Method for ultra-sensitive detection of GSK3beta through rolling circle amplification based on magnetic separation

Abstract

The invention relates to a method for ultrasensitively detecting GSK3beta through rolling circle amplification based on magnetic separation, which can effectively solve the problems that the common method for detecting expression of a certain protein in body fluid of a patient at present is an Elisa method, and the method has the defects that the signal amplification capability is insufficient and the detection sensitivity is limited. Comprising the following steps: 1) preparing antibody modified magnetic beads; (2) preparing an SH-DNA modified antibody; (3) rolling circle amplification RCA reaction; (4) detecting GSK3beta protein; according to the invention, multiple protein detection can be realized, ultra-sensitive detection of GSK3beta in a patient specimen is carried out through a roll-exchange amplification principle, and the detection sensitivity is greatly improved and can reach fg level (fg / ml); according to the present invention, the concentration of the GSK3beta in the GSK3beta detection kit does not reach ng / ml while the concentration of the elisa detection kit used in the market, such as abroad famous brands such as Abcam, cell signalling and Invitrogen, does not reach ng / ml, and the method can use a variety of detection modes such as a microplate reader, laser confocal and streaming, and is the innovation of the GSK3beta detection method.

Description

1. Technical Field

[0001] The invention relates to the technical field of biomedicine, and in particular to a method for ultra-sensitive detection of GSK3β by rolling circle amplification based on magnetic separation. 2. Background Technology

[0002] Diabetic kidney disease (DKD) refers to chronic kidney disease (CKD) caused by diabetes. It is usually a clinical diagnosis based on elevated urinary albumin and / or decreased estimated glomerular filtration rate, while excluding other CKDs. The clinical features of DKD are gradually progressive proteinuria, progressive decline in renal function, and severe renal failure in the late stage. It is one of the main causes of death in diabetic patients. There may be some defects in using a single screening indicator to determine whether there is kidney damage. Therefore, a variety of auxiliary examination methods should be combined in clinical practice for comprehensive judgment. At the same time, the importance of diabetic kidney damage should be strengthened, the assessment of diabetic kidney damage should be standardized, and the early prediction and diagnosis of DKD should be strengthened.

[0003] Currently, the diagnosis of DKD in clinical practice relies on the assessment of renal function, usually by calculating the estimated glomerular filtration rate (eGFR), and the assessment of renal damage, usually by examining the urine albumin-to-creatinine ratio in a random urine sample.

[0004] There are some potential pitfalls in using eGFR as a marker for early diagnosis of DKD. First, serum creatinine levels are affected by muscle mass and dietary patterns (especially meat intake), which may interfere with the calculation of eGFR. Second, in some cases, the formula used may also lead to inaccurate results.

[0005] Albuminuria is considered a marker of renal damage, especially glomerular dysfunction. Calculation of UACR by checking albumin and creatinine levels in a random urine sample is the current clinical standard. However, urinary albumin excretion may also be increased by causes other than DKD, such as physical activity, dietary patterns, infection, fever, congestive heart failure, hyperglycemia, menstruation, and hypertension.

[0006] There is growing interest in using alternative biomarkers beyond urine albumin and creatinine for the detection of early DKD, including protein-based biomarkers present in urine, blood, and kidney tissue samples.

[0007] GSK3β (glycogen synthase kinase 3β) is a highly conserved threonine / serine kinase that activates glycogen synthase. As a key molecule in the glucose metabolism pathway, GSK3β participates in a variety of cellular activities, plays a key role in a variety of diseases, and is also a biomarker indicating the progression of DKD. Studies have shown that the expression level of GSK3β is positively correlated with kidney damage, especially the degree of kidney damage in diabetic nephropathy, and can be used as a biomarker for diabetic kidney damage. However, the current detection method for GSK3β in body fluids is only ELISA, and the detection range is limited. For patients with low expression levels of GSK3β in serum, especially urine, the sensitivity and detection range of ELISA are obviously insufficient, and the ELISA method is highly dependent on antibodies to GSK3β, which has certain limitations. Therefore, the improvement and innovation of GSK3β detection methods are currently an urgent problem to be solved. III. Summary of the invention

[0008] In view of the above situation, in order to solve the defects of the prior art, the purpose of the present invention is to provide a method for ultra-sensitive detection of GSK3β based on magnetic separation rolling circle amplification, which can effectively solve the problem that the commonly used method for detecting the expression of a certain protein in the patient's body fluid is the Elisa method, which has the disadvantages of insufficient signal amplification ability and limited detection sensitivity.

[0009] The technical solution provided by the present invention comprises the following steps:

[0010] 1) Preparation of antibody-modified magnetic beads

[0011] The carboxyl-modified magnetic beads are connected to the monoclonal antibody, and the unbound monoclonal antibody is removed by magnetic separation to obtain the antibody-modified magnetic beads;

[0012] 2) Preparation of SH-DNA modified antibodies

[0013] The thiol-modified primer (SH-DNA) is linked to the polyclonal antibody, and the position of the DNA bands before and after the reaction is determined by 12% Native-PAGE electrophoresis to verify the binding of DNA and the antibody, thereby obtaining the SH-DNA-modified antibody;

[0014] 3) Rolling circle amplification (RCA) reaction

[0015] The circular template is synthesized by enzyme ligation of the phosphate and hydroxyl ends, connected into a circle by template-mediated T4 DNA ligase, the primer recognizes the paired sequence of the circular template, and under the action of phi 29 polymerase, a repetitive linear single-stranded DNA / RNA sequence is synthesized, including a repetitive template complementary fragment, and the RCA reaction is mixed with reagents according to the following reaction system for 20-60 minutes to obtain an RCA product;

[0016] Reaction system

[0017]

[0018] 4) GSK3β protein detection

[0019] The antibody-modified magnetic beads prepared in step 1) are used to capture the GSK3β protein in a certain concentration gradient, and the SH-DNA-modified antibody prepared in step 2) is added to the magnetic bead precipitate, and the following mixed system is added to the magnetic bead precipitate after magnetic separation, and the RCA product obtained in step 3) is added after resuspending after magnetic separation;

[0020] Hybrid system

[0021]

[0022]

[0023] The single-stranded sequence of the loop template is: ATACAATAGGACTCAATTCTGCTAACCCGCCCTACCCAATATCTTCACCTCGCATACAGTCCGGGG, as shown in SEQ ID NO.1.

[0024] The primer sequence is: TCCTATTGTATCCCCGGACT, as shown in SEQ ID NO.2.

[0025] The thiol-modified primer sequence is: SH-TCCTATTGTATCCCCGGACT, as shown in SEQ ID NO.3.

[0026] The RCA product is a fluorescent complementary oligonucleotide chain with the sequence: Cy3-AACCCGCCCTACCCAATATC, as shown in SEQ ID NO.4.

[0027] Application of the RCA product of the present invention in preparing a kit for detecting GSK3β protein.

[0028] The present invention can realize multiple protein detection, and performs ultrasensitive detection of GSK3β in patient specimens through the principle of rolling amplification, which greatly improves the detection sensitivity and can reach the fg level (fg / ml); while the ELISA detection kits used on the market, including well-known foreign brands such as Abcam, cell signalling, and Invitrogen, all fail to reach ng / ml, and the method of the present invention can use a variety of detection methods: such as microplate reader, laser confocal, and flow cytometry, which is an innovation in the method of detecting GSK3β. IV. Description of the drawings

[0029] Figure 1 This is the basic principle of the rolling circle amplification (RCA) reaction of the present invention.

[0030] Figure 2 The Western blot of the present invention shows the binding of protein GSK3β with monoclonal antibodies and polyclonal antibodies.

[0031] Figure 3 This is a Western blot diagram of the present invention showing the binding of carboxyl-modified magnetic beads to antibodies (monoclonal antibodies).

[0032] Figure 4 This is a Western blot diagram of the present invention showing the binding of thiol-modified primer (SH-DNA) and antibody (polyclonal antibody).

[0033] Figure 5 It is a feasibility analysis diagram of the rolling circle amplification (RCA) reaction of the present invention.

[0034] Figure 6 This is an amplified view of the fluorescence signal of the RCA reaction of the present invention.

[0035] Figure 7 This is a feasibility diagram of the ultra-sensitive detection of GSK3β protein by the rolling circle amplification (RCA) amplification method based on magnetic separation of the present invention.

[0036] Figure 8 This is a correlation analysis diagram of the present invention using the RCA method to detect serum or urine specimens of patients with diabetic nephropathy and urine albumin (uACR). V. Specific implementation methods

[0037] The specific implementation of the present invention is further described in detail below in conjunction with the accompanying drawings and examples.

[0038] Example 1

[0039] The present invention, when implemented, specifically comprises the following steps:

[0040] 1) Preparation of antibody-modified magnetic beads

[0041] The carboxyl-modified magnetic beads were connected to the monoclonal antibody, with the ratio of magnetic beads to antibody = 100:1 (μg), and the unbound monoclonal antibody was removed by magnetic separation to obtain the antibody-modified magnetic beads;

[0042] 2) Preparation of SH-DNA modified antibodies

[0043] The thiol-modified primer (SH-DNA) is linked to the polyclonal antibody, and the position of the DNA bands before and after the reaction is determined by 12% Native-PAGE electrophoresis to verify the binding of DNA and the antibody, thereby obtaining the SH-DNA modified antibody;

[0044] 3) Rolling circle amplification (RCA) reaction

[0045] The circular template is synthesized by enzyme ligation of the phosphate and hydroxyl ends, connected into a circle by template-mediated T4 DNA ligase, the primer recognizes the paired sequence of the circular template, and under the action of phi 29 polymerase, a repetitive linear single-stranded DNA / RNA sequence is synthesized, including a repetitive template complementary fragment, and the RCA reaction is mixed according to the following reaction system, reacted for 30 minutes, and the RCA product is obtained;

[0046] Reaction system

[0047]

[0048] 4) GSK3β protein detection

[0049] Take 20 μL of the antibody-modified magnetic beads prepared in step 1) to capture 10 μL of GSK3β protein in a certain concentration gradient (1 ng / mL, diluted to 0, 50, 100, 300, 500 pg / mL in sequence according to the conditions of investigation), perform magnetic separation, add 20 μL of the SH-DNA-modified antibody prepared in step 2) to the magnetic bead precipitate, perform magnetic separation, add the following mixed system to the magnetic bead precipitate, resuspend after magnetic separation, and add the RCA product obtained in step 3);

[0050] Hybrid system

[0051]

[0052] The single-stranded sequence of the loop template is: ATACAATAGGACTCAATTCTGCTAACCCGCCCTACCCAATATCTTCACCTCGCATACAGTCCGGGG, as shown in SEQ ID NO.1.

[0053] The primer sequence is: TCCTATTGTATCCCCGGACT, as shown in SEQ ID NO.2.

[0054] The thiol-modified primer sequence is: SH-TCCTATTGTATCCCCGGACT, as shown in SEQ ID NO.3.

[0055] The RCA product is a fluorescent complementary oligonucleotide chain with the sequence: Cy3-AACCCGCCCTACCCAATATC, as shown in SEQ ID NO.4.

[0056] The present invention provides a method for ultra-sensitive detection of GSK3β protein based on magnetic separation rolling circle amplification (RCA) amplification method. First, magnetic beads-antibodies capture proteins (samples), and magnetic separation is used to remove free proteins; then SH-DNA is modified to bind antibodies to proteins, and magnetic separation is used to remove free molecules; resuspend and add ring templates and Phi29 enzymes to generate RCA reactions; add fluorescent chains, perform magnetic separation, and remove free fluorescent chains; and finally resuspend and use an ELISA instrument to measure fluorescence / confocal counting / flow analysis. The present invention uses the principle of rolling circle amplification to perform ultra-sensitive detection of GSK3β in patient specimens, greatly improving the detection sensitivity. The relevant experimental data are as follows:

[0057] 1. Antibody-protein binding

[0058] Western Blot

[0059] 1) Perform SDS-PAGE gel electrophoresis on GSK-3β protein;

[0060] 2) Cut out the target protein with the reference marker and transfer to the membrane;

[0061] 3) 5% skim milk to block excess sites on the membrane;

[0062] 4) Incubate the proteins on the membrane with monoclonal antibodies, polyclonal antibodies and phosphorylated antibodies respectively;

[0063] 5) Incubate with HRP-labeled secondary antibody;

[0064] 6) After incubation with ECL luminescent solution, exposure and imaging are performed, such as Figure 2 shown.

[0065] The results showed that the Western blot of the present invention showed that the protein GSK3β bound to the monoclonal antibody and the polyclonal antibody, but did not bind to the phosphorylated antibody, further illustrating the feasibility of the experimental technical solution.

[0066] 2. Magnetic beads linked to primary antibody

[0067] Experimental process: 1μm carboxyl modified magnetic beads: antibody = 100: 1 (μg)

[0068] 1) One-step coupling method allows for rapid binding. Carboxyl magnetic beads, EDC and antibody protein are added simultaneously in one reaction. The activation of the carboxyl group on the antibody protein will not affect subsequent experiments.

[0069] 2) Collect the connected magnetic beads and separate the magnetic beads, and the supernatant contains unbound antibodies;

[0070] 3) The binding of magnetic beads to antibodies is determined by SDS-PAGE gel electrophoresis and the amount of antibodies is determined based on the position and amount of the bands after staining.

[0071] The experimental results showed that compared with the control group, there were no obvious bands in the supernatant, the magnetic beads (dark color) were retained in the sample wells, and protein bands appeared, proving that the carboxyl-modified magnetic beads were bound to the antibody (monoclonal antibody). Figure 3 shown.

[0072] 3. DNA (primer) linked to secondary antibody

[0073] Experimental process: Sulfo-SMCC mediated SH-DNA and antibody coupling

[0074] 1) Sulfo-SMCC was first reacted with the antibody, shaken at room temperature for 1 hour, and free SMCC was removed by 10 kDa ultrafiltration;

[0075] 2) TCEP activated SH-DNA at room temperature for 30 min;

[0076] 3) The activated SH-DNA was added to 1) in the ratio of DNA:antibody=5:1, and reacted at room temperature for 48h;

[0077] 4) The binding of DNA to the antibody was verified by determining the positions of DNA bands before and after the reaction using 12% Native-PAGE electrophoresis.

[0078] The experimental results show that compared with the DNA band before the reaction, the DNA band after the reaction moved up, indicating that the DNA was connected to the antibody, and the electrophoretic resistance became larger, proving that the thiol-modified primer (SH-DNA) was bound to the antibody (polyclonal antibody). Figure 4 shown.

[0079] 4. Feasibility analysis of RCA reaction

[0080] 3) Feasibility study of rolling circle amplification (RCA) reaction: RCA reaction mixed reagents according to the following reaction system and performed amplification product detection;

[0081] Reaction system

[0082]

[0083] The single-stranded sequence of the loop template is: ATACAATAGGACTCAATTCTGCTAACCCGCCCTACCCAATATCTTCACCTCGCATACAGTCCGGGG, as shown in SEQ ID NO.1;

[0084] The primer sequence is: TCCTATTGTATCCCCGGACT, as shown in SEQ ID NO.2.

[0085] like Figure 5As shown, the results show that: 1) the Western blot uses 12% Native-PAGE electrophoresis to determine the synthesis of the circular template; 2) the Western blot uses 1% agarose gel electrophoresis to verify the RCA reaction conditions. The circular template, Phi29 enzyme, and SH-DNA alone cannot achieve RCA reaction. The nucleic acid nanoproduct retained in the sample well is the RCA product, which is only visible in the experimental group; 3) the Western blot uses 1% agarose gel electrophoresis to verify the RCA reaction time: 20-60min. In this experiment, the RCA reaction time of 30min is selected as the best.

[0086] 5. Fluorescence signal amplification of RCA reaction

[0087] like Figure 6 As shown, the fluorescence signal of the RCA reaction of the present invention is amplified, and the results show that: 1) the figure shows the efficiency of nucleic acid dye binding to rolling circle amplification (RCA) products; 2) the figure shows the efficiency of fluorescent complementary chain binding to RCA products; 3) the figure is a fluorescent spot imaging of RCA products using a 63x oil objective under confocal microscope; all three methods can detect the amplified RCA products.

[0088] 6. Feasibility of ultrasensitive detection of GSK-3β protein by RCA amplification based on magnetic separation

[0089] like Figure 7 As shown, the results show that: 1) This Western blot uses 1% agarose gel electrophoresis to verify the feasibility of this experiment; 2) This figure shows the feasibility of this experiment using an enzyme reader; 3) This figure shows the sensitivity of fluorescent detection of GSK3β.

[0090] 7. Detection of serum or urine specimens of patients with diabetic nephropathy (diagnosed with diabetic nephropathy by renal puncture biopsy)

[0091] like Figure 8 As shown, the results showed that: the RCA method was used to detect serum or urine specimens of patients with diabetic nephropathy (diagnosed with diabetic nephropathy by renal puncture biopsy), and correlation analysis was performed with urine albumin (uACR), and it was found that its expression level was positively correlated with urine uACR.

[0092] 8. Conclusion

[0093] The present invention uses the principle of rolling amplification to perform ultrasensitive detection of GSK3β in patient specimens, greatly improving the detection sensitivity, which can reach fg level, and can use a variety of detection methods: such as microplate reader, laser confocal, flow cytometry, and can also achieve multiple protein detection. It is an innovation in the GSK3β protein detection method and has practical clinical significance and promotion and application value.

[0094] It should be pointed out that the above is only a preferred embodiment of the present invention and does not limit the present invention in any form. Any technician familiar with the profession can make changes or modify the technical contents disclosed above into equivalent embodiments with equivalent changes without departing from the scope of the technical solution of the present invention, which all fall within the protection scope of the present invention.

Claims

1. A method for ultrasensitive detection of GSK3β based on magnetic separation rolling circle amplification, characterized in that: The following steps are involved: 1) Preparation of antibody-modified magnetic beads The carboxyl-modified magnetic beads are connected to the monoclonal antibody, and the unbound monoclonal antibody is removed by magnetic separation to obtain the antibody-modified magnetic beads; 2) Preparation of SH-DNA modified antibodies The thiol-modified primer is connected to the polyclonal antibody, and the position of the DNA bands before and after the reaction is determined by 12% Native-PAGE electrophoresis to verify the binding of DNA and the antibody, thereby obtaining the SH-DNA modified antibody; 3) Rolling circle amplification reaction The circular template is synthesized by enzyme ligation of the phosphate and hydroxyl ends, connected into a circle by template-mediated T4 DNA ligase, the primer recognizes the paired sequence of the circular template, and under the action of phi 29 polymerase, a repetitive linear single-stranded DNA / RNA sequence is synthesized, including a repetitive template complementary fragment, and the RCA reaction is mixed with reagents according to the following reaction system for 20-60 minutes to obtain an RCA product; Reaction system 4) GSK3β protein detection The GSK3β protein is captured by the antibody-modified magnetic beads prepared in step 1), and the SH-DNA-modified antibody prepared in step 2) is added to the magnetic bead precipitate, and the following mixed system is added to the magnetic bead precipitate after magnetic separation, and the RCA product obtained in step 3) is added after resuspending after magnetic separation; Hybrid system 2. The method for ultrasensitive detection of GSK3β based on magnetic separation and rolling circle amplification according to claim 1, characterized in that: The single-stranded sequence of the loop template is: ATACAATAGGACTCAATTCTGCTAACCCGCCCTACCCAATATCTTCACCTCGCATACAGTCCGGGG, as shown in SEQ ID NO.

1. The primer sequence is: TCCTATTGTATCCCCGGACT, as shown in SEQ ID NO.

2. The thiol-modified primer sequence is: SH-TCCTATTGTATCCCCGGACT, as shown in SEQ ID NO.

3. The RCA product is a fluorescent complementary oligonucleotide chain, and the sequence is: Cy3-AACCCGCCCTACCCAATATC, as shown in SEQ ID NO.

4.

3. The method for ultrasensitive detection of GSK3β based on magnetic separation and rolling circle amplification according to claim 1, characterized in that: The specific steps include: 1) Preparation of antibody-modified magnetic beads Connect the carboxyl-modified magnetic beads to the monoclonal antibody, 1 μm carboxyl-modified magnetic beads: antibody = 100: 1 μg, remove the unbound monoclonal antibody by magnetic separation, and obtain the antibody-modified magnetic beads; 2) Preparation of SH-DNA modified antibodies The thiol-modified primer is connected to the polyclonal antibody, and the position of the DNA bands before and after the reaction is determined by 12% Native-PAGE electrophoresis to verify the binding of DNA and the antibody, thereby obtaining the SH-DNA modified antibody; 3) Rolling circle amplification reaction The circular template is synthesized by enzyme ligation of the phosphate and hydroxyl ends, connected into a circle by template-mediated T4 DNA ligase, the primer recognizes the paired sequence of the circular template, and under the action of phi 29 polymerase, a repetitive linear single-stranded DNA / RNA sequence is synthesized, including a repetitive template complementary fragment, and the RCA reaction is mixed according to the following reaction system, reacted for 30 minutes, and the RCA product is obtained; Reaction system 4) GSK3β protein detection Use 20 μL of the antibody-modified magnetic beads prepared in step 1) to capture 10 μL of GSK3β protein with a concentration gradient of 0, 50, 100, 300, and 500 pg / mL, respectively, and perform magnetic separation and add 20 μL of the SH-DNA-modified antibody prepared in step 2) to the magnetic bead precipitate, perform magnetic separation and add the following mixed system to the magnetic bead precipitate, resuspend after magnetic separation and add the RCA product obtained in step 3); Hybrid system The single-stranded sequence of the loop template is: ATACAATAGGACTCAATTCTGCTAACCCGCCCTACCCAATATCTTCACCTCGCATACAGTCCGGGG, as shown in SEQ ID NO.1; The primer sequence is: TCCTATTGTATCCCCGGACT, as shown in SEQ ID NO.2; The thiol-modified primer sequence is: SH-TCCTATTGTATCCCCGGACT, as shown in SEQ ID NO.3; The RCA product is a fluorescent complementary oligonucleotide chain, and the sequence is: Cy3-AACCCGCCCTACCCAATATC, as shown in SEQ ID NO.

4.

4. Use of the RCA product obtained by the method according to any one of claims 1 to 3 in preparing a kit for detecting GSK3β protein.

Images