Method for rapidly detecting mycoplasma synoviae based on fluorescent quantitative PCR (Polymerase Chain Reaction)

Abstract

The invention discloses a method for rapidly detecting mycoplasma synoviae based on fluorescent quantitative PCR (Polymerase Chain Reaction). The method specifically comprises the following steps: (1) extracting DNA (Deoxyribose Nucleic Acid); (2) preparing a reaction system; (3) setting and operating a reaction program; and (4) testing results and judging. According to the method for rapidly detecting the mycoplasma synoviae based on the fluorescent quantitative PCR, a PCR reaction program of a reaction system is creatively set as follows: pre-denaturation is performed at 95 DEG C for 20 s; according to the present invention, with the program setting, the chicken mycoplasma synoviae detection time is shortened by about 40% compared with the commercially available kit and the commercial standard program, the time cost is saved, the detection efficiency is substantially improved, and the detection method has advantages of high sensitivity, good repeatability, reliable detection result and the like, and can be used for the detection of the chicken mycoplasma synoviae. The method can be used for clinical diagnosis of MS and monitoring of epidemic conditions.

Description

Technical Field

[0001] The invention belongs to the technical field of mycoplasma detection, and particularly relates to a method for rapid detection of chicken synoviae Mycoplasma based on fluorescent quantitative PCR. Background Art

[0002] Mycoplasma synoviae (MS) is a microorganism between bacteria and viruses, belonging to the genus Mycoplasma. It has no cell wall and has various shapes, mainly spherical or club-shaped, with a size of about 0.2-0.4μm. This microorganism can survive and reproduce in the body of chickens, causing damage to multiple tissues and organs of chickens, leading to an increase in the mortality rate of chickens, especially in the chick stage. Since chicks have weak resistance, they are often seriously ill after infection and have a relatively high mortality rate. At the same time, the growth and development of infected chickens are retarded, which prolongs the time for chickens to reach market weight and increases the cost of feeding. For laying hens, the decline in egg-laying performance directly affects the economic benefits of the chicken farm. Moreover, this pathogen is easy to exist in the flock for a long time and is difficult to completely eliminate. It will continue to threaten the health and production of the flock. Therefore, it is necessary to conduct regular mycoplasma testing on the breeder flock.

[0003] The detection methods of chicken synoviae Mycoplasma include serological detection methods, pathogen isolation and culture methods, and molecular biological detection methods. Among the molecular biological detection methods, fluorescent quantitative PCR is one of the common detection methods of chicken synoviae Mycoplasma. It has the following advantages: high sensitivity and specificity, quantitative analysis, good repeatability, etc. However, the fluorescent quantitative PCR amplification procedure in the prior art takes a long time, which reduces the overall detection efficiency, increases the detection cost, affects the accuracy of the results, reduces the experimental throughput, is not conducive to real-time monitoring, and ultimately affects the quality of the data and the detection and analysis results. Summary of the invention

[0004] In view of the problems raised by the background technology, the present invention studies and designs a method for rapid detection of Mycoplasma synoviae based on fluorescent quantitative PCR, the purpose of which is to provide a method for rapid detection of Mycoplasma synoviae by shortening the fluorescent quantitative PCR amplification program time, improving the overall detection efficiency of Mycoplasma synoviae, reducing the detection cost, ensuring the accuracy of the results, and performing real-time monitoring.

[0005] The technical solution of the present invention: The method for rapid detection of Mycoplasma synoviae based on fluorescent quantitative PCR specifically comprises the following steps: 1. DNA extraction The chicken joint fluid is drawn into a sterile centrifuge tube using a sterile syringe and centrifuged in a microcentrifuge. After centrifugation, the supernatant is removed, and a DNA extraction reagent is added to the precipitate in the sterile centrifuge tube to extract pure template DNA, which is temporarily stored for later use. 2. Preparation of reaction system In an ice box, add 10 μL of pre-cooled PCR premix, 0.8-2 μL of 1 μmol / L PCR primer, 0.2-1 μL of 0.5 μmol / L PCR probe, 1-5 μL template DNA, and 1-3 μL double distilled water to a clean PCR tube, mix well, and prepare a reaction system. Place it in an ice box for temporary storage. 3. Set up and run the reaction program Centrifuge the PCR tube containing the reaction system prepared in step (ii) and place it in a fluorescent quantitative PCR instrument. Set the PCR reaction program as follows: pre-denaturation at 95°C for 20 seconds; denaturation at 95°C for 1 second, annealing at 60°C for 20 seconds, and 40 cycles; (IV) Test results and judgment The PCR instrument collects the fluorescence signals of the above cycles, draws the amplification curve, and sets positive and negative controls to determine the results.

[0006] Preferably, in step (i), the speed of the microcentrifuge is 13500 rpm, the centrifugation time is 15 min, and the temperature at which the pure DNA is temporarily stored is -20°C.

[0007] Preferably, the DNA extraction reagent in step (i) is a commercially available magnetic bead DNA extraction kit.

[0008] Preferably, in step (ii), the volume of the PCR premix is ​​10 μL, the volume of the PCR primer is 2 μL, the volume of the PCR probe is 1 μL, the volume of the template DNA is 5 μL, and the volume of double distilled water is 2 μL.

[0009] Preferably, the PCR master mix in step (ii) is a commercially available Animal Detection U+ Probe Master Mix that is compatible with the rapid procedure.

[0010] Preferably, the PCR primers include 1 μL of PCR forward primer and 1 μL of PCR reverse primer, the sequence of the PCR forward primer is CTAAATACAATAGCCCAAGGCAA, and the sequence of the PCR reverse primer is CCTCCTTTCTTACGGAGTACA.

[0011] Preferably, the sequence of the PCR probe is 5'-FAM-AGCGATACACAACCGCTTTTAGAAT-BHQ1-3'.

[0012] Preferably, in step (iii), the centrifugal speed is 1500 rpm and the centrifugal time is 2 min.

[0013] The beneficial effects of the present invention are as follows: the method for rapidly detecting Mycoplasma synoviae based on fluorescent quantitative PCR of the present invention creatively sets the PCR reaction program of the reaction system as follows: pre-denaturation at 95°C for 20s; denaturation at 95°C for 1s, annealing at 60°C for 20s, and 40 cycles. The program setting not only shortens the detection time of Mycoplasma synoviae by about 40% compared with commercially available kits and industry standard programs, thus saving time and cost, and greatly improving the detection efficiency. Meanwhile, the detection method of the present invention has the advantages of high sensitivity, good repeatability, reliable detection results, and the like, and can be used for clinical diagnosis of MS and monitoring of epidemic conditions. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is the amplification curve diagram in Example 1 of the present invention; Figure 2 is the amplification curve diagram of Example 2 (commercially available kit); Figure 3 This is the amplification curve of Example 3 (industry standard). DETAILED DESCRIPTION

[0015] The present invention is further described below in conjunction with the accompanying drawings, specific embodiments and clinical sample testing.

[0016] Example 1 The method for rapid detection of Mycoplasma synoviae based on fluorescent quantitative PCR specifically comprises the following steps: 1. DNA extraction Use a sterile syringe to extract the chicken joint fluid into a sterile centrifuge tube and centrifuge it in a microcentrifuge. The speed of the microcentrifuge is 13500rpm and the centrifugation time is 15min. After centrifugation, remove the supernatant and add a commercially available magnetic bead DNA extraction reagent to the precipitate in the sterile centrifuge tube to extract pure template DNA, which is temporarily stored at -20℃ for later use. 2. Preparation of reaction system In an ice box, add 10 μL of pre-cooled Animal Detection U+ ProbeMaster Mix premix compatible with the rapid procedure on the market, 2 μL of 1 μmol / L PCR primer, 1 μL of 0.5 μmol / L PCR probe, 5 μL template DNA, and 2 μL of double distilled water to a clean PCR tube, mix well while adding, and prepare a reaction system, which is temporarily stored in an ice box for later use. The PCR primers include 1 μL PCR forward primer and 1 μL PCR reverse primer. The sequence of the PCR forward primer is CTAAATACAATAGCCCAAGGCAA, the sequence of the PCR reverse primer is CCTCCTTTCTTACGGAGTACA, and the sequence of the PCR probe is 5'-FAM-AGCGATACACAACCGCTTTTAGAAT-BHQ1-3'; 3. Set up and run the reaction program Centrifuge the PCR tube containing the reaction system prepared in step (ii) and place it in a fluorescent quantitative PCR instrument. Set the PCR reaction program as follows: pre-denaturation at 95°C for 20 seconds; denaturation at 95°C for 1 second, annealing at 60°C for 20 seconds, 40 cycles, with a centrifugal speed of 1500 rpm and a centrifugal time of 2 minutes. (IV) Test results and judgment The PCR instrument collects the fluorescence signals of the above cycles, draws the amplification curve, and sets positive and negative controls to determine the results.

[0017] Example 2 Only the reaction program of the commercially available kit was used in step (iii): 50°C for 2 min; 95°C for 3 min; 95°C for 15 s, 60°C for 30 s, 40 cycles, and the other steps were the same as in Example 1.

[0018] Example 3 Only in step (iii) the industry standard reaction procedure was used: pre-denaturation: 95°C, 3 min; denaturation: 95°C, 15 s, annealing and extension: 60°C, 30 s, and the other steps were the same as in Example 1.

[0019] Example 4 (Repeatability Test) Three groups of intra-group and inter-group controls were set up respectively, and the MS bacterial liquid titer / (ccu / ml) was directly used. After DNA was extracted, the optimal reaction procedure of the present invention (in Example 1) was adopted after multiple dilution. The specific test results are shown in Table 1 below.

[0020] Example 5 (Comparison of compliance rate of clinical sample testing) The detection method of the present invention, a commercially available kit, and an industry standard PCR method were used to detect clinical samples (all using the same sample source and sample number) to detect the infection of chicken synoviae Mycoplasma, thereby performing a comparison of the compliance rates of the detection method of the present invention. The detection results are shown in Table 2.

[0021] Table 1 Repeatability test results in Example 4 Table 2 Comparison results of the compliance rate in Example 5 As can be seen from Table 1, according to the optimal reaction procedure of the present invention (pre-denaturation at 95°C for 20s; denaturation at 95°C for 1s, annealing at 60°C for 20s, 40 cycles), the CV values ​​of the repeated tests between groups and the repeated tests within the group were both less than 2.17%, which fully demonstrates that the detection method of the present invention has good repeatability.

[0022] As can be seen from Table 2, for the same sample source and number of samples, the chicken synoviae Mycoplasma infection was detected, and the detection results of the detection method of the present invention were basically similar to those of the commercially available kit and the industry standard detection method, with a compliance rate of more than 85.7%, which fully demonstrates that the results of the present invention are highly reliable.

[0023] Depend on Figure 1~Figure 3 It can be seen that compared with commercially available kits and industry standard PCR methods, the detection method of the present invention has high sensitivity.

[0024] Therefore, the detection method of the present invention has the advantages of high sensitivity, good repeatability, and reliable detection results. In summary, the method for rapid detection of Mycoplasma synoviae based on fluorescent quantitative PCR of the present invention creatively sets the PCR reaction program of the reaction system as follows: pre-denaturation at 95°C for 20s; denaturation at 95°C for 1s, annealing at 60°C for 20s, and 40 cycles. This program setting not only shortens the detection time of Mycoplasma synoviae (about 30min) by about 40% compared with the commercially available kit (55min) and the industry standard (52min) program, but also saves time and cost, greatly improves the detection efficiency, and can be used for the clinical diagnosis of MS and the monitoring of the epidemic situation.

Claims

1. A method for rapid detection of Mycoplasma synoviae based on fluorescent quantitative PCR, characterized in that: The specific steps include:

1. DNA extraction The chicken joint fluid is drawn into a sterile centrifuge tube using a sterile syringe and centrifuged in a microcentrifuge. After centrifugation, the supernatant is removed, and a DNA extraction reagent is added to the precipitate in the sterile centrifuge tube to extract pure template DNA, which is temporarily stored for later use.

2. Preparation of reaction system In an ice box, add 10 μL of pre-cooled PCR premix, 0.8-2 μL of 1 μmol / L PCR primer, 0.2-1 μL of 0.5 μmol / L PCR probe, 1-5 μL template DNA, and 1-3 μL double distilled water to a clean PCR tube, mix well, and prepare a reaction system. Place it in an ice box for temporary storage.

3. Set up and run the reaction program Centrifuge the PCR tube containing the reaction system prepared in step (ii) and place it in a fluorescent quantitative PCR instrument. Set the PCR reaction program as follows: pre-denaturation at 95°C for 20 seconds; denaturation at 95°C for 1 second, annealing at 60°C for 20 seconds, and 40 cycles; (IV) Test results and judgment The PCR instrument collects the fluorescence signals of the above cycles, draws the amplification curve, and sets positive and negative controls to determine the results.

2. The method for rapid detection of Mycoplasma synoviae based on fluorescent quantitative PCR as claimed in claim 1, characterized in that: In the step (i), the speed of the microcentrifuge is 13500 rpm, the centrifugation time is 15 min, and the temperature at which the purified DNA is temporarily stored is -20°C.

3. The method for rapid detection of Mycoplasma synoviae based on fluorescent quantitative PCR as claimed in claim 1, characterized in that: The DNA extraction reagent in step (i) is a commercially available magnetic bead DNA extraction kit.

4. The method for rapid detection of Mycoplasma synoviae based on fluorescent quantitative PCR as claimed in claim 1, characterized in that: In step (ii), the volume of the PCR premix is ​​10 μL, the volume of the PCR primer is 2 μL, the volume of the PCR probe is 1 μL, the volume of the template DNA is 5 μL, and the volume of double distilled water is 2 μL.

5. The method for rapid detection of Mycoplasma synoviae based on fluorescent quantitative PCR as claimed in claim 1, characterized in that: The PCR premix in step (ii) is the commercially available Animal Detection U+ ProbeMaster Mix that is compatible with the rapid procedure.

6. The method for rapid detection of Mycoplasma synoviae based on fluorescent quantitative PCR as claimed in claim 1, characterized in that: The PCR primers include 1 μL of PCR forward primer and 1 μL of PCR reverse primer. The sequence of the PCR forward primer is CTAAATACAATAGCCCAAGGCAA, and the sequence of the PCR reverse primer is CCTCCTTTCTTACGGAGTACA.

7. The method for rapid detection of Mycoplasma synoviae based on fluorescent quantitative PCR as claimed in claim 1, characterized in that: The sequence of the PCR probe is 5'-FAM-AGCGATACACAACCGCTTTTAGAAT-BHQ1-3'.

8. The method for rapid detection of Mycoplasma synoviae based on fluorescent quantitative PCR as claimed in claim 1, characterized in that: In the step (iii), the centrifugal speed is 1500 rpm and the centrifugal time is 2 min.

Images