL; PCR instrument temperature controlled at 22℃ for 15min;

[0049] ③ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the target site is connected to the vector;

[0050] Identify the primer fgY10b-b1 / Y16-R1; expand the correct clone, extract the plasmid, and sequence it with the Y16-R1 primer to obtain the pCambia1300:LbCas12-fgY10b vector;

[0051] (6) Construction of pCambia1300:T5exo-LbCas12 vector:

[0052] ① 1 μg pCambia1300:LbCas12 plasmid, 1 μL BamH I and 1 μL Bcu I, 5 μL 10×FastDigestGreen Buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 30min, then purify the DNA and store it in a freezer at -20℃;

[0053] ② The primer pairs 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2 were used to amplify the T5 nuclease and LbCas12a nucleotide sequences, respectively, to obtain two specific PCR bands, respectively; after agarose gel electrophoresis, the specific PCR target bands were recovered and purified by gel cutting; the sequences of 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2 are shown in SEQ ID NOs: 17-20:

[0054] 1300-T5-F1:

[0055] AAATTTTCACCATTTACGAACGATAGGATCCCGCCACCATGGCCGACTATAAGGACCACGACGGAGA;

[0056] 1300-T5-R1:

[0057] TATAACCGACCTTTCTTTTTTCTTTGGGGCCATATCACTTCCGCCAGAAGAACCT;

[0058] 1300-T5-F2:

[0059] AGGTTCTTCTGGCGGAAGTGATATGGCCCCAAAGAAAAAAAGAAAGGTCGGTATA;

[0060] 1300-T5-R2:

[0061] GATCGGGGAAATTCGAGCTCactagtCTTCTTTTTTTTTGCCTGGCCTGC;

[0062] ③ 3 μL of the backbone of pCambia1300:LbCas12 plasmid was digested with BamH I and Bcu I, 1 μL of each of the amplified fragments of 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2, and 5 μL of 2×MultiF Seamless Assembly Mix; reacted at 50°C for 30 min; T5 nuclease (T5exo) was fused to the 5' end of LbCas12a, and the sequence of T5exo is shown in SEQ ID NO: 7;

[0063] ④ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as resistance screening, select single clones for colony PCR identification and sequencing to confirm whether the target site is connected to the vector;

[0064] Primer 35S-F / 1300-T5-R1 was used for identification, and the correct clone was expanded, the plasmid was extracted, and sequenced using the Nos-R1 primer;

[0065] So far, the vector containing pCambia1300:T5exo-LbCas12 is obtained.

[0066] (7) Construction of pCambia1300:T5exo-LbCas12-fgY10A vector:

[0067] ① 1μg pCambia1300:LbCas12 plasmid, 1μL Bsa I-HF, 5μL 10×cutsmart buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 60min, then purify the DNA and store at -20℃;

[0068] ②10×T4 DNA ligase buffer 2μL, pCambia1300:LbCas12 vector 80ng after enzyme digestion, double-stranded gRNA 1μL, T4 DNA ligase 1μL, ddH2O fixed volume to 20μL; PCR instrument controlled temperature 22℃ reaction for 15min;

[0069] ③ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the target site is connected to the vector;

[0070] Identify the primers fgY10A-F1 / Y16-R1; expand the correct clone, extract the plasmid, and sequence it with the Y16-R1 primer to obtain the pCambia1300:T5exo-LbCas12-fgY10A vector;

[0071] (8) Construction of pCambia1300:T5exo-LbCas12-fgY10b:

[0072] ① 1μg pCambia1300:LbCas12 plasmid, 1μL Bsa I-HF, 5μL 10×cutsmart buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 60min, then purify the DNA and store at -20℃;

[0073] ②10×T4 DNA ligase buffer 2μL, pCambia1300:LbCas12 vector 80ng after enzyme digestion, double-stranded gRNA 1μL, T4 DNA ligase 1μL, ddH2O fixed to 20μL; PCR instrument controlled at 22℃ for 15min;

[0074] ③ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the target site is connected to the vector;

[0075] Identify the primers fgY10b-F1 / Y16-R1; expand the correct clone, extract the plasmid, and sequence it with the Y16-R1 primer to obtain the pCambia1300:T5exo-LbCas12-fgY10b vector;

[0076] (9) Construction of pCambia1300:T5exo-LbCas12-Y10*4:

[0077] ① Select a PAM site near the TYLCCNV replication key site and design two crRNAs; and select a PAM site near the TYLCCNB replication key site and design two crRNAs, and separate the four crRNA sequences using hammerhead ribozyme HH and hepatitis delta virus ribozyme HDV for series connection, and artificially synthesize the sequence, named Y10*4, whose sequence is shown in SEQ ID NO: 5;

[0078] After artificial synthesis of the Y10*4 gene fragment, it was cloned into pUC57 and named pUC57:Y10*4;

[0079] ②1μg pUC57:Y10*4 plasmid, 1μL Bsa I-HF and 1μL Bcu I, 5μL 10×cutsmart buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 60min, then purify the DNA and store at -20℃;

[0080] ③1μg pCambia1300:T5exo-LbCas12 plasmid, 1μL Bsa I-HF and 1μL Bcu I, 5μL 10×cutsmart buffer; the remaining system was supplemented with ddH2O; enzyme digestion at 37℃ for 60min, then DNA was purified and stored at -20℃;

[0081] ④10×T4 DNA ligase buffer 2μL, pCambia1300:T5exo-LbCas12 vector 80ng after enzyme digestion, pUC57:Y10*4 fragment 80ng after enzyme digestion, T4 DNA ligase 1μL, ddH2O fixed volume to 20μL; PCR instrument temperature controlled at 22℃ for 15min;

[0082] ⑤ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing;

[0083] The identification primer is Y10*4-F1 / Y16-R1; wherein the sequence of Y10*4-F1 is shown in SEQ ID NO: 21;

[0084] Y10*4-F1: AGAGACACCAATTGACCAGTCAA;

[0085] The correct clones were expanded and cultured, plasmids were extracted, and sequenced with Y16-R1 primers to obtain the pCambia1300:T5exo-LbCas12-Y10*4 vector;

[0086] (10) Final vector Agrobacterium transformation: 50 μL of Agrobacterium EHA105 strain and 5 μL of plasmid were used for chemical transformation; incubated at 28°C for 5-6 h; Kan+Rif resistance plates were plated and single clones were selected for colony PCR identification; the strains were stored at -80°C.

[0087] The present invention is based on the CRISPR / LbCas12a system, which can target the TYLCCNV / TYLCCNB replication key motif infection vector and has a significant and efficient antiviral function. The antiviral principle based on the system directly cuts the viral sequence to inhibit viral replication, while increasing the size of the deleted fragment, further increasing the anti-gemini virus effect, thereby preventing the potential risk of virus escape editing, and is more safely applied in production.

[0088] The vector with T5exo element added in the present invention can enhance the efficiency of editing the Geminivirus genome sequence and expand the application of deletion fragments. The present invention can enhance the disease resistance effect on TYLCCNV / TYLCCNB by using a multi-target editing strategy.

[0089] Compared with the prior art, the outstanding effects of the present invention are:

[0090] (1) The present invention constructs recombinant vectors pCambia1300:LbCas12-fgY10A, pCambia1300:LbCas12-fgY10b, pCambia1300:T5exo-LbCas12-fgY10A, pCambia1300:T5exo-LbCas12-fgY10b and pCambia1300:T5exo-LbCas12-Y10*4. The vector utilizes the editing characteristics of Cas12 protein, high editing efficiency, and the advantages of large deletion fragments, and targets TYLCCNV / TYLCCNB replication key sites, thereby further reducing and eliminating the risk of virus escape editing due to Gemini virus sequence mutations.

[0091] (2) The vector further increases the editing efficiency and deletion fragment size by adding the T5exo element, thereby further enhancing the anti-geminivirus effect.

[0092] (3) This vector further enhances its anti-disease effect against Geminivirus by editing multiple targets of Geminivirus.

[0093] (4) The vector targets the virus itself rather than the host plant, so it can effectively resist virus infection without affecting agronomic traits, making it more suitable for actual field production.

[0094] (5) This system has a wide range of applications and can be used on all TYLCCNV / TYLCCNB host plants.

[0095] The following is a further description of the CRISPR / LbCas12a system-based vector for inhibiting Gemini virus infection, its construction method and application in combination with the accompanying drawings and specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0096] Figure 1 In the figure, (a) is a schematic diagram of the infection vector for editing the geminivirus TYLCCNV / TYLCCNB based on the CRISPR / LbCas12a system; (b) is a schematic diagram of the infection vector for editing the geminivirus TYLCCNV / TYLCCNB based on the CRISPR / T5exo-LbCas12a system; (c) is a schematic diagram of the infection vector for simultaneously editing the geminivirus TYLCCNV / TYLCCNB at four targets based on the CRISPR / T5exo-LbCas12a system.

[0097] Figure 2(a) shows the total DNA extracted 3 days after BKG-g4 (Cas9-TYLCCNV) Agrobacterium was mixed with TYLCCNV / TYLCCNB virus, PCR was performed near the PAM site of the TYLCCNV virus sequence, and the editing sequence after first-generation sequencing was connected to the T vector; (b) shows the total DNA extracted 3 days after BKG-g1 (Cas9-TYLCCNB) Agrobacterium was mixed with TYLCCNV / TYLCCNB virus, PCR was performed near the PAM site of the TYLCCNB virus sequence, and the editing sequence after first-generation sequencing was connected to the T vector. Sequence diagram; (c) is the edited sequence diagram after DNA was extracted after CRISPR / LbCas12a-Y10A Agrobacterium was mixed and inoculated with TYLCCNV / TYLCCNB viruses, PCR was performed near the PAM site of the TYLCCNV virus sequence, and the sequence was connected to the T vector, and the sequence was sequenced; (d) is the edited sequence diagram after DNA was extracted after CRISPR / LbCas12a-Y10b Agrobacterium was mixed and inoculated with TYLCCNV / TYLCCNB viruses, PCR was performed near the PAM site of the TYLCCNB virus sequence, and the sequence was connected to the T vector, and the sequence was sequenced;

[0098] Figure 3 (a) Symptoms of the mixed TYLCCNV / TYLCCNB infiltration of Nicotiana benthamiana plants with Agrobacterium tumefaciens containing BKG-g4 (Cas9-TYLCCNV), BKG-g1 (Cas9-TYLCCNB), pCambia1300:LbCas12-fgY10A (Cas12-TYLCCNV), and pCambia1300:LbCas12-fgY10b (Cas12-TYLCCNB) as MOCKs. (b) The accumulation level of TYLCCNV was detected by qPCR using the CP protein encoded by TYLCCNV as a reference. The accumulation level of TYLCCNB was detected by qPCR using the βC1 protein encoded by TYLCCNB as a reference.

[0099] Figure 4(a) Symptoms of empty Agrobacterium as MOCK, Agrobacterium containing pCambia1300:LbCas12-fgY10A (Cas12-TYLCCNV), pCambia1300:T5exo-LbCas12-fgY10A (Cas12 / T5exo-TYLCCNV), and mixed TYLCCNV / TYLCCNB infectious cloned Agrobacterium infiltrated into Nicotiana benthamiana plants 7 days after infiltration (7 dpi); (b) qPCR detection of the accumulation level of TYLCCNV in (a) using the CP protein encoded by TYLCCNV as a reference ; (c) Symptoms of Nicotiana benthamiana plants infiltrated with empty Agrobacterium as MOCK, pCambia1300:LbCas12-fgY10b (Cas12-TYLCCNB), pCambia1300:T5exo-LbCas12-fgY10b (Cas12 / T5exo-TYLCCNB) infectious cloned Agrobacterium mixed with TYLCCNV / TYLCCNB infectious cloned Agrobacterium 7 days after infiltration (7dpi); (d) Using the βC1 protein encoded by TYLCCNB as a reference, qPCR was used to detect the accumulation level of TYLCCNB in ​​Figure (a).

[0100] Figure 5 In (a), empty Agrobacterium was used as MOCK, containing pCambia1300:T5exo-LbCas12-fgY10A(Cas12 / T5exo-TYLCCNV), pCambia1300:T5exo-LbCas12-Y10*4(Cas12 / T5exo-TYLCCNV *4 ) Symptoms of Nicotiana benthamiana plants 7 days after infiltration (7 dpi) with the infectious cloned Agrobacterium mixed with TYLCCNV / TYLCCNB; (b) Using the CP protein encoded by TYLCCNV as a reference, qPCR was used to detect the accumulation level of TYLCCNV in (a). DETAILED DESCRIPTION

[0101] A method for constructing a vector for inhibiting infection of geminiviruses based on the CRISPR / LbCas12a system, wherein the geminivirus is TYLCCNV / TYLCCNB; Figure 1 As shown, the vectors are pCambia1300:LbCas12-fgY10A, pCambia1300:LbCas12-fgY10b, pCambia1300:T5exo-LbCas12-fgY10A, pCambia1300:T5exo-LbCas12-fgY10b and pCambia1300:T5exo-LbCas12-Y10*4;

[0102] The specific steps include:

[0103] (1) Selecting a PAM site in the TYLCCNV sequence and designing crRNA; including two crRNA chains required for the pCambia1300:LbCas12-fgY10A vector target: fgY10A-F1 / R1; the sequence of which is shown in SEQ ID NO: 1-2;

[0104] fgY10A-F1:AGATTATGTGGACACCAAATGGCATAA

[0105] fgY10A-R1:GGCCTTATGCCATTTGGTGTCCACATA

[0106] (2) Selecting a PAM site in the TYLCCNB sequence and designing crRNA; including two crRNA chains required for one target site of the pCambia1300:LbCas12-fgY10b vector: fgY10b-F1 / R1; the sequence of which is shown in SEQ ID NO: 3-4;

[0107] fgY10b-F1:AGATATCTCAGAGGTAAATAATTGGGA

[0108] fgY10b-R1:GGCCTCCCAATTATTTACCTCTGAGAT

[0109] (3) synthesizing the single-stranded crRNA described in steps (1) and (2) into a double-stranded crRNA, the specific method is as follows:

[0110] ① Dilute the above single-stranded gRNA to 10μM / μL;

[0111] ② Make a 15μL system according to 10×reaction buffer A: 1.5μL; T4 Polynucleotide Kinase: 1.5μL; 10mMATP: 1μL; T4 Polynucleotide Kinase: 1μL; Primer F: 4μL; Primer R: 4μL; ddH2O: 3.5μL;

[0112] ③ Boil in boiling water bath for 5 min, cool naturally to room temperature, and store at -20℃;

[0113] (4) Construction of pCambia1300:LbCas12-fgY10A vector:

[0114] ① 1 μg pCambia1300 plasmid, 1 μL BamHI and 1 μL BcuI, 5 μL 10×FastDigest GreenBuffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 30min, then purify the DNA and store at -20℃;

[0115] ② The LbCas12a nucleotide sequence was amplified with primer pair 1300-LbCas12a-F1 / R1 to obtain a specific PCR band; after agarose gel electrophoresis, the specific PCR target band was recovered and purified by gel cutting; the sequences of LbCas12a and 1300-LbCas12a-F1 / R1 are shown in SEQ ID NOs: 6, 8-9;

[0116] ③ 3 μL of the backbone of the pCambia1300 plasmid digested with BamH I and Bcu I, 1 μL of the fragment amplified from 1300-LbCas12a-F1 / R1, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50°C for 30 min;

[0117] ④ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector;

[0118] Identification primer 35S-F / LbCas12a-R1, wherein the sequences of 35S-F and LbCas12a-R1 are shown in SEQ ID NOs: 10-11;

[0119] The correct clone was expanded and cultured, and the plasmid was extracted and sequenced using the Nos-R1 primer. The sequence is shown in SEQ ID NO: 12;

[0120] So far, the pCambia1300-ccdb-LbCas12 vector is obtained.

[0121] ⑤1μg pENTR4 plasmid, 1μL SmaI and 1μL EcoR I, 5μL 10×FastDigest Green Buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 30min, then purify the DNA and store at -20℃;

[0122] ⑥ Amplify the nucleotide sequence of 35S-HH-crRNA-BsaⅠ-HDV with primer pair 35s-HDV-F1 / R1 to obtain a specific PCR band; perform agarose gel electrophoresis and recover and purify the specific PCR target band; the sequences of 35S-HH-crRNA-BsaⅠ-HDV and 35s-HDV-F1 / R1 are shown in SEQ ID NOs: 13-15;

[0123] 35s-HDV-F1: AAAAAGCAGGCTCCACCATGGatggccccgggcctgcagg

[0124] 35s-HDV-R1:CTCGAGTGGCGGCCGCGAATTCccgatctagtaacatagatgacaccg

[0125] ⑦ 3 μL of pENTR plasmid backbone digested with Sma I and EcoR I, 1 μL of 35s-HDV-F1 / R1 amplified fragment, 5 μL of 2×MultiF Seamless Assembly Mix; react at 50℃ for 30 min;

[0126] ⑧ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector;

[0127] Identification primer 35S-F / Y16-R1, wherein the sequence of Y16-R1 is shown in SEQ ID NO: 16;

[0128] The correct clones were expanded, plasmids were extracted, and sequenced using Nos-R1 primers;

[0129] Thus, the pENTR-Y16 vector was obtained.

[0130] ⑨1μg pENTR-Y16 plasmid, ApaⅠ1μL, 10×FastDigest Green Buffer 5μL; the remaining system was supplemented with ddH2O; enzyme digestion was performed at 37℃ for 30min, then the DNA was purified and cloned into pCambia1300-ccdb-LbCas12 through Gateway's LR reaction to obtain the pCambia1300:LbCas12 vector.

[0131] ⑩1μg pCambia1300:LbCas12 plasmid, 1μL Bsa I-HF, 5μL 10×cutsmart buffer; the remaining system was supplemented with ddH2O; enzyme digestion at 37℃ for 60min, then DNA was purified and stored at -20℃;

[0132] 10×T4 DNAligase buffer 2μL, pCambia1300:LbCas12 vector 80ng after enzyme digestion, double-stranded gRNA 1μL, T4 DNAligase 1μL, ddH2O fixed volume to 20μL; PCR instrument controlled temperature 22℃ reaction for 15min;

[0133] 10 μL of the ligation product was transformed into E. coli DH5α, and kanamycin was used for resistance screening. Single clones were selected for colony PCR identification and sequencing to confirm whether the target site was connected to the vector;

[0134] Identification primer fgY10A-F1 / Y16-R1, wherein the sequence of Y16-R1 is shown in SEQ ID NO: 16;

[0135] Y16-R1:ACTTTGTACAAGAAAGCTGGGT;

[0136] The correct clone was expanded and cultured, the plasmid was extracted, and sequenced with the Y16-R1 primer to obtain the pCambia1300:LbCas12-fgY10A vector;

[0137] (5) Construction of pCambia1300:LbCas12-fgY10b vector:

[0138] ① 1μg pCambia1300:LbCas12 plasmid, 1μL Bsa I-HF, 5μL 10×cutsmart buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 60min, then purify the DNA and store at -20℃;

[0139] ②10×T4 DNA ligase buffer 2μL, pCambia1300:LbCas12 vector 80ng after enzyme digestion, double-stranded gRNA 1μL, T4 DNA ligase 1μL, ddH2O fixed to 20μL; PCR instrument controlled at 22℃ for 15min;

[0140] ③ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the target site is connected to the vector;

[0141] Identify the primer fgY10b-b1 / Y16-R1; expand the correct clone, extract the plasmid, and sequence it with the Y16-R1 primer to obtain the pCambia1300:LbCas12-fgY10b vector;

[0142] (6) Construction of pCambia1300:T5exo-LbCas12 vector:

[0143] ① 1 μg pCambia1300:LbCas12 plasmid, 1 μL BamH I and 1 μL Bcu I, 5 μL 10×FastDigestGreen Buffer; the remaining system was supplemented with ddH2O; enzyme digestion was performed at 37°C for 30 min, and then the DNA was purified and stored in a freezer at -20°C;

[0144] ② Use primer pairs 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2 to amplify T5 nuclease and LbCas12a nucleotide sequences, respectively, and obtain two specific PCR bands. After agarose gel electrophoresis, the specific PCR target bands were recovered and purified by gel cutting. The sequences of 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2 are shown in SEQ ID NOs: 17-20:

[0145] 1300-T5-F1:

[0146] AAATTTTCACCATTTACGAACGATAGGATCCCGCCACCATGGCCGACTATAAGGACCACGA CGGAGA;

[0147] 1300-T5-R1:

[0148] TATAACCGACCTTTCTTTTTTCTTTGGGGCCATATCACTTCCGCCAGAAGAACCT;

[0149] 1300-T5-F2:

[0150] AGGTTCTTCTGGCGGAAGTGATATGGCCCCAAAGAAAAAAAGAAAGGTCGGTATA;

[0151] 1300-T5-R2:

[0152] GATCGGGGAAATTCGAGCTCactagtCTTCTTTTTTTTTGCCTGGCCTGC;

[0153] ③ 3 μL of the backbone of pCambia1300:LbCas12 plasmid was digested with BamH I and Bcu I, 1 μL of each of the amplified fragments of 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2, and 5 μL of 2×MultiF Seamless Assembly Mix; reacted at 50°C for 30 min; T5 nuclease (T5exo) was fused to the 5' end of LbCas12a, and the sequence of T5exo is shown in SEQ ID NO: 7;

[0154] ④ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector;

[0155] Primer 35S-F / 1300-T5-R1 was used for identification, and the correct clone was expanded, the plasmid was extracted, and sequenced using the Nos-R1 primer;

[0156] So far, the vector containing pCambia1300:T5exo-LbCas12 is obtained.

[0157] (7) Construction of pCambia1300:T5exo-LbCas12-fgY10A vector:

[0158] ① 1μg pCambia1300:T5exo-LbCas12 plasmid, 1μL Bsa I-HF, 5μL 10×cutsmart buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 60min, then purify the DNA and store at -20℃;

[0159] ②10×T4 DNA ligase buffer 2μL, pCambia1300:T5exo-LbCas12 vector 80ng after enzyme digestion, double-stranded gRNA 1μL, T4 DNA ligase 1μL, ddH2O fixed volume to 20μL; PCR instrument temperature controlled at 22℃ for 15min;

[0160] ③ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the target site is connected to the vector;

[0161] Identify the primers fgY10A-F1 / Y16-R1; expand the correct clone, extract the plasmid, and sequence it with the Y16-R1 primer to obtain the pCambia1300:T5exo-LbCas12-fgY10A vector;

[0162] (8) Construction of pCambia1300:T5exo-LbCas12-fgY10b:

[0163] ① 1μg pCambia1300:T5exo-LbCas12 plasmid, 1μL Bsa I-HF, 5μL 10×cutsmart buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 60min, then purify the DNA and store at -20℃;

[0164] ②10×T4 DNA ligase buffer 2μL, pCambia1300:T5exo-LbCas12 vector 80ng after enzyme digestion, double-stranded gRNA 1μL, T4 DNA ligase 1μL, ddH2O fixed volume to 20μL; PCR instrument temperature controlled at 22℃ for 15min;

[0165] ③ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the target site is connected to the vector;

[0166] Identify the primers fgY10b-F1 / Y16-R1; expand the correct clone, extract the plasmid, and sequence it with the Y16-R1 primer to obtain the pCambia1300:T5exo-LbCas12-fgY10b vector;

[0167] (9) Construction of pCambia1300:T5exo-LbCas12-Y10*4:

[0168] ① Select a PAM site near the TYLCCNV replication key site and design two crRNAs; and select a PAM site near the TYLCCNB replication key site and design two crRNAs, and separate the four crRNA sequences using hammerhead ribozyme HH and hepatitis delta virus ribozyme HDV for series connection, artificially synthesize the sequence, and name it Y10*4, whose sequence is shown in SEQ ID NO: 5; After artificially synthesizing the Y10*4 gene fragment, clone it into pUC57 and name it pUC57:Y10*4;

[0169] ②1μg pUC57:Y10*4 plasmid, 1μL Bsa I-HF and 1μL Bcu I, 5μL 10×cutsmart buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 60min, then purify the DNA and store at -20℃;

[0170] ③1μg pCambia1300:T5exo-LbCas12 plasmid, 1μL Bsa I-HF and 1μL Bcu I, 5μL 10×cutsmart buffer; the remaining system was supplemented with ddH2O; enzyme digestion at 37℃ for 60min, then DNA was purified and stored at -20℃;

[0171] ④10×T4 DNA ligase buffer 2μL, pCambia1300:T5exo-LbCas12 vector 80ng after enzyme digestion, pUC57:Y10*4 fragment 80ng after enzyme digestion, T4 DNA ligase 1μL, ddH2O fixed volume to 20μL; PCR instrument temperature controlled at 22℃ for 15min;

[0172] ⑤ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing;

[0173] The identification primer is Y10*4-F1 / Y16-R1; wherein the sequence of Y10*4-F1 is shown in SEQ ID NO: 21;

[0174] Y10*4-F1: AGAGACACCAATTGACCAGTCAA;

[0175] The correct clones were expanded and cultured, plasmids were extracted, and sequenced with Y16-R1 primers to obtain the pCambia1300:T5exo-LbCas12-Y10*4 vector;

[0176] (10) Final vector Agrobacterium transformation: 50 μL of Agrobacterium EHA105 strain and 5 μL of plasmid were used for chemical transformation; incubated at 28°C for 5-6 h; Kan+Rif resistance plates were plated and single clones were selected for colony PCR identification; the strains were stored at -80°C.

[0177] (11) Activate Agrobacterium, mix TYLCCNV / TYLCCNB infectious clones with Agrobacterium containing BKG-g4 (Cas9-TYLCCNV), pCambia1300:LbCas12-fgY10A, BKG-g1 (Cas9-TYLCCNB), and pCambia1300:LbCas12-fgY10b2 vectors, and inoculate wild-type Nicotiana benthamiana. Mix TYLCCNV / TYLCCNB infectious clones with empty vector Agrobacterium as a control (Mock). Take the inoculated leaves 3 days after inoculation to extract total DNA, perform PCR near the PAM site of the TYLCCNV / TYLCCNB viral sequence, connect to the T vector, and detect the editing effect after first-generation sequencing. Figure 2 shown.

[0178] (12) The antiviral effects of BKG-g4 (Cas9-TYLCCNV), pCambia1300:LbCas12-fgY10A, BKG-g1 (Cas9-TYLCCNB), and pCambia1300:LbCas12-fgY10b2 vectors were tested respectively. Total DNA from systemic leaves of Nicotiana benthamiana plants 7 days after mixed inoculation was extracted, and the accumulation level of TYLCCNV was detected by qPCR using the CP protein encoded by TYLCCNV as a reference. The accumulation level of TYLCCNB was detected by qPCR using the βC1 protein encoded by TYLCCNB as a reference. Figure 3 shown.

[0179] (13) Detection of the antiviral effect of pCambia1300:T5exo-LbCas12-fgY10A and pCambia1300:T5exo-LbCas12-fgY10b vectors: pCambia1300:LbCas12-fgY10A, pCambia1300:LbCas12-fgY10b, pCambia1300:T5exo-LbCas12-fgY10A, and pCambia1300:T5exo-LbCas12-fgY10b were extracted and mixed and inoculated 7 days later.

[0180] The total DNA of leaves of T5exo-LbCas12-fgY10b Nicotiana benthamiana plants was used to detect the accumulation level of TYLCCNV by qPCR, with the CP protein encoded by TYLCCNV as a reference. The accumulation level of TYLCCNB was detected by qPCR, with the βC1 protein encoded by TYLCCNB as a reference. Figure 4 shown.

[0181] (14) Detection of the antiviral effect of pCambia1300:T5exo-LbCas12-fgY10A and pCambia1300:T5exo-LbCas12-Y10A*4 vectors: Total DNA from systemic leaves of Nicotiana benthamiana plants 7 days after mixed inoculation was extracted, and the accumulation level of TYLCCNV was detected by qPCR using the CP protein encoded by TYLCCNV as a reference. Figure 5 shown.

[0182] The above results all show that the antiviral effect of the viral gene editing vector based on CRISPR / LbCas12a is better than that of the viral gene editing vector based on CRISPR / Cas9, and the deletion fragment of the viral gene sequence is larger, which can reduce the risk of Gemini virus escaping gene editing. In addition, the viral gene editing vector based on CRISPR / LbCas12a can further enhance the resistance to Gemini virus after adding the T5exo element, and effectively inhibit the infection and viral accumulation of TYLCCN / TYLCCNB. In addition, the multi-gene editing vector designed for the TYLCCN / TYLCCNB genome has a better anti-gemini virus effect than single gene editing, indicating that the viral gene editing vector based on CRISPR / LbCas12a has better application prospects than the viral gene editing vector based on CRISPR / Cas9.

[0183] The embodiments described above are merely descriptions of preferred implementation modes of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A vector for inhibiting Gemini virus infection based on the CRISPR / LbCas12a system, characterized in that: The Geminivirus is TYLCCNV / TYLCCNB; Including at least one of the pCambia1300:LbCas12-fgY10A and pCambia1300:T5exo-LbCas12-fgY10A vectors constructed for the key replication site of TYLCCNV, the pCambia1300:LbCas12-fgY10b and pCambia1300:T5exo-LbCas12-fgY10b vectors constructed for the key replication site of TYLCCNB, and the pCambia1300:T5exo-LbCas12-Y10*4 vector constructed for the key replication site of TYLCCNV / TYLCCNB.

2. The method for constructing a vector for inhibiting geminivirus infection based on the CRISPR / LbCas12a system according to claim 1, characterized in that: A PAM site was selected near the key replication site of TYLCCNV and two crRNAs were designed to construct the two crRNA chains required for the pCambia1300:LbCas12-fgY10A vector containing the target: fgY10A-F1 / R1, whose sequence is shown in SEQ ID NO: 1-2; A PAM site was selected near the TYLCCNB replication key site and crRNA was designed to construct two crRNA chains required for the pCambia1300:LbCas12-fgY10b vector containing the target: fgY10b-F1 / R1, whose sequence is shown in SEQ ID NO: 3-4; The single-stranded crRNA is synthesized into a double strand.

3. The method for constructing a vector for inhibiting Gemini virus infection based on the CRISPR / LbCas12a system according to claim 1, characterized in that: The editing vector pCambia1300:T5exo-LbCas12-Y10*4, which fuses T5 nuclease at the 5' end of LbCas12a and simultaneously edits four viral target sites at the key replication sites of TYLCCNV and TYLCCNB; Among them, a PAM site was selected near the TYLCCNV replication key site and two crRNAs were designed, and a PAM site was selected near the TYLCCNB replication key site and two crRNAs were designed, and the four crRNA sequences were separated by hammerhead ribozyme HH and hepatitis delta virus ribozyme HDV for series connection, and the sequence was artificially synthesized and named Y10*4, and its sequence is shown in SEQ ID NO: 5; T5 nuclease is fused to the 5' end of LbCas12a, wherein the sequences of LbCas12a and T5 nuclease are shown in SEQ ID NOs: 6-7.

4. The method for constructing a vector for inhibiting Gemini virus infection based on the CRISPR / LbCas12a system according to any one of claims 1 to 3, characterized in that Including the construction of pCambia1300:LbCas12-fgY10A vector: ① 1 μg pCambia1300 plasmid, 1 μL BamHI and 1 μL BcuI, 5 μL 10×FastDigest Green Buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 30min, then purify the DNA and store at -20℃; ② The LbCas12a nucleotide sequence was amplified with primer pair 1300-LbCas12a-F1 / R1 to obtain a specific PCR band; after agarose gel electrophoresis, the specific PCR target band was recovered and purified by gel cutting; the sequence of 1300-LbCas12a-F1 / R1 is shown in SEQ ID NO: 8-9: ③ 3 μL of the backbone of the pCambia1300 plasmid digested with BamH I and Bcu I, 1 μL of the fragment amplified from 1300-LbCas12a-F1 / R1, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50°C for 30 min; ④ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector; Identification primer 35S-F / LbCas12a-R1, wherein the sequences of 35S-F and LbCas12a-R1 are shown in SEQ ID NOs: 10-11; The correct clone was expanded and cultured, and the plasmid was extracted and sequenced using the Nos-R1 primer. The sequence is shown in SEQ ID NO: 12; So far, the pCambia1300-ccdb-LbCas12 vector is obtained; ⑤1μg pENTR4 plasmid, 1μL SmaI and 1μL EcoR I, 5μL 10×FastDigest Green Buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 30min, then purify the DNA and store at -20℃; ⑥ Amplify the nucleotide sequence of 35S-HH-crRNA-BsaⅠ-HDV with primer pair 35s-HDV-F1 / R1 to obtain a specific PCR band; perform agarose gel electrophoresis and recover and purify the specific PCR target band by cutting the gel; the sequences of 35S-HH-crRNA-BsaⅠ-HDV and 35s-HDV-F1 / R1 are shown in SEQ ID NOs: 13-15: ⑦ 3 μL of the backbone of the pENTR plasmid digested with Sma I and EcoR I, 1 μL of the fragment amplified by 35s-HDV-F1 / R1, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50°C for 30 min; ⑧ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector; Identification primer 35S-F / Y16-R1, wherein the sequence of Y16-R1 is shown in SEQ ID NO: 16; The correct clones were expanded, plasmids were extracted, and sequenced using Nos-R1 primers; Thus, the pENTR-Y16 vector was obtained; ⑨1 μg pENTR-Y16 plasmid, 1 μL ApaⅠ, 5 μL 10× FastDigest Green Buffer; the remaining system was supplemented with ddH2O; restriction enzyme digestion was performed at 37°C for 30 min, and then the DNA was purified and cloned into pCambia1300-ccdb-LbCas12 through Gateway LR reaction to obtain pCambia1300:LbCas12 vector; ⑩1μg pCambia1300:LbCas12 plasmid, 1μL Bsa I-HF, 5μL 10×cutsmart buffer; the remaining system was supplemented with ddH2O; enzyme digestion at 37℃ for 60min, then DNA was purified and stored at -20℃; 10×T4 DNAligase buffer 2μL, pCambia1300:LbCas12 vector 80ng after enzyme digestion, double-stranded gRNA 1μL, T4 DNAligase 1μL, ddH2O fixed volume to 20μL; PCR instrument controlled temperature 22℃ reaction for 15min; 10 μL of the ligation product was transformed into E. coli DH5α, and kanamycin was used for resistance screening. Single clones were selected for colony PCR identification and sequencing to confirm whether the target site was connected to the vector; Primers fgY10A-F1 / Y16-R1 were identified, the correct clone was expanded, the plasmid was extracted, and sequenced with Y16-R1 primer to obtain the pCambia1300:LbCas12-fgY10A vector.

5. The method for constructing a vector for inhibiting Gemini virus infection based on the CRISPR / LbCas12a system according to any one of claims 1 to 3, characterized in that Including the construction of pCambia1300:LbCas12-fgY10b vector: ① 1 μg pCambia1300 plasmid, 1 μL BamHI and 1 μL BcuI, 5 μL 10×FastDigest Green Buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 30min, then purify the DNA and store at -20℃; ② The LbCas12a nucleotide sequence was amplified with primer pair 1300-LbCas12a-F1 / R1 to obtain a specific PCR band; after agarose gel electrophoresis, the specific PCR target band was recovered and purified by gel cutting; the sequence of 1300-LbCas12a-F1 / R1 is shown in SEQ ID NO: 8-9: ③ 3 μL of the backbone of the pCambia1300 plasmid digested with BamH I and Bcu I, 1 μL of the fragment amplified from 1300-LbCas12a-F1 / R1, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50°C for 30 min; ④ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector; Identification primer 35S-F / LbCas12a-R1, wherein the sequences of 35S-F and LbCas12a-R1 are shown in SEQ ID NOs: 10-11; The correct clone was expanded and cultured, and the plasmid was extracted and sequenced using the Nos-R1 primer. The sequence is shown in SEQ ID NO: 12; So far, the pCambia1300-ccdb-LbCas12 vector is obtained; ⑤1μg pENTR4 plasmid, 1μL SmaI and 1μL EcoR I, 5μL 10×FastDigest Green Buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 30min, then purify the DNA and store at -20℃; ⑥ Amplify the nucleotide sequence of 35S-HH-crRNA-BsaⅠ-HDV with primer pair 35s-HDV-F1 / R1 to obtain a specific PCR band; perform agarose gel electrophoresis and recover and purify the specific PCR target band by cutting the gel; the sequences of 35S-HH-crRNA-BsaⅠ-HDV and 35s-HDV-F1 / R1 are shown in SEQ ID NOs: 13-15: ⑦ 3 μL of pENTR plasmid backbone digested with Sma I and EcoR I, 1 μL of 35s-HDV-F1 / R1 amplified fragment, 5 μL of 2×MultiF Seamless Assembly Mix; react at 50℃ for 30 min; ⑧ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector; Identification primer 35S-F / Y16-R1, wherein the sequence of Y16-R1 is shown in SEQ ID NO: 16; The correct clones were expanded, plasmids were extracted, and sequenced using Nos-R1 primers; Thus, the pENTR-Y16 vector was obtained; ⑨1 μg pENTR-Y16 plasmid, 1 μL ApaⅠ, 5 μL 10× FastDigest Green Buffer; the remaining system was supplemented with ddH2O; restriction enzyme digestion was performed at 37°C for 30 min, and then the DNA was purified and cloned into pCambia1300-ccdb-LbCas12 through Gateway LR reaction to obtain pCambia1300:LbCas12 vector; ⑩1μg pCambia1300:LbCas12 plasmid, 1μL Bsa I-HF, 5μL 10×cutsmart buffer; the remaining system was supplemented with ddH2O; enzyme digestion at 37℃ for 60min, then DNA was purified and stored at -20℃; 10×T4 DNAligase buffer 2μL, pCambia1300:LbCas12 vector 80ng after enzyme digestion, double-stranded gRNA 1μL, T4 DNAligase 1μL, ddH2O fixed volume to 20μL; PCR instrument controlled temperature 22℃ reaction for 15min; 10 μL of the ligation product was transformed into E. coli DH5α, and kanamycin was used for resistance screening. Single clones were selected for colony PCR identification and sequencing to confirm whether the target site was connected to the vector; The primers fgY10b-F1 / Y16-R1 were identified; the correct clones were expanded, the plasmids were extracted, and sequenced with the Y16-R1 primer to obtain the pCambia1300:LbCas12-fgY10b vector.

6. The method for constructing a vector for inhibiting Gemini virus infection based on the CRISPR / LbCas12a system according to any one of claims 1 to 3, characterized in that Including the construction of pCambia1300:T5exo-LbCas12 vector: ① 1 μg pCambia1300 plasmid, 1 μL BamHI and 1 μL BcuI, 5 μL 10×FastDigest Green Buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 30min, then purify the DNA and store at -20℃; ② The LbCas12a nucleotide sequence was amplified with primer pair 1300-LbCas12a-F1 / R1 to obtain a specific PCR band; after agarose gel electrophoresis, the specific PCR target band was recovered and purified by gel cutting; the sequence of 1300-LbCas12a-F1 / R1 is shown in SEQ ID NO: 8-9: ③ 3 μL of the backbone of the pCambia1300 plasmid digested with BamH I and Bcu I, 1 μL of the fragment amplified from 1300-LbCas12a-F1 / R1, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50°C for 30 min; ④ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector; Identification primer 35S-F / LbCas12a-R1, wherein the sequences of 35S-F and LbCas12a-R1 are shown in SEQ ID NOs: 10-11; The correct clone was expanded and cultured, and the plasmid was extracted and sequenced using the Nos-R1 primer. The sequence is shown in SEQ ID NO: 12; So far, the pCambia1300-ccdb-LbCas12 vector is obtained; ⑤1μg pENTR4 plasmid, 1μL SmaI and 1μL EcoR I, 5μL 10×FastDigest Green Buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 30min, then purify the DNA and store at -20℃; ⑥ Amplify the nucleotide sequence of 35S-HH-crRNA-BsaⅠ-HDV with primer pair 35s-HDV-F1 / R1 to obtain a specific PCR band; perform agarose gel electrophoresis and recover and purify the specific PCR target band by cutting the gel; the sequences of 35S-HH-crRNA-BsaⅠ-HDV and 35s-HDV-F1 / R1 are shown in SEQ ID NOs: 13-15: ⑦ 3 μL of the backbone of the pENTR plasmid digested with Sma I and EcoR I, 1 μL of the fragment amplified by 35s-HDV-F1 / R1, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50°C for 30 min; ⑧ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector; Identification primer 35S-F / Y16-R1, wherein the sequence of Y16-R1 is shown in SEQ ID NO: 16; The correct clones were expanded, plasmids were extracted, and sequenced using Nos-R1 primers; Thus, the pENTR-Y16 vector was obtained; ⑨1 μg pENTR-Y16 plasmid, 1 μL ApaⅠ, 5 μL 10× FastDigest Green Buffer; the remaining system was supplemented with ddH2O; restriction enzyme digestion was performed at 37°C for 30 min, and then the DNA was purified and cloned into pCambia1300-ccdb-LbCas12 through Gateway LR reaction to obtain pCambia1300:LbCas12 vector; ⑩1 μg pCambia1300:LbCas12 plasmid, 1 μL BamHI and 1 μL BcuI, 5 μL 10×FastDigest GreenBuffer; the remaining system was supplemented with ddH2O; digestion was performed at 37℃ for 30 min, and then the DNA was purified and stored in a freezer at -20℃; The primer pairs 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2 were used to amplify the T5 nuclease and LbCas12a nucleotide sequences, respectively, to obtain two specific PCR bands, respectively; after agarose gel electrophoresis, the specific PCR target bands were recovered and purified by gel cutting; the sequences of 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2 are shown in SEQ ID NOs: 17-20: 3 μL of the backbone of pCambia1300:LbCas12 plasmid digested with BamH I and Bcu I, 1 μL of each of the amplified fragments of 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50°C for 30 min; 10 μL of the ligation product was transformed into E. coli DH5α, and kanamycin was used for resistance screening. Single clones were selected for colony PCR identification and sequencing to confirm whether the fragment was connected to the vector; Identify primer 35S-F / 1300-T5-R1; expand the correct clone, extract the plasmid, and sequence it with Nos-R1 primer; So far, the vector containing pCambia1300:T5exo-LbCas12 is obtained.

7. The method for constructing a vector for inhibiting Gemini virus infection based on the CRISPR / LbCas12a system according to claim 6, characterized in that Including the construction of pCambia1300:T5exo-LbCas12-fgY10A vector: ① 1μg pCambia1300:T5exo-LbCas12 plasmid, 1μL Bsa I-HF, 5μL 10×cutsmart buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 60min, then purify the DNA and store at -20℃; ②10×T4 DNA ligase buffer 2μL, pCambia1300:T5exo-LbCas12 vector 80ng after enzyme digestion, double-stranded gRNA 1μL, T4 DNA ligase 1μL, ddH2O fixed volume to 20μL; PCR instrument temperature controlled at 22℃ for 15min; ③ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the target site is connected to the vector; The primers fgY10A-F1 / Y16-R1 were identified; the correct clones were expanded and cultured, the plasmids were extracted, and sequenced with the Y16-R1 primer to obtain the pCambia1300:T5exo-LbCas12-fgY10A vector.

8. The method for constructing a vector for inhibiting Gemini virus infection based on the CRISPR / LbCas12a system according to claim 6, characterized in that Including the construction of pCambia1300:T5exo-LbCas12-fgY10b vector: ① 1μg pCambia1300:T5exo-LbCas12 plasmid, 1μL Bsa I-HF, 5μL 10×cutsmart buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 60min, then purify the DNA and store at -20℃; ②10×T4 DNA ligase buffer 2μL, pCambia1300:T5exo-LbCas12 vector 80ng after enzyme digestion, double-stranded gRNA 1μL, T4 DNA ligase 1μL, ddH2O fixed volume to 20μL; PCR instrument temperature controlled at 22℃ for 15min; ③ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the target site is connected to the vector; The primers fgY10b-F1 / Y16-R1 were identified; the correct clones were expanded and cultured, the plasmids were extracted, and sequenced with the Y16-R1 primer to obtain the pCambia1300:T5exo-LbCas12-fgY10b vector.

9. The method for constructing a vector for inhibiting Gemini virus infection based on the CRISPR / LbCas12a system according to claim 6, characterized in that Including the construction of pCambia1300:T5exo-LbCas12-Y10*4 vector: ① Artificially synthesize the Y10*4 gene fragment and clone it into pUC57, named pUC57:Y10*4; ②1μg pUC57:Y10*4 plasmid, 1μL Bsa I-HF and 1μL Bcu I, 5μL 10×cutsmart buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 60min, then purify the DNA and store at -20℃; ③1μg pCambia1300:T5exo-LbCas12 plasmid, 1μL Bsa I-HF and 1μL Bcu I, 5μL 10×cutsmartbuffer; the remaining system was supplemented with ddH2O; enzyme digestion at 37℃ for 60min, then DNA was purified and stored at -20℃; ④10×T4 DNA ligase buffer 2μL, pCambia1300:T5exo-LbCas12 vector 80ng after enzyme digestion, pUC57:Y10*4 fragment 80ng after enzyme digestion, T4 DNA ligase 1μL, ddH2O fixed volume to 20μL; PCR instrument temperature controlled at 22℃ for 15min; ⑤ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing; The identification primers are Y10*4-F1 / Y16-R1, wherein the sequence of Y10*4-F1 is shown in SEQ ID NO: 21; Y10*4-F1: AGAGACACCAATTGACCAGTCAA; The correct clone was expanded and cultured, the plasmid was extracted, and sequenced with the Y16-R1 primer to obtain the pCambia1300:T5exo-LbCas12-Y10*4 vector.

10. The use of the CRISPR / LbCas12a system-based Geminivirus infection inhibition vector according to claim 1 in the prevention and control of TYLCCNV / TYLCCNB.

Images