Primer group for detecting halophilic bdellovibrio bacteriovorus, detection method and application

Abstract

The invention discloses a primer group for detecting halophilic bdellovibrio bacteriovorus based on high-throughput sequencing and application of the primer group. The primer group comprises primers of which the nucleotide sequences are as shown in SEQ ID NO.1 and SEQ ID NO.2. The invention further discloses a method for detecting the halophilic bdellovibrio bacteriovorus based on high-throughput sequencing. The invention also discloses a halophilic bdellovibrio detection method based on high-throughput sequencing. The method comprises the following steps: extracting template DNA of a sample to be detected; carrying out amplification on the template DNA by using the two primers; treating an amplification product, constructing a gene library, and carrying out high-throughput sequencing; after sequencing data is processed, statistical analysis is carried out, and the biological diversity of the halophilic bdellovibrio is obtained. According to the primer provided by the invention, diversity detection on the Halobacteriovorax can be realized, the primer has the characteristics of high sensitivity, good repeatability and the like, construction of a gene library is completed through one-step amplification, and existence and diversity of the Halobacteriovorax in an environment can be rapidly detected.

Description

Technical Field

[0001] The invention relates to the technical field of gene sequencing and identification, and in particular to a primer set for detecting Bdellovibrio halophilicus Halobacteriovorax based on high-throughput sequencing, a detection method and an application thereof. Background Art

[0002] Bdellovibrio and like organisms (BALOs) are small, curved or rod-shaped organisms with a size of about 0.2-0.4 μm × 0.8-1.2 μm. They are predatory bacteria that parasitize other Gram-negative bacteria.

[0003] In 1963, Stolp and Starr successfully isolated Bdellovibrio from soil samples using the double-layer plate method and named it Bdellovibrio vorus. Since the discovery of Bdellovibrio, researchers at home and abroad have detected that Bdellovibrio is widely distributed in the natural environment through molecular technology. As a predatory bacterium, BALOs not only have a unique life history and predation characteristics, but also have characteristics such as being non-toxic to humans. Therefore, BALOs can be used as a microbial agent to prevent and control bacterial diseases and have a wide range of uses in the agricultural field.

[0004] In recent years, my country's marine aquaculture industry has developed rapidly, and the scale of aquaculture has continued to expand. Along with this, the problem of aquaculture diseases has become increasingly serious. Among them, the more serious bacterial diseases are mainly caused by pathogenic Vibrio. The traditional method of controlling pathogenic Vibrio is to use antibiotic chemicals, but this not only aggravates the production of drug-resistant strains, but also leads to the deterioration of the offshore ecological environment. Given that the halophilic Bdellovibrio Halobacteriovorax in the aquaculture environment can efficiently prey on pathogenic Vibrio, therefore, detecting the distribution of halophilic Bdellovibrio Halobacteriovorax is of great significance for the prevention and control of bacterial diseases in aquaculture. With the development of molecular biology technology, the new generation of high-throughput sequencing technology has been widely used in the classification study of BALOs, providing a new idea for studying the biodiversity of halophilic Bdellovibrio Halobacteriovorax in the environment. Currently, the detection of Halobacteriovorax is mostly carried out by high-throughput sequencing using universal primers of bacterial 16S. The advantage of this primer is that it can identify the diversity of major bacterial categories. However, the resolution of Halobacteriovorax groups is low, and its diversity and subclasses cannot be accurately identified. Therefore, it is urgent to design a pair of specific primers for the Halobacteriovorax group for the study of the diversity of Halobacteriovorax groups. Summary of the invention

[0005] The invention aims to provide a primer set and a detection method for detecting Halobacteriovorax based on high-throughput sequencing, which can be used for detecting Halobacteriovorax and improving the accuracy of classification.

[0006] In order to achieve the above object, the present invention provides a primer set for detecting Halobacteriovorax, which comprises two primers whose nucleotide sequences are shown as SEQ ID NOs. 1 and 2.

[0007] The primer set provided by the invention can be used for detecting Halobacteriovorax in the environment and detecting the biodiversity of Halobacteriovorax.

[0008] The present invention also provides a kit for detecting Halobacteriovorax, which comprises two primers with nucleotide sequences as shown in SEQ ID NO.1 and 2.

[0009] The present invention also provides a method for detecting Halobacteriovorax based on high-throughput sequencing, comprising the following steps:

[0010] (1) Extracting genomic DNA from the sample to be tested;

[0011] (2) using genomic DNA as a template, PCR amplification was performed using the two primers mentioned above;

[0012] (3) construct a gene library for PCR amplification products and perform high-throughput sequencing;

[0013] (4) Statistical analysis was performed on the sequencing data to obtain the detection results of Halobacteriovorax.

[0014] Preferably, the reaction system for the PCR amplification is 20 μL, including 10 μL TaqPCR StarMix, 1 μL genomic DNA, 0.5 μL of each of two primers, and 8 μL double distilled water.

[0015] Preferably, the reaction procedure of the above PCR amplification is: pre-denaturation at 95°C for 4 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, for a total of 35 cycles; extension at 72°C for 5 min.

[0016] Preferably, the detection result of the above step (4) includes the presence or absence of Halobacteriovorax and biodiversity detection.

[0017] The present invention has the following advantages:

[0018] The invention provides a method for detecting halophilic Bdellovibrio Halobacteriovorax based on high-throughput sequencing technology, develops a halophilic Bdellovibrio Halobacteriovorax-specific primer, and uses the primer to identify strains, thereby realizing diversity detection of halophilic Bdellovibrio Halobacteriovorax. The method has the characteristics of high sensitivity, good repeatability, etc., and can complete the construction of a gene library by one-step amplification, so that the presence of halophilic Bdellovibrio Halobacteriovorax in an environment can be quickly detected. The composition of halophilic Bdellovibrio Halobacteriovorax in an environmental sample can be comprehensively identified without using traditional ideas, and classification can be performed. The resolution is higher than that of 16S rRNA, and a new idea is provided for studying the biodiversity of halophilic Bdellovibrio Halobacteriovorax in an environment.

[0019] The method of the invention can comprehensively identify the Halobacteriovorax in the sample to be tested, and the identification accuracy is extremely high. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The diversity of Halobacteriovorax is obtained by analyzing the characteristics of the microbial community structure in the water sample and analyzing the taxonomic statistical results in the present invention. DETAILED DESCRIPTION

[0021] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0022] Note: The experimental methods in the following examples are conventional methods unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0023] Example 1

[0024] This embodiment provides a method for developing a primer set for detecting Halobacteriovorax and identifying a strain, which is as follows:

[0025] 1. Specific primer design method:

[0026] According to the sequences of the 16S rRNA region of Halobacteriovorax published on the website of NCBI (National Center for Biotechnology Information), 17 representative sequences of Halobacteriovorax grown in seawater with different salinity gradients were downloaded (the database accession numbers are: DQ631770.1, DQ631715.1, DQ631752.1, DQ631772.1, KM107985.1, KM107995.1, KM107991.1, DQ631773.1, DQ631774.1, DQ631775.1, DQ631776.1, DQ6317777.1, DQ631778.1, DQ631779.1, DQ631779.1, DQ631779.1, DQ631770.1, DQ6317715 ... 1783.1, DQ631758.1, DQ631739.1, OM666629, KM107982.1, KM107997.1, KM107987.1, KM107989.1, OM666630), the representative sequences were compared and analyzed by ClustalW software, and the regions with conservative and significant differences in the jurisdictional sequences were selected for primer design and screening. The amplified fragment was limited by the read length of the Illumiana MiSeq platform and was controlled below 600 bp. The preset PCR product was about 500 bp. The specific information of the designed primer set is as follows:

[0027] Upstream primer Halo 676F (SEQ ID NO: 1):

[0028] CTTGGTCATTTAGAGGAAGTAA;

[0029] Downstream primer Halo 1193R (SEQ ID NO: 2):

[0030] GCTGCGTTCTTCATCGATGC.

[0031] 2. PCR Amplification and Identification

[0032] 1. Collect surface water samples from the Dafeng River estuary in Guangxi Zhuang Autonomous Region (the principle of water sample collection is based on salinity gradient), store seawater samples at 4°C and transport them back to the laboratory in time.

[0033] 2. Each 2L water sample was pre-filtered using a 0.22μm polycarbonate membrane, and then filtered using a 0.1μm polycarbonate membrane to collect Halobacteriovorax. The membrane was stored at -80℃ for DNA extraction.

[0034] 3. Use the DNeasy PowerWaterKit kit to extract biofilm DNA. The extraction process is strictly in accordance with the kit instructions. The DNA concentration is measured by NanoVueTM Plus microanalyzer, and the quality of the extracted DNA is tested by agarose gel electrophoresis.

[0035] 4. The upstream and downstream primers for PCR amplification are Halo 676F and Halo 1193R respectively. The PCR reaction system is 20μL in total, including 10μL Taq PCR StarMix, 1μL DNA to be tested, 0.5μL of upstream and downstream primers, and finally double distilled water is used to make up the surplus. The PCR amplification reaction program is: 95℃ pre-denaturation for 4min; 95℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 45s, a total of 35 cycles; 72℃ extension for 5min. The PCR product was detected by agarose gel electrophoresis, and the electrophoresis band was single, indicating good primer specificity. The PCR amplification product was sent to a sequencing company for sequencing. After the sequencing results were compared with the database on the NCBI website, it was shown that the sequences all belonged to Halobacteriovorax, proving that the primers had strong specificity.

[0036] 3. Sample testing and analysis

[0037] 1. Collect surface water samples from the Dafeng River estuary in Guangxi Zhuang Autonomous Region in four seasons. Samples in each season were collected from water environments with three salinity gradients: low, medium, and high. Filter 2L of seawater samples with 0.22μm and 0.1μm polycarbonate membranes, and extract biofilm DNA using the DNeasy PowerWaterKit kit. Use the extracted samples as templates to perform PCR amplification according to the PCR reaction system and reaction procedure provided above.

[0038] 2. The PCR amplification products were sent to the sequencing company, and the library was built, sequenced and bioinformatics analyzed on the Illumiana MiSeq platform (PE300, 2×300bp). The DADA2 denoising method was used in QIME2 to remove low-quality reads, primers, barcode sequences and chimeric sequences, and amplicon sequence variants (ASV) were used for subsequent analysis. The Ribosomal Database Project (RDP) program (http: / / rdp.cme.msu.edu / ) was used for species annotation. Only the sequence of Halobacterivorax was retained for subsequent statistical analysis.

[0039] 3. Analyze the characteristics of the microbial community structure in the water samples. The diversity characteristics of Halobacteriovorax obtained based on the taxonomic statistical results are as follows: Figure 1 The horizontal axes of SP, SU, FA and WI refer to spring, summer, autumn and winter respectively; the horizontal axes of LS, MS and HS refer to low salinity, medium salinity and high salinity areas respectively; the vertical axes refer to the abbreviations of different subtypes of Halobacterivorax.

[0040] 4. Determine the diversity characteristics of Halobacteriovorax. The results are shown in Figure 1 , a total of 12 subclasses of Halobacterivorax (XIII, XI, X, V, PVI, PIV, PIII, IX, IV, III, BGII, BGI) were found in the samples. Among them, the diversity of Halobacteriovorax in low-salinity environments was lower than that in medium-salinity and high-salinity environments; the dominant groups of Halobacteriovorax in different seasons changed with the change of seasons. In summary, the diversity characteristics of Halobacteriovorax showed significant differences in different seasons and salinity conditions.

[0041] It has been verified that the Halobacteriovorax primers have good specificity and can accurately classify the Halobacteriovorax in the test samples and the environment. The Halobacteriovorax primers are of great significance for quickly and efficiently realizing the detection and classification of Halobacteriovorax in samples from different environments.

[0042] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be appreciated that the above description should not be considered as a limitation of the present invention. After reading the above content, it will be apparent to those skilled in the art that various modifications and substitutions of the present invention will occur. Therefore, the protection scope of the present invention should be limited by the appended claims.

Claims

1. A primer set for detecting Halobacteriovorax, characterized in that: The primer set comprises two primers whose nucleotide sequences are shown as SEQ ID NOs. 1 and 2.

2. Use of the primer set as claimed in claim 1 in detecting Halobacteriovorax in the environment.

3. Use of the primer set as claimed in claim 1 in detecting the biodiversity of Halobacteriovorax in the environment.

4. A kit for detecting Halobacteriovorax, characterized in that: The kit comprises the primer set according to claim 1.

5. A method for detecting Halobacteriovorax based on high-throughput sequencing, characterized in that: The following steps are included: (1) Extracting genomic DNA from the sample to be tested; (2) using genomic DNA as a template and performing PCR amplification using the two primers described in claim 1; (3) construct a gene library for PCR amplification products and perform high-throughput sequencing; (4) Statistical analysis was performed on the sequencing data to obtain the detection results of Halobacteriovorax.

6. The detection method according to claim 5, characterized in that: The reaction system of the PCR amplification is 20 μL, including 10 μL Taq PCR StarMix, 1 μL genomic DNA, 0.5 μL of each of two primers, and 8 μL double distilled water.

7. The detection method according to claim 5, characterized in that: The reaction procedure of the PCR amplification was as follows: pre-denaturation at 95°C for 4 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, for a total of 35 cycles; and extension at 72°C for 5 min.

8. The detection method according to claim 5, characterized in that: The detection result of step (4) includes the presence or absence of Halobacteriovorax and biodiversity detection.

Images