Near-infrared light driven DNA nano system and application thereof in detection of miRNA-103

Abstract

The invention discloses a near-infrared light driven DNA (deoxyribonucleic acid) nano system and application of the near-infrared light driven DNA nano system in detection of miRNA-103 (micro Ribonucleic Acid), and relates to the technical field of design of probes for in-situ imaging of miRNA in cells. The near-infrared light driven DNA nano system is composed of nano hairpin probes LT-H1 and H2, the nucleotide sequence of the LT-H1 is as shown in SEQ ID NO.1, a fluorophore Cy3 is modified at the 43rd site from the 5'end of the nucleotide sequence, and a photolysis connecting bond is arranged between the 48th site and the 49th site; the nucleotide sequence of H2 is shown as SEQ ID NO.2, and the 5'end of the nucleotide sequence is modified with a fluorophore Cy5. The near-infrared light driven DNA nano system has very high sensitivity and specificity to the miRNA-103, and can be used for monitoring the miRNA-103 in a non-cell environment and in-situ visual imaging of the ovarian granular cell miRNA-103; and ovarian granular cells of normal people, obesity type and non-obesity type polycystic ovarian syndrome patients with different miRNA-103 expression levels can be accurately distinguished.

Description

Technical Field

[0001] The invention relates to the technical field of probe design for in-situ imaging of intracellular miRNA, and in particular to a near-infrared light-driven DNA nanosystem and an application thereof in detecting miRNA-103. Background Art

[0002] Polycystic ovary syndrome (PCOS) is a clinically highly heterogeneous disease caused by complex endocrine and metabolic abnormalities in women of childbearing age. PCOS patients often present with complex phenotypes, including menstrual irregularities, insulin resistance, abnormal follicular development, elevated androgen levels, and even infertility. PCOS is also associated with obesity, arterial hypertension, and dyslipidemia, which increase the lifelong risk of type 2 diabetes and cardiovascular disease in PCOS patients. As a potential biomarker for PCOS, miRNA-103 regulates the occurrence and development of PCOS by participating in various metabolic and hormonal processes. Therefore, intuitive characterization of the spatial distribution and expression level of miRNA-103 in cells, especially in ovarian granulosa cells, will help to elucidate the biomolecular function of miRNA-103 in PCOS and provide effective diagnostic and therapeutic options for PCOS patients.

[0003] Dynamic self-assembled DNA nanostructures have the advantages of high programmability, structural responsiveness and good biocompatibility; they have broad application prospects in the development of high spatiotemporal resolution, intelligent response miRNA molecule nanohairpin probes for living cell imaging. At present, a variety of strategies have been developed for live cell miRNA amplification imaging. Among them, the catalytic hairpin assembly strategy of enzyme-free isothermal nucleic acid amplification is particularly suitable for clinical sample miRNA analysis due to its simplicity, robustness and recycling. However, conventional catalytic hairpin assembly nanohairpin probes usually bind to non-target molecules before reaching the location in the target cell, resulting in a decrease in the imaging signal-to-noise ratio and a decrease in spatiotemporal resolution. This problem hinders the use of conventional catalytic hairpin assembly nanohairpin probes for high-sensitivity detection and specific analysis of low-abundance miRNAs in ovarian granulosa cells of PCOS. Therefore, it is urgent to develop a highly sensitive and visualized detection method for imaging miRNA-103 in ovarian granulosa cells of PCOS patients. Summary of the invention

[0004] The present invention provides a near-infrared light-driven DNA nanosystem and its application in detecting miRNA-103. The near-infrared light-driven DNA nanosystem has the advantages of high spatiotemporal controllability, high sensitivity, high specificity, etc. for the detection of miRNA-103, and can realize the amplification imaging of low-abundance miRNA-103. It is specifically achieved through the following technologies.

[0005] In a first aspect of the present invention, a method for constructing a near-infrared light-driven DNA nanosystem is provided, wherein the near-infrared light-driven DNA nanosystem is used to detect miRNA-103, comprising the following steps:

[0006] Nanohairpin probes LT-H1 and H2 were designed; the nucleotide sequence of LT-H1 was as shown in SEQ ID NO.1, and the fluorescent group Cy3 was modified at the 43rd position from the 5' end of the nucleotide sequence, and a photocleavable linker was provided between the 48th position and the 49th position; the nucleotide sequence of H2 was as shown in SEQ ID NO.2, and the fluorescent group Cy5 was modified at the 5' end of the nucleotide sequence.

[0007] Optionally, the photocleavable linker comprises a PC-linker.

[0008] Furthermore, the method further comprises the steps of: preparing oil phase upconversion nanoparticles, treating the oil phase upconversion nanoparticles with hydrochloric acid at room temperature by stirring, and washing to obtain water phase upconversion nanoparticles; mixing the water phase upconversion nanoparticles with polylysine in water, stirring at room temperature, and washing to obtain polylysine-coated upconversion nanoparticles;

[0009] The poly-lysine-coated upconversion nanoparticles and the nanohairpin probes LT-H1 and H2 are mixed and incubated in a buffer.

[0010] Furthermore, the molar ratio of the poly-lysine-coated upconversion nanoparticles, the nanohairpin probes LT-H1 and H2 is 1:(40-60):(40-60).

[0011] Preferably, the molar ratio of the polylysine-coated upconversion nanoparticles, the nanohairpin probes LT-H1 and H2 is 1:50:50. By adjusting the molar ratio of the polylysine-coated upconversion nanoparticles, the nanohairpin probes LT-H1 and H2, the Zeta potential of the constructed near-infrared light-driven DNA nanosystem can be regulated to -20 to -40 mV, so that the cells show a higher uptake efficiency of the near-infrared light-driven DNA nanosystem.

[0012] Optionally, the formula of the buffer is: 20 mM Tris-HCl, 150 mM NaCl, 5 mM MgCl2, pH 7.4.

[0013] Furthermore, oil-phase upconversion nanoparticles NaGdF4:Yb / Tm@NaGdF4 are prepared by ultrasonically mixing the oil-phase upconversion nanoparticles NaGdF4:Yb / Tm@NaGdF4 with hydrochloric acid and vigorously stirring at room temperature; washing with HCl-ethanol solution, hydrochloric acid and MQ water (double distilled water or ultrapure water) in sequence to obtain water-phase upconversion nanoparticles;

[0014] The aqueous upconversion nanoparticles are dispersed in MQ water, polylysine is added and mixed, and the mixture is stirred in a dark environment (ie, away from light / dark environment) at room temperature to obtain polylysine-coated upconversion nanoparticles UCNP@PLL; centrifugation and washing are performed, and the UCNP@PLL is re-dispersed in MQ water for later use.

[0015] In a second aspect of the present invention, a nanohairpin probe combination for detecting miRNA-103 is provided, comprising nanohairpin probes LT-H1 and H2; the nucleotide sequence of the LT-H1 is as shown in SEQ ID NO.1, and the fluorescent group Cy3 is modified at the 43rd position from the 5' end of the nucleotide sequence, and a photocleavable linker is provided between the 48th position and the 49th position; the nucleotide sequence of the H2 is as shown in SEQ ID NO.2, and the fluorescent group Cy5 is modified at the 5' end of the nucleotide sequence.

[0016] The third aspect of the present invention provides a near-infrared light-driven DNA nanosystem for detecting miRNA-103, which is constructed using any of the above-mentioned construction methods.

[0017] In a fourth aspect, the present invention provides an application of the above-mentioned nanohairpin probe combination for detecting miRNA-103 in a non-cellular environment for purposes other than disease diagnosis and treatment.

[0018] In a fifth aspect, the present invention provides an application of a near-infrared light-driven DNA nanosystem for detecting miRNA-103 in a cell environment for purposes other than disease diagnosis and treatment; the near-infrared light-driven DNA nanosystem is constructed using any of the construction methods described above.

[0019] The near-infrared light-driven DNA nanosystem provided by the present invention is prepared by inserting a photocleavable linker into the designed nanohairpin probe LT-H1, modifying the fluorescent dye Cy3 in the sequence of LT-H1, and modifying the fluorescent dye Cy5 in the sequence of H2, to prepare a light-triggered DNA nanohairpin probe combination (LT-DP), including LT-H1 and H2. This nanohairpin probe combination LT-DP can be directly used to detect miRNA-103 in a non-cellular environment.

[0020] The "not for the purpose of disease diagnosis and treatment" claimed in the present invention refers to the detection of miRNA-103 in a cellular environment or a non-cellular environment under non-clinical conditions (for example, in laboratory research or teaching). That is, as long as the application scenario is not directly used for the diagnosis or treatment of diseases / symptoms related to vesicular viruses in the human or animal body, the above-mentioned technical means provided by the present invention can be used. It is easy to think that in clinical practice, the nano-hairpin probe combination provided by the present invention can also be considered for miRNA-103 detection.

[0021] Among the above-mentioned nanohairpin probes LT-H1 and H2, LT-H1 is designed to have three different functions, including a functional domain that recognizes miRNA-103, a light-activated domain modified with a photocleavable linker (PC-linker), and a binding domain that catalyzes hairpin assembly with H2; at the same time, the fluorophore Cy3 is also labeled on the LT-H1 nanohairpin probe. The nanohairpin probe H2 is designed by complementary base pairing with the LT-H1 sequence, and the fluorophore Cy5 is labeled at the 5' end of H2.

[0022] Specifically, the nucleotide sequences of the nanohairpin probes LT-H1 and H2 and the nucleotide sequence of miRNA-103 (DNA mimic) are shown in Table 1 below.

[0023] Table 1 Nucleotide sequences of nanohairpin probes LT-H1 and H2

[0024]

[0025] In order to detect miRNA-103 in cells, especially in ovarian granulosa cells of patients with polycystic ovary syndrome, it is necessary to prepare upconversion nanoparticles (i.e., UCNP@PLL) that can convert near-infrared light into ultraviolet light and are coated with poly-lysine. Then, through electrostatic adsorption, LT-DP (i.e., LT-H1 and H2) is combined with UCNP@PLL to construct the corresponding near-infrared light-driven DNA nanosystem. The near-infrared light-driven DNA nanosystem prepared by this method can realize in situ visualization imaging of miRNA-103 in cells.

[0026] Compared with the prior art, the present invention is beneficial in that:

[0027] 1. The near-infrared light-driven DNA nanosystem constructed by the present invention avoids the nonspecific activation of traditional catalytic hairpin assembly nanoprobes by using the photocleavable linker as a catalytic hairpin assembly, improves the signal-to-noise ratio of the detection, and has excellent detection sensitivity and specificity when performing miRNA-103 detection.

[0028] 2. The near-infrared light-driven DNA nanosystem constructed by the present invention has a good probe delivery rate and high spatiotemporal resolution when performing cell imaging by combining with upconversion nanoparticles, and can be used for in situ visualization imaging of miRNA-103 in ovarian granulosa cells of patients with polycystic ovary syndrome under clinical or non-clinical conditions.

[0029] 3. The near-infrared light-driven DNA nanosystem constructed by the present invention can be used for the precise detection of miRNA in ovarian granulosa cells of patients with different subtypes of PCOS, and can accurately distinguish the ovarian granulosa cells of normal people, obese and non-obese PCOS patients with different miRNA-103 expressions. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Schematic diagram of the near-infrared light-driven DNA nanosystem (LT-DP nanohairpin probe) constructed in the present invention for amplification imaging of miRNA-103.

[0031] Figure 2 This is a graph showing the sensitivity of the LT-DP nanohairpin probe constructed in Example 1 of the present invention to miRNA-103.

[0032] Figure 3 This is a diagram showing the selective detection of miRNA-103 by the LT-DP nanohairpin probe constructed in Example 1 of the present invention.

[0033] Figure 4 (a) Schematic diagram, (b) TEM characterization image and (c) emission spectrum (980 nm) of the LT-DP nanohairpin probe constructed in Example 1 of the present invention.

[0034] Figure 5 Zeta potential characterization diagram of near-infrared light-driven DNA nanosystems (LT-DP-1, LT-DP-2, LT-DP-3, LT-DP-4 and LT-DP-5) prepared with different molar ratios of LT-DP and UCNP@PLL, as well as aqueous upconversion nanoparticles NaGdF4:Yb / Tm@NaGdF4 and UCNP@PLL.

[0035] Figure 6 Imaging images of the cellular uptake ability of DNA nanosystems driven by near-infrared light with different Zeta potentials in KGN cell lines and clinical ovarian granulosa cells (GC).

[0036] Figure 7The near-infrared light-driven DNA nanosystem LT-DP-3 (Zeta potential of -30 mV) was used for confocal fluorescence imaging of miRNA-103 in KGN cell lines and ovarian granulosa cells of healthy, obese, and non-obese PCOS patients. Figure 7 a and 7c) and fluorescence quantitative analysis by confocal fluorescence imaging ( Figure 7 b Figure 7 d).

[0037] The LT-DP nanohairpin probe prepared in Example 2 of the present invention is used for visualization imaging of ovarian granulosa cells in clinical normal people, obese and non-obese polycystic ovary syndrome patients. DETAILED DESCRIPTION

[0038] The technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0039] The near-infrared light-driven DNA nanosystem provided by the present invention is specially designed and constructed for miRNA-103 detection.

[0040] When used to detect miRNA-103 in a non-cellular environment, the near-infrared light-driven DNA nanosystem includes nanohairpin probes LT-H1 and H2. As shown in Table 1 above, the nucleotide sequence of LT-H1 is shown in SEQ ID NO.1, and the fluorescent group Cy3 is modified at the 43rd position from the 5' end of the nucleotide sequence, and a photocleavable linker (such as PC-linker) is provided between the 48th and 49th positions; the nucleotide sequence of H2 is shown in SEQ ID NO.2, and the fluorescent group Cy5 is modified at the 5' end of the nucleotide sequence.

[0041] When used to detect miRNA-103 in a cellular environment or for in situ visualization of miRNA-103 in cells, the near-infrared light-driven DNA nanosystem includes, in addition to the nanohairpin probes LT-H1 and H2, a poly-lysine-coated upconversion nanoparticle is prepared. The nanohairpin probes LT-H1 and H2 are bound to the upconversion nanoparticles through electrostatic adsorption, thereby promoting the cell's uptake of the near-infrared light-driven DNA nanosystem.

[0042] The near-infrared light-driven DNA nanosystem provided by the present invention is divided into two types according to the above-mentioned different uses. When used to detect miRNA-103 in a non-cellular environment, there is no need to use upconversion nanoparticles UCNP@PLL, so the near-infrared light-driven DNA nanosystem includes nanohairpin probes LT-H1 and H2. When used to detect miRNA-103 in a cellular environment, or for in situ visualization imaging of miRNA-103 in cells, in order to promote cellular uptake of the near-infrared light-driven DNA nanosystem, the near-infrared light-driven DNA nanosystem needs to use upconversion nanoparticles UCNP@PLL, specifically, first prepare upconversion nanoparticles UCNP@PLL, and then bind the nanohairpin probes LT-H1 and H2 to the upconversion nanoparticles UCNP@PLL through electrostatic adsorption.

[0043] Regardless of the type of near-infrared light-driven DNA nanosystem, the detection of miRNA-103 is completed using the nanohairpin probes LT-H1 and H2. The detection principle is the same as Figure 1 shown.

[0044] Example 1: Design and preparation of nanohairpin probes LT-H1 and H2

[0045] In the nanohairpin probes LT-H1 and H2 provided in this embodiment, the nucleotide sequence of LT-H1 is as shown in SEQ ID NO.1, and the fluorescent group Cy3 is modified at the 43rd position from the 5' end of the nucleotide sequence, and a photocleavable linker PC-linker is provided between the 48th position and the 49th position; the nucleotide sequence of H2 is as shown in SEQ ID NO.2, and the fluorescent group Cy5 is modified at the 5' end of the nucleotide sequence. The sequences of the nanohairpin probes LT-H1 and H2 are specifically shown in Table 1 above.

[0046] The nanohairpin probes LT-H1 and H2 prepared in this example can be directly used as near-infrared light-driven DNA nanosystems and used to detect miRNA-103 in non-cellular environments (eg, miRNA-103 in a test tube).

[0047] Example 2: Sensitivity and specificity test of LT-DP nanohairpin probe for detecting miRNA-103

[0048] In this example, the nanohairpin probes LT-H1 and H2 designed in Example 1 were used to test the detection sensitivity and specificity of miRNA-103. The specific steps are as follows.

[0049] 1. Annealing of Nanohairpin Probe LT-DP (LT-H1 and H2)

[0050] The nanohairpin probes LT-DP (LT-H1 and H2) were prepared by annealing in HEPES buffer, and the mixed solution was incubated at 95°C for 5 min; then slowly cooled to room temperature and stored at 4°C for future use.

[0051] 2. Detection sensitivity of miRNA-103

[0052] 100 nM annealed LT-H1 and H2 and different concentrations (0 pM, 1 pM, 5 pM, 10 pM, 50 pM, 100 pM, 500 pM, 1 nM, 5 nM and 10 nM) of miRNA-103 were mixed in HEPES buffer; UV light (5 mW / cm 2 The cells were irradiated at 37 °C for 60 min.

[0053] After the reaction, the solution system was excited with 490 nm fluorescence, the fluorescence spectrum was recorded, and the fluorescence intensity at 675 nm and 575 nm corresponding to the fluorescence spectrum was measured to calculate the FRET ratio (F675 / F575).

[0054] like Figure 2 As shown in Figure 2, the LOD value calculated according to the 3σ method (LOD = 3σ / K) is 13 pM. Figure 2 It can be seen that the nanohairpin probe LT-DP (LT-H1 and H2) designed in the present invention shows a good linear correlation with the increase of the concentration of the above-mentioned miRNA-103, has a very high sensitivity, and the detection limit can reach 13 pM.

[0055] 3. Detection of miRNA-103 specificity

[0056] 100 nM annealed LT-H1 and H2 were mixed with 10 nM different RNAs (miRNA-103, miRNA141, miRNA10b, miRNA21, let-7a and IL-6) in HEPES buffer. The samples were illuminated with a UV lamp (5 mW / cm 2 The cells were irradiated with 365 nm (100 nm) for 10 min and then incubated at 37 °C for 60 min.

[0057] After the reaction, the solution system was excited with 490 nm fluorescence, the fluorescence intensity at 675 nm and 575 nm was measured, and the FRET ratio (F675 / F575) was calculated. Figure 3 As shown, it can be seen that the nanohairpin probe LT-DP (LT-H1 and H2) designed in the present invention did not detect the above 6 non-miRNA-103 RNAs, indicating that the nanohairpin probe LT-DP has a very high specificity for miRNA-103 detection.

[0058] Example 3: Construction of a near-infrared light-driven DNA nanosystem containing upconversion nanoparticles UCNP@PLL

[0059] The near-infrared light-driven DNA nanosystem provided in this embodiment is prepared by combining the nanohairpin probes LT-H1 and H2 with the upconversion nanoparticles UCNP@PLL through electrostatic adsorption.

[0060] The construction method of upconversion nanoparticles UCNP@PLL is as follows:

[0061] S1. Preparation of upconversion nanoparticles UCNP@PLL

[0062] S1-1. Preparation of oil-phase upconversion nanoparticles NaGdF4:Yb / Tm@NaGdF4.

[0063] It was prepared using the thermal decomposition method provided in the literature "Upconversion Luminescence-Activated DNA Nanodevice for ATP Sensing in Living Cells" (Jian Zhao, Jinhong Gao, Wenting Xue, Zhenghan Di, Hang Xing, Yi Lu, Lele Li, DOI: 10.1021 / jacs.7b11161).

[0064] Among them, the oil-phase upconversion nanoparticles NaGdF4:Yb / Tm@NaGdF4 can be prepared by referring to the existing method.

[0065] S1-2. Preparation of aqueous phase conversion nanoparticles (UCNPs) NaGdF4:Yb / Tm@NaGdF4

[0066] 1 mL of oil-phase upconversion nanoparticles (UCNPs) NaGdF4:Yb / Tm@NaGdF4 was ultrasonically mixed with hydrochloric acid solution (1 mL, 0.1 M) for 10 min and then vigorously stirred at room temperature for 3 h to remove oleic acid (OA) molecules on the surface of UCNPs.

[0067] UCNPs without OA molecules on the surface were collected and washed (washed with 0.01 M HCl-ethanol solution, 0.01 M hydrochloric acid and MQ water in sequence) to obtain aqueous phase transition nanoparticles (UCNPs) NaGdF4:Yb / Tm@NaGdF4.

[0068] The aqueous upconversion nanoparticles (UCNPs) NaGdF4:Yb / Tm@NaGdF4 were dispersed in 1 mL MQ water and stored at 4°C.

[0069] S1-3. Preparation of upconversion nanoparticles UCNP@PLL

[0070] The aqueous upconversion nanoparticles NaGdF4:Yb / Tm@NaGdF4 were ultrasonically mixed with 10 mg of poly-lysine (PLL) for 10 min and then stirred at room temperature in dark (i.e., protected from light / dark environment) for 24 h to form UCNP@PLL;

[0071] The unreacted PLL was removed by centrifugation (18,000 g, 10 min) and washed three times with MQ water.

[0072] Finally, the UCNP@PLL product was dispersed in 1 mL MQ water for later use.

[0073] S2. The annealed LT-DP (nanohairpin probes LT-H1 and H2) and upconversion nanoparticles UCNP@PLL were added to a buffer (20 mM Tris-HCl, 150 mM NaCl, 5 mM MgCl2, pH 7.4) at a molar ratio of 50:1 and incubated at 37°C for 2 h. The prepared near-infrared light-driven DNA nanosystem was constructed for subsequent cell experiments.

[0074] like Figure 4 shown. Figure 4 a is a schematic diagram of the near-infrared light-driven DNA nanosystem prepared in this example; Figure 4 b is the TEM characterization of the near-infrared light-driven DNA nanosystem; Figure 4 c is the emission spectrum of the near-infrared light-driven DNA nanosystem (980 nm).

[0075] Example 4: Effects of different molar ratios of LT-DP probe and upconversion nanoparticle UCNP@PLL on the ability of KGN cell line and clinical ovarian granulosa cells to uptake the corresponding near-infrared light-driven DNA nanosystem:

[0076] In order to more intuitively study the cellular uptake ability of the LT-DP probe, in this example, the annealed LT-DP probe (only Cy3-labeled LT-H1) and UCNP@PLL were tested at different molar ratios (60:1, 80:1, 100:1, 120:1 and 140:1), that is, only the nanohairpin probe LT-H1 (the amount used is the sum of the nanohairpin probes LT-H1 and H2) was selected, and incubated at 37 ° C for 2 h in a buffer (20mM Tris-HCl, 150mM NaCl, 5mM MgCl2, pH 7.4), and near-infrared light-driven DNA nanosystems with different Zeta potentials (LT-DP-1, LT-DP-2, LT-DP-3, LT-DP-4 and LT-DP-5) were synthesized respectively. Figure 5 As shown, the Zeta potentials of the LT-DP systems are: -10 mV for LT-DP-1, -20 mV for LT-DP-2, -30 mV for LT-DP-3, -40 mV for LT-DP-4, and -50 mV for LT-DP-5.

[0077] The above LT-DP systems with different Zeta potentials were used in subsequent cell uptake capacity optimization experiments.

[0078] KGN cells are ovarian granulosa cells from clinical PCOS patients. They are normal cells and miRNA-103 is not overexpressed in the cells. In order to simulate the overexpression of miRNA-103 in clinical polycystic ovary syndrome (PCOS) patients, KGN cells were transfected with miRNA-130 to construct a KGN cell line miRNA-103 overexpression model. The specific steps are as follows:

[0079] 1. Transfection of miRNA-103 mimics into KGN cells

[0080] KGN cells were seeded in 6-well plates (3 × 10 5 / well); miRNA-103 mimic was taken and 100 nM miRNA-103 mimic and negative control were transfected into cells using Lipofectamine 3000 for 48 h to obtain the miRNA-103 mimics overexpression model.

[0081] The nucleotide sequence of miRNA-103 mimic is agcagcattgtacagggctatga, as shown in SEQ ID NO.3.

[0082] 2. Clinical ovarian granulosa cell (GC) extraction

[0083] Density gradient centrifugation was used to extract clinical ovarian granulosa cells (GCs) from the follicular fluid of patients with polycystic ovary syndrome.

[0084] (1) Centrifuge the follicular fluid at 1500 × g for 10 min.

[0085] (2) Collect the precipitate and add 50% Percoll solution, then centrifuge at 1800 r / min for 20 min.

[0086] (3) Aspirate the middle white granular cell layer and treat it with red blood cell lysis buffer.

[0087] (4) The collected GCs were rinsed with PBS and inoculated into cell culture plates for cell confocal imaging experiments.

[0088] The experimental steps of cell confocal imaging were as follows: ovarian granulosa cells (GCs) and KGN cell line (miRNA-103 mimics overexpression model) of clinical PCOS patients were incubated with LT-DP system with different Zeta potential for 4 h, respectively; after incubation, they were rinsed with PBS three times, and the probes were activated by 980 nm near-infrared irradiation for 15 min, and the cell nuclei were stained with Hoechst 33342, and finally CLSM imaging was performed.

[0089] Figure 6 The imaging diagrams show the cell uptake ability of DNA nanosystems driven by near-infrared light with different Zeta potentials in KGN cell lines and clinical ovarian granulosa cells (GC). Figure 6 a It can be seen that compared with other systems, after the KGN cell line was incubated with the LT-DP-3 and LT-DP-4 systems, the cells showed obvious fluorescence signals; this indicates that the KGN cell line has a better cell uptake ability for the near-infrared light-driven DNA nanosystem with a Zeta potential of -40 to -30 mV. Figure 6 b It can be seen that for the ovarian granulosa cells (GC) of clinical PCOS patients, after incubating GC with LT-DP systems with different Zeta potentials, LT-DP-2, LT-DP-3 and LT-DP-4 systems have obvious fluorescence in GC; this indicates that GC shows a higher uptake efficiency for near-infrared light-driven DNA nanosystems with a Zeta potential in the range of -40 to -20 mV.

[0090] Example 5: Visualization of miRNA-103 in normal subjects, KGN cell lines, and clinical ovarian granulosa cells (GC) of patients with different subtypes of PCOS by near-infrared light-driven DNA nanosystem LT-DP-3

[0091] The annealed LT-DP (LT-H1 and H2) and UCNP@PLL were incubated in a buffer solution (20 mM Tris-HCl, 150 mM NaCl, 5 mM MgCl2, pH 7.4) at a molar ratio of 50:1 at 37 °C for 2 h to construct the near-infrared light-driven DNA nanosystem LT-DP-3 (Zeta potential of -30 mV).

[0092] The experimental steps of cell confocal imaging were as follows: ovarian granulosa cells (GCs) and KGN cell line (miRNA-103 mimics overexpression model) of clinical obese (Obese) and non-obese (Non-obese) PCOS patients were incubated with near-infrared light-driven DNA nanosystem LT-DP-3 for 4 h, respectively; after incubation, they were rinsed with PBS three times and irradiated with 980 nm near-infrared for 15 min to activate the probe; the cell nuclei were then stained with Hoechst 33342; finally, the FRET signals of the Cy3 and Cy5 channel cells were analyzed by confocal fluorescence microscopy system.

[0093] The results are as follows Figure 7 As shown. Figure 7 As can be seen from Figures 7a and 7b, the nanohairpin probe LT-DP (LT-H1 and H2) designed in the present invention showed significantly enhanced FRET (fluorescence intensity ratio: channel Cy5 / Cy3) signal for the detection of miRNA-103 in KGN cells, and the fluorescence intensity FRET ratio was about 1.5 ( Figure 7 b) It shows that the nanohairpin probe LT-DP can be used for visual detection of miRNA-103 in cells. Figure 7 As can be seen in Figure c, the nanohairpin probe LT-DP (LT-H1 and H2) designed by the present invention exhibits different fluorescence intensities when imaging miRNA-103 in ovarian granulosa cells of clinically healthy people, non-obese and obese PCOS patients. Figure 7 The fluorescence intensity of c was quantified, and the results were as follows Figure 7 As shown in d, it can be seen that the FRET signal intensities in the ovarian granulosa cells of clinically healthy people, non-obese and obese PCOS patients are 0.2, 1.0 and 1.5, respectively, with obvious differences in fluorescence intensity, indicating that the nanoprobe LT-DP designed in the present invention can be used to distinguish non-obese and obese PCOS patients with different miRNA-103 expressions.

[0094] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, the technical solution of the present invention can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. A method for constructing a near-infrared light-driven DNA nanosystem, characterized in that: The near-infrared light-driven DNA nanosystem is used to detect miRNA-103, comprising the following steps: Nanohairpin probes LT-H1 and H2 were designed; the nucleotide sequence of LT-H1 was as shown in SEQ ID NO.1, and the fluorescent group Cy3 was modified at the 43rd position from the 5' end of the nucleotide sequence, and a photocleavable linker was provided between the 48th position and the 49th position; the nucleotide sequence of H2 was as shown in SEQ ID NO.2, and the fluorescent group Cy5 was modified at the 5' end of the nucleotide sequence.

2. The method for constructing a near-infrared light-driven DNA nanosystem according to claim 1, characterized in that: The method also includes the steps of: preparing oil-phase upconversion nanoparticles, treating the oil-phase upconversion nanoparticles with hydrochloric acid at room temperature by stirring, and washing to obtain water-phase upconversion nanoparticles; mixing the water-phase upconversion nanoparticles with polylysine in water, stirring at room temperature, and washing to obtain polylysine-coated upconversion nanoparticles; The poly-lysine-coated upconversion nanoparticles and the nanohairpin probes LT-H1 and H2 are mixed and incubated in a buffer.

3. The method for constructing a near-infrared light-driven DNA nanosystem according to claim 2, characterized in that: The molar ratio of poly-lysine-coated upconversion nanoparticles, nanohairpin probes LT-H1 and H2 is 1:(40-60):(40-60).

4. The method for constructing a near-infrared light-driven DNA nanosystem according to claim 3, characterized in that: The molar ratio of poly-lysine-coated upconversion nanoparticles, nanohairpin probes LT-H1 and H2 was 1:50:

50.

5. The method for constructing a near-infrared light-driven DNA nanosystem according to claim 2, characterized in that: The formula of the buffer is: 20 mM Tris-HCl, 150 mM NaCl, 5 mM MgCl2, pH 7.

4.

6. The method for constructing a near-infrared light-driven DNA nanosystem according to claim 2, characterized in that: preparing oil-phase upconversion nanoparticles NaGdF4:Yb / Tm@NaGdF4, ultrasonically mixing the oil-phase upconversion nanoparticles NaGdF4:Yb / Tm@NaGdF4 with hydrochloric acid, and vigorously stirring at room temperature; washing with HCl-ethanol solution, hydrochloric acid and MQ water in sequence to obtain water-phase upconversion nanoparticles; The aqueous upconversion nanoparticles are dispersed in MQ water, polylysine is added and mixed, and the mixture is stirred in dark at room temperature to obtain polylysine-coated upconversion nanoparticles UCNP@PLL; the UCNP@PLL is re-dispersed in MQ water after centrifugation and washing.

7. A nanohairpin probe combination for detecting miRNA-103, characterized in that: It comprises nanohairpin probes LT-H1 and H2; the nucleotide sequence of LT-H1 is shown in SEQ ID NO.1, and the fluorescent group Cy3 is modified at the 43rd position from the 5' end of the nucleotide sequence, and a photo-cleavable connecting bond is provided between the 48th position and the 49th position; the nucleotide sequence of H2 is shown in SEQ ID NO.2, and the fluorescent group Cy5 is modified at the 5' end of the nucleotide sequence.

8. A near-infrared light-driven DNA nanosystem for detecting miRNA-103, characterized in that: The method is constructed by any one of claims 1 to 6.

9. An application of the nanohairpin probe combination according to claim 7, characterized in that: Used to detect miRNA-103 in non-cellular environments without the purpose of disease diagnosis and treatment.

10. An application of a near-infrared light-driven DNA nanosystem, characterized in that: Used for detecting miRNA-103 in a cell environment for purposes other than disease diagnosis and treatment; the near-infrared light-driven DNA nanosystem is constructed using the construction method described in any one of claims 1 to 6, or is the near-infrared light-driven DNA nanosystem described in claim 7.

Images