Primer and kit for rapidly and visually detecting mycobacterium leprosy and application of primer and kit for rapidly and visually detecting mycobacterium leprosy

Abstract

The invention discloses a primer and a kit for rapidly and visually detecting mycobacterium jatrovii and application of the primer and the kit. The primer comprises a pair of specific primer pairs for amplifying target genes of the mycobacterium jatrovii, and nucleotide sequences of the specific primer pairs for amplifying the target genes of the mycobacterium jatrovii are shown as SEQ ID NO.3 and 4 or SEQ ID NO.3 and 5. The kit is rapid, visible, good in specificity and high in sensitivity, and is particularly suitable for detecting mycobacterium leprosy in regions with poor medical conditions.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a primer, a kit and an application for rapid visualization detection of Mycobacterium leprae. Background Art

[0002] Leprosy, also known as Hansen's disease, is a chronic infectious disease caused by a bacterium called Mycobacterium leprae. The disease affects the skin, peripheral nerves, upper respiratory tract mucosa and eyes, and can cause progressive and permanent damage to the skin, nerves, limbs and eyes, leading to disability.

[0003] Leprosy is a neglected tropical disease (NTD). In 2019, more than 200,000 new leprosy patients were diagnosed worldwide, with more than 120 countries reporting cases (including non-local cases), 80% of which were newly diagnosed in India, Brazil and Indonesia. At present, the prevalence of leprosy in most parts of my country has been significantly controlled, but it still spreads to a certain extent in some remote rural areas. Due to the long incubation period of Mycobacterium leprae infection and the lack of obvious early symptoms, most patients can only be discovered clinically after severe limb deformities occur.

[0004] Early diagnosis and treatment of leprosy can effectively prevent disability. However, accurate diagnosis of leprosy remains a challenge. Currently, the diagnosis of leprosy is made clinically by finding at least one of the following main signs: (1) pale (hypopigmented) or reddish skin patches with obvious sensory loss; (2) thickening or enlargement of peripheral nerves, accompanied by sensory loss and / or weakness of the muscles innervated by these nerves; (3) skin smear examination (Ziehl-Neelsen acid-fast staining). Traditional skin smear examination is economical and rapid, but has low sensitivity and specificity, and an experienced physician is required to make a definitive diagnosis of leprosy in combination with clinical and pathological features. Respiratory transmission is the main route of infection with Mycobacterium leprae. Therefore, it is necessary to develop a non-invasive detection kit for the detection of Mycobacterium leprae nucleic acid in human nasal swabs.

[0005] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention and should not be regarded as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art. Summary of the invention

[0006] The purpose of the present invention is to provide a primer, a kit and an application for rapid visualization detection of Mycobacterium leprae.

[0007] In order to achieve the above object, a technical solution provided by a specific embodiment of the present invention is as follows:

[0008] The primer probe for rapid visual detection of Mycobacterium leprae of the present invention comprises a pair of specific primer pairs for amplifying Mycobacterium leprae target genes, and the nucleotide sequences of the specific primer pairs for amplifying Mycobacterium leprae target genes are shown in SEQ ID NOs. 3 and 4 or SEQ ID NOs. 3 and 5. The above primer probes and crRNA can be used in any combination.

[0009] In one or more embodiments of the present invention, crRNA and a fluorescent reporter probe for CRISPR / Cas12a reaction are also included, and the fluorescent reporter probe includes at least one single-stranded DNA sequence as shown in SEQ ID NO.6-8; the nucleotide sequence of RGEN DNA complementary to crRNA is shown in SEQ ID NO.2.

[0010] In one or more embodiments of the present invention, the 3' end and / or the 5' end of the fluorescent reporter probe is further connected to a fluorescent group. Preferably, the fluorescent group is selected from FAM, BHQ1, VIC, CY5, BHQ3, ROX, and BHQ2.

[0011] In one or more embodiments of the present invention, a kit for rapid visualization detection of Mycobacterium leprae comprises at least the aforementioned primer probe.

[0012] In one or more embodiments of the present invention, the kit also includes Cas12a protein, and the concentration of Cas12a protein is 1-10 μM.

[0013] In one or more embodiments of the present invention, the total concentration of the specific primer pairs used to amplify the target gene of Mycobacterium leprae is 10-40 μM.

[0014] In one or more embodiments of the present invention, the crRNA concentration used for CRISPR / Cas12a reaction is 300nM.

[0015] In one or more embodiments of the present invention, the concentration of the fluorescent reporter probe used in the CRISPR / Cas12a reaction is 10 μM.

[0016] In one or more embodiments of the present invention, a kit for rapid visualization detection of Mycobacterium leprae is provided, wherein, preferably, the nucleotide sequence of the specific primer pair used to amplify the Mycobacterium leprae target gene is as shown in SEQ ID NO.3 and 4, and the nucleotide sequence of the RGEN DNA complementary to the crRNA used for CRISPR / Cas12a reaction is as shown in SEQ ID NO.2.

[0017] In one or more embodiments of the present invention, a kit for rapid visualization detection of Mycobacterium leprae is used to identify whether an early infection of Mycobacterium leprae exists in a test sample.

[0018] In one or more embodiments of the present invention, the test sample used is selected from human nasal swab specimens.

[0019] The present invention is based on recombinase polymerase amplification (RPA) and CRISPR / Cas12a system, and establishes a detection method for rapid detection of Mycobacterium leprae. Specifically, the inventor designs recombinase polymerase amplification (RPA) primers and CRISPR / Cas12a system crRNA and fluorescent reporter probes according to the Mycobacterium leprae specific target gene sequence, realizes RPA specific target gene amplification, activates the trans-scission effect of CRISPR / Cas12a system to cut the fluorescent reporter probe amplification signal, thereby rapidly visualizing the detection of Mycobacterium leprae nucleic acid in human nasal swab specimens. By optimizing the RPA system and CRISPR / Cas12a reaction system, the specificity and sensitivity of the method are analyzed. The results show that the detection method has good specificity, and there is no cross reaction to Mycobacterium tuberculosis, Mycobacterium marinum, Mycobacterium kansasii, Mycobacterium haemophilum, Mycobacterium avium, etc., and the sensitivity can reach 100 copies / ml, and the test results can be obtained in 30 minutes at the fastest.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The detection method of the present invention can not only be applied to the analysis of fluorescence detection samples, but also can be combined with immunochromatography for visualization, and can be applied both in the laboratory and on the spot.

[0022] The present invention improves the detection sensitivity of Cas12a through recombinase polymerase amplification (RPA), utilizes the CRISPR / Cas12a trans-cleavage effect to cut the fluorescent reporter probe to amplify the signal, and the minimum detection limit can reach 100 copies / ml.

[0023] This method combines recombinase polymerase amplification (RPA) specific amplification with crRNA specific sequence identification, which is more specific;

[0024] This method is carried out at 37°C and is suitable for use in laboratories or on-site areas that lack instruments such as PCR machines.

[0025] In summary, the primers, kits and applications of a rapid visualization detection of Mycobacterium leprae provided by the present invention can detect Mycobacterium leprae nucleic acid in human nasal swab specimens rapidly, and rapidly predict the infection risk of leprosy patients or suspected leprosy patients who have not been disabled in the early stage, so as to help clinical diagnosis and confirm the accuracy, give timely intervention or treatment, and effectively prevent the spread of the disease and the occurrence of disability. At the same time, the present invention is fast, visible, and has good specificity and high sensitivity, and is particularly suitable for the detection of Mycobacterium leprae in areas with poor medical conditions. The present invention designs recombinase polymerase amplification (RPA) primers and CRISPR / Cas12a system crRNA and probes according to Mycobacterium leprae specific target gene sequences, realizes RPA specific target gene amplification, and CRISPR / Cas12a system cuts reporter genes, can detect Mycobacterium leprae nucleic acid in human nasal swab specimens rapidly, and rapidly predicts the infection risk of leprosy patients or suspected leprosy patients who have not been disabled in the early stage, so as to help clinical diagnosis and confirm the accuracy, give timely intervention or treatment, and effectively prevent the spread of the disease and the occurrence of disability. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0027] Figure 1 These are the test results of the kit in one embodiment of the present invention on 5 leprosy sensitivity standard products, from left to right: 10^4 copies / 10μL, 10^3 copies / 10μL, 10^2 copies / 10μL, 10 copies / 10μL, and 1 copy / 10μL.

[0028] Figure 2 Criteria for interpreting immunochromatographic test strip results.

[0029] Negative (-): The C line is colored and the T line is not colored, indicating that the nucleic acid probe is not cut by the Cas enzyme.

[0030] Positive (+): The C line is colored and the T line is visible to the naked eye, which is considered positive, indicating that part of the nucleic acid probe is cut by the Cas enzyme;

[0031] Invalid: Both the C line and the T line do not show color, indicating an operating error or the test strip has deteriorated and is invalid. In this case, you should read the instructions carefully again and retest.

[0032] Figure 3The results of immunochromatographic detection of 5 leprosy sensitivity standard samples by the kit in one embodiment of the present invention are, from left to right, 1 copy / 10 μL, 10 copies / 10 μL, 10^2 copies / 10 μL, 10^3 copies / 10 μL, 10^4 copies / 10 μL, NTC, and Pos control. DETAILED DESCRIPTION

[0033] In order to enable those skilled in the art to better understand the technical solutions in the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0034] Embodiment 1:

[0035] The design and preparation of specific primer pairs, crRNA and fluorescent reporter probes for rapid visual detection of Mycobacterium leprae include the following steps:

[0036] 1. Sequence acquisition: The source of the gene sequence used is NCBI (National Center for Biotechnology Information)

[0037] 2. Design method:

[0038] 2.1 According to the reference genome sequence of Mycobacterium leprae published in the NCBI database, a specific region was selected, which included a leprosy-specific high-copy sequence, for designing appropriate specific primer pairs, crRNA and fluorescent reporter probes. The sequence information obtained by screening is as follows:

[0039] SEQ ID NO.1-leprosy-specific high copy sequence:

[0040] GGGCACCTGGGCTGTGCTGAAGGCGATATCGATGCAGGCGTGAGTGTGAGGATAGTTGTTAGCGCCGC

[0041] GGGGTAGGGGCGTTTTAGTGTGCATGTCATGGCCTTGAGGTGTCGGCGTGGTCAATGTGGCCGCACCT

[0042] GAACAGGCACGTCCCCGTGCACGGTATAACTATTCGCACCTGATGTTATCCCTTGCACCATTTCTGCC

[0043] GCTGGTATCGGTGTCGGCGGCTTGTTGACCGGCCCTCAGCCAGCAAGCAGGCATGCCGCCGGGTGCAG

[0044] CAGTATTCGTGTTAGTGAACAGTGCATCGATGATCCGGCCGTCGGCGGCACATACGGCAACCTMycobacteriμMlepraeKyoto-2DNA,SequenceID:AP014567.1

[0045] 2.2 Design of crRNA using CRISPRRGENTools:

[0046] 1) The crRNA design of the CRISPR / Cas12a system should follow the following principles:

[0047] Target sequence selection: Select a specific target sequence as the starting point for design, which is usually determined based on the function of the target gene and the needs of related research.

[0048] PAM sequence selection: Select an appropriate PAM sequence near the target sequence (TTTN, N is any nucleotide). The PAM sequence is the key sequence for Cas12a enzyme recognition and binding. Lack of a suitable PAM sequence will cause Cas12a to be unable to recognize and cut the target sequence.

[0049] Avoiding cleavage sites: Avoid cleavage sites that match other non-target gene sequences by carefully designing the crRNA. This can be achieved by using sequence alignment software.

[0050] Avoid secondary structures at the cleavage site: Avoid forming stable secondary structures between the target sequence and other non-target sequences to ensure that the Cas12a enzyme can effectively bind to and cleave the target sequence.

[0051] Sequence selection and verification: During the design process, sequence alignment tools and structure prediction tools can be used to evaluate the specificity and effectiveness of the designed crRNA. The specificity and shearing effect of the designed siRNA can be confirmed by experiments.

[0052] 2) The RGEN sequence information designed by CRISPRRGENTools is shown in Table 1-1:

[0053] Table 1-1 RGENDNA sequences complementary to crRNA in the CRISPR / Cas12a system

[0054] name Serial number Nucleotide sequence MF-RGEN SEQ ID NO.2 5'-TTTCTGCCCGCTGGTATCGGTGTCGGCG-3'

[0055] 3) Preparation of crRNA: Referring to the instructions of Cas12a High Yield crRNA Synthesis and Purification Kit (TOLOBIO, #31903), Cas12a DR reverse complementary sequence and T7 Promoter reverse complementary sequence were added before the RGEN DNA sequence complementary to crRNA (nucleotide sequence as shown in SEQ ID NO.2) as templates for in vitro transcription, and the resulting template sequence was commissioned to be synthesized by Integrated DNA Technologies of the United States (IDT for short). The synthesized template sequence was added to the reagents provided in the kit, incubated overnight at 37 ° C, and the DNA template was digested with DNase I. The crRNA concentration was determined by Qubit for magnetic bead purification, and the crRNA concentration was aliquoted and frozen at -80 ° C.

[0056] 2.3 Design of RPA primers using PrimerPremier5:

[0057] 1) The design of RPA primers should follow the following principles:

[0058] Primer length: RPA primers usually need to be 30-38 bases, compared to 15-30 bp in traditional PCR.

[0059] The primers for RPA are longer because longer primers help improve amplification efficiency and specificity.

[0060] Avoid specific sequences: The 3-5 nucleotides at the 5' end should avoid polyguanine, while the guanine and cytosine in the 3' terminal nucleotides help stabilize the binding of the polymerase. In addition, special sequences such as long strings of polypurine or polypyrimidine should be avoided in the primers, as this may affect the amplification performance.

[0061] GC content: The ideal GC content should be between 40% and 60%. Avoid too high or too low GC content, as this may be detrimental to RPA amplification.

[0062] Avoid secondary structures and primer-primer interactions: Secondary structures such as hairpin structures or primer complementarity should be avoided during design, as these structures may lead to the formation of primer dimers, thereby affecting amplification efficiency.

[0063] Temperature conditions: The optimal temperature for RPA reaction is between 37°C and 42°C, and no traditional denaturation step is required.

[0064] This requires that this feature be taken into consideration when designing primers.

[0065] 2) Primer sequence information designed by PrimerPremier5 is shown in Table 1-2:

[0066] Table 1-2 List of RPA specific primers

[0067] name Serial number Nucleotide sequence MF-F1 SEQ ID NO.3 5'-CGGCGTGGTCAAGTGTGGCCGCACCTGAACAG-3' MF-R1 SEQ ID NO.4 5'-ATCGATGCACTGTTCACTAACACGATACTGC-3' MF-R2 SEQ ID NO.5 5'-TCGATGCACTGTTCACTAACACGATACTGCT-3'

[0068] 3. The obtained sequence was commissioned to be synthesized by Integrated DNA Technologies (IDT) of the United States.

[0069] 2.4 Synthesis of fluorescent reporter probes:

[0070] After binding to the target, the CRISPR-Cas12a protein can activate its trans-cleavage effect, that is, it can indiscriminately cut any single-stranded DNA in the system. The nucleotide sequence with fluorescent groups after cutting can emit fluorescence, and the fluorescence value in the reaction system can be detected by fluorescence detection equipment, or by immunochromatography detection through test strips.

[0071] Table 1-3 List of fluorescent reporter probes

[0072] Serial number Nucleotide sequence SEQ ID NO.6 ATTATTATTATT SEQ ID NO.7 TTTATTTATTTA SEQ ID NO.8 AAATAAATAAAT

[0073] The fluorescent reporter probe is a single-stranded DNA sequence containing at least one of SEQ ID NO.6-8; when used for fluorescence detection, the 3' end and / or 5' end of the fluorescent reporter probe is also connected to a fluorescent group, and the fluorescent group is selected from FAM, BHQ1, VIC, CY5, BHQ3, ROX, and BHQ2. In the embodiment of this scheme, the single-stranded DNA sequence shown in SEQ ID NO.6 is specifically used as an example; when used for fluorescence detection, the 3' end of the fluorescent reporter probe is also connected to a fluorescent group BHQ2.

[0074] The obtained fluorescent reporter probe was commissioned to be synthesized by Integrated DNA Technologies (IDT) of the United States.

[0075] Example 2

[0076] Verification of experimental method accuracy

[0077] 1. Materials: 10 accuracy reference samples, consisting of 4 Mycobacterium leprae genomic DNA, 2 Mycobacterium tuberculosis genomic DNA, 2 Mycobacterium marinum genomic DNA, and 2 Mycobacterium kansasii genomic DNA;

[0078] 2. Method: The above-mentioned genomic DNA was detected using the above-mentioned Mycobacterium leprae detection kit. The specific primers, crRNA and fluorescent reporter probes used for Mycobacterium leprae detection in the kit were prepared in Example 1; the RPA amplification reagent in the kit was prepared by ABampbasicKitforDNA, purchased from Wuhan Abotek Biotechnology Co., Ltd., item number RK20738; the CRISPR / Cas12a detection reagent in the kit was prepared by LbaCas12a (Cpf1) nuclease was prepared and purchased from NEB (New England Biolabs), catalog number M0653S.

[0079] A. Sample preparation: Four samples of Mycobacterium leprae genomic DNA were provided by the Institute of Dermatology, Chinese Academy of Medical Sciences. The Mycobacterium tuberculosis genomic DNA, Mycobacterium marinum genomic DNA, and Mycobacterium kansasii genomic DNA were developed by the Henan Industrial Microbial Strain Engineering Technology Research Center and purchased for future use.

[0080] B. Prepare the RPA amplification reaction solution according to Table 2, vortex to mix, and centrifuge instantaneously;

[0081] Table 2. Configuration of RPA amplification reaction solution for Mycobacterium leprae

[0082] Components Each reaction / μL RPAPCRreagent 1x Samples to be tested 10.0 2×ReactionBuffer 25 MF-F1 2 MF-R1 2 <![CDATA[ddH2O]]> 8.5 MgOAC 2.5 Total volume 50

[0083] C. Place the amplification reaction solution in a constant temperature device at 37-39°C for 30 minutes;

[0084] D. Use Cas12a to detect specific target sequences, turn on the fluorescent PCR instrument in advance and set the reaction temperature to 37°C, turn off the re-incubation function or set the hot cover to 45°C.

[0085] E. Prepare the CRISPR / Cas12a detection reaction system according to Table 3, flick to mix, centrifuge instantaneously (avoid vortexing and vigorous vibration), and repeat 3 times;

[0086] Table 3. Configuration of reaction solution for detecting M. leprae CRISPR / Cas12a

[0087] Components Each reaction / μL Amplification products 5 NEBufferr2.1ReactionBuffer(10X) 3 300nM crRNA 3 10 μM fluorescent reporter probe 1 1 μM EnGenLbaCas12a (Cpf1) 1 <![CDATA[ddH2O]]> 17 Total volume 30

[0088] F. Place the reaction tube in a fluorescent PCR instrument (FAM channel), react at 37°C for 30-60 minutes, and automatically collect the fluorescent signal every 30 seconds.

[0089] G. Result analysis: There were fluorescence signals in the FAM fluorescence channels of P1, P2, P3, and P4 wells, indicating that Mycobacterium leprae was positive. There were no fluorescence signals in the FAM fluorescence channels of J1, J2, H1, H2, K1, and K2 wells, indicating that Mycobacterium leprae was negative. The accuracy of the test result was 100%. At the same time, it was proved that this kit had no cross reaction with Mycobacterium tuberculosis, Mycobacterium marinum, Mycobacterium kansasii, etc. The test results are shown in Table 4.

[0090] Table 410 accuracy reference test results

[0091]

[0092]

[0093] H. Immunochromatography analysis: Take 1-10 μL of the reaction product and dilute it 9-200 times with diluent in a centrifuge tube, mix well; take 70 μL of the diluted reaction product and drop it on the nucleic acid test strip, record the test results in the reading area within 5 minutes, and the judgment standard is as follows: Figure 2 shown.

[0094] I. Analysis of immunochromatography test results: There are bands on the test lines (TestLine, T line) of P1, P2, P3, and P4 wells, and there are bands on the quality control line (ControlLine, C line), indicating that the sample contains the target nucleic acid fragment to be detected (Cas protease is activated and the fluorescent reporter probe is cut); there are no bands on the J1, J2, H1, H2, K1, and K2 wells (TestLine, T line), and there are bands on the quality control line (ControlLine, C line), indicating that there is no target nucleic acid fragment to be detected in the sample (Cas protease is not activated and the fluorescent reporter probe is not cut).

[0095] 3. Analysis of experimental results: The experimental results show that the kit provided by the present invention accurately detects Mycobacterium leprae, indicating that the detection method is successfully established and can not only be applied to the analysis of fluorescent detection samples, but also can be combined with immunochromatography for visualization, which can be applied both in the laboratory and on the field.

[0096] Example 3

[0097] Experimental method sensitivity verification

[0098] 1. Materials: Mycobacterium leprae sensitivity standard

[0099] 2. Methods: The Mycobacterium leprae sensitivity standard was tested using the above-mentioned Mycobacterium leprae detection kit. Each standard plate was repeated 3 times. The detection experiment was completed on a MA6000 fluorescence quantitative PCR instrument.

[0100] A. The sensitivity reference was prepared by diluting the artificially synthesized plasmid. The plasmid mother solution was quantified by Qubit4 fluorometer, the copy number was calculated, and the 1xTE solution was diluted in a gradient to obtain 5 sensitivity standards including 10^4 copies / 10μL, 10^3 copies / 10μL, 10^2 copies / 10μL, 10 copies / 10μL, and 1 copy / 10μL. This plasmid contains the sequence information of the target gene and was commissioned to be synthesized by Genewise Biotechnology Co., Ltd.

[0101] B. The above sensitivity standard was tested, and the test steps and result analysis were the same as in Example 2. The fluorescence test results were as follows: Figure 1 The detailed results are shown in Table 5. The results of immunochromatography are shown in Figure 3 As shown, the detection results show that the kit of the present invention can achieve high-quality stable detection at ≥1 copy / 10 μL sample.

[0102] Table 58 Sensitivity Reference Test Results

[0103]

[0104]

[0105] Analysis of experimental results: Based on the above-mentioned Mycobacterium leprae detection kit, 5 Mycobacterium leprae sensitivity standards were tested and analyzed. Figure 1 , Figure 3 As shown, this kit has excellent linearity and high sensitivity, and the minimum detection limit can reach 1 copy / 10μL.

[0106] Example 4

[0107] Clinical sample validation 1

[0108] 1. Materials: 20 clinical skin lesion tissue specimens with known results

[0109] 2. Methods: The above kit was used to detect 20 clinical skin lesion tissue specimens with known results, and the detection test was completed on a MA6000 fluorescence quantitative PCR instrument.

[0110] A. Use nucleic acid extraction and purification reagent (column method) (SuSu Medical Equipment No. 20231196) to extract nucleic acid from the above-mentioned clinical skin lesion tissue specimens. The extraction steps are carried out according to the product instructions to obtain 50 μL DNA solution, which is directly tested or temporarily stored at -20°C. At the same time, quality control products are tested.

[0111] B. The detection steps and result analysis were carried out according to Example 2. The detailed results are shown in Table 6.

[0112] Table 6 Test results of 20 clinical specimens

[0113]

[0114]

[0115] Experimental result analysis: According to the above-mentioned kit for detecting Mycobacterium leprae, 20 clinical skin lesion tissues with known results were tested and analyzed. As shown in Table 6, 100% of multibacillary specimens can be detected, and the detection rate of 90% of paucibacillary specimens can be further explained, which further illustrates that the kit of the present invention can simply, quickly and accurately detect and determine Mycobacterium leprae, and meet the application requirements of clinical early diagnosis.

[0116] Example 5

[0117] Clinical sample validation 2

[0118] 3. Materials: Nasal swab specimens from 10 leprosy-infected patients

[0119] 4. Methods: The above kit was used to detect nasal swab specimens from the 10 leprosy-infected patients, and the detection test was completed on a MA6000 fluorescent quantitative PCR instrument.

[0120] A. Use nucleic acid extraction and purification reagent (column method) (SuSu Medical Equipment No. 20231196) to extract nucleic acid from the above nasal swab specimens. The extraction steps are carried out according to the product instructions to obtain 50 μL DNA solution, which is directly tested or temporarily stored at -20°C. At the same time, quality control products are tested.

[0121] B. The detection steps and result analysis were carried out according to Example 2. The detailed results are shown in Table 7.

[0122] Table 7 Test results of 10 clinical specimens

[0123]

[0124]

[0125] Analysis of experimental results: According to the above-mentioned kit for detecting Mycobacterium leprae, nasal swab specimens of 10 leprosy-infected patients were tested and analyzed. As shown in Table 7, the positive detection rate was 70%, which further illustrates that the kit of the present invention can be used to quickly diagnose leprosy patients who have not developed disability or suspected leprosy patients in the early stage, give timely treatment, effectively prevent the spread of the disease and the occurrence of disability, and meet clinical needs.

[0126] It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above and that the invention can be implemented in other specific forms without departing from the spirit or essential features of the invention. Therefore, the embodiments should be considered exemplary and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations falling within the meaning and scope of the equivalent elements of the claims be included in the invention. Any reference numeral in a claim should not be considered as limiting the claim to which it relates.

[0127] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A primer probe for rapid visual detection of Mycobacterium leprae, characterized in that: It comprises a pair of specific primers for amplifying the target gene of Mycobacterium leprae. The nucleotide sequence of the specific primers for amplifying the target gene of Mycobacterium leprae is shown in SEQ ID NO. 3 and 4 or SEQ ID NO. 3 and 5.

2. The primer probe according to claim 1, characterized in that: It also includes crRNA and a fluorescent reporter probe for CRISPR / Cas12a reaction, wherein the fluorescent reporter probe includes at least one single-stranded DNA sequence as shown in SEQ ID NO.6-8; the nucleotide sequence of the RGEN DNA complementary to the crRNA is shown in SEQ ID NO.

2.

3. The primer probe according to claim 2, characterized in that: The 3' end and / or 5' end of the fluorescent reporter probe is also connected to a fluorescent group.

4. A kit for rapid visual detection of Mycobacterium leprae, characterized in that: At least comprising the primer probe according to any one of claims 1-3.

5. The kit according to claim 4, characterized in that The kit also includes Cas12a protein, and the concentration of Cas12a protein is 1-10 μM.

6. The kit according to claim 4, characterized in that The total concentration of the specific primer pairs used to amplify the target gene of Mycobacterium leprae is 10-40 μM.

7. The kit according to claim 4, characterized in that The crRNA concentration used for CRISPR / Cas12a reactions was 300 nM.

8. The kit according to claim 4, characterized in that The concentration of the fluorescent reporter probe used for the CRISPR / Cas12a reaction was 10 μM.

9. Use of the kit for rapid visualization detection of Mycobacterium leprae according to any one of claims 4 to 8 in identifying whether an early infection of Mycobacterium leprae exists in a detection sample.

10. The use according to claim 9, characterized in that: The test sample used in the application is selected from human nasal swab specimens.

Images