Method for identifying largehead atractylodes rhizome provenance by using EST-SSR (expressed sequence tag-simple sequence repeat) primer

Abstract

The invention discloses a method for identifying largehead atractylodes rhizome provenance by using EST-SSR (expressed sequence tag-simple sequence repeat) primers, and relates to the technical field of molecular markers in molecular biology. According to the method for distinguishing the seed sources of the bighead atractylodes rhizome by using the EST-SSR primers, the bighead atractylodes rhizome can be rapidly and effectively distinguished, the identification result is not easily influenced by the environment, the bighead atractylodes rhizome can be effectively distinguished through tissue samples at the seedling stage of the bighead atractylodes rhizome, and planting enterprises and farmers can be prevented from suffering from heavy loss caused by planting wrong varieties.

Description

Technical Field

[0001] The invention relates to the technical field of molecular markers in molecular biology, and in particular to a method for identifying the provenance of Atractylodes macrocephala by utilizing EST-SSR primers. Background Art

[0002] Atractylodes macrocephala Koidz., also known as Fuji, Yushu, Dongbaizhu, Xishu, etc., is a perennial herbaceous plant of the Asteraceae family. Its rhizomes are used as medicine. It is mainly distributed in mountain wetlands such as Zhejiang, Sichuan, Yunnan, and Guizhou. Among them, the ones produced in Yuqian, Zhejiang are of the best quality and are called "Yushu". They are one of the famous "Eight Flavors of Zhejiang". Atractylodes was first recorded in "Shennong's Herbal Classic", which says: "Atractylodes is bitter and warm in taste. It is used to treat wind-cold dampness, stiff muscles, spasms, jaundice, stop sweating, remove heat, digest food, and make fried bait. Long-term use will make you lighter and prolong your life without hunger. It is also called Shan, which grows in valleys." Therefore, it is listed as a top-grade product. Atractylodes is bitter and sweet in taste, warm in nature, and belongs to the spleen and stomach meridians. It has the effects of strengthening the spleen and replenishing qi, drying dampness and promoting diuresis, stopping sweating, and calming the fetus. It is mainly used for spleen deficiency, poor appetite, abdominal distension and diarrhea, phlegm and fluid, palpitations, edema, spontaneous sweating, and restless fetal movement. "Medical Origin" records that it "removes dampness and replenishes dryness, harmonizes the middle and replenishes qi, warms the middle, removes dampness from the spleen and stomach, removes stomach heat, strengthens the spleen and stomach, promotes diet, and stabilizes pregnancy." Modern research on Atractylodes macrocephala shows that it contains a variety of ingredients such as volatile oils, lipid compounds, polysaccharides, amino acids, and Atractylodes triols. It has the functions of protecting the liver, regulating gastrointestinal motility, anti-inflammatory response, anti-tumor, regulating the immune system, lowering blood sugar, and regulating immune metabolism. Therefore, the demand for Atractylodes macrocephala has been increasing in recent years, and its development and utilization prospects are broad. However, in the process of production and cultivation, the application of Atractylodes macrocephala germplasm resources in different regions and even different farmers is chaotic, and the phenomenon of germplasm mixing is becoming increasingly serious. High-quality Atractylodes macrocephala germplasm resources are the basis for the selection and breeding of new varieties. Clarifying the categories of Atractylodes macrocephala germplasm resources with different genetic backgrounds and mastering the laws of their genetic diversity are the most important links in standardizing Atractylodes macrocephala cultivation and the selection and breeding of excellent varieties.

[0003] In the prior art, a patent application with publication number CN104531838A discloses a PCR identification kit and an identification method for Atractylodes macrocephala, wherein the specific primers in the kit are ZBZ1 and ZBZ2. The invention provides a method for rapid and accurate identification of Atractylodes macrocephala, which can be widely used in the selection and breeding of Atractylodes macrocephala in traditional Chinese medicine. A patent application with publication number CN104774948A discloses a PCR identification kit and an identification method for Atractylodes macrocephala in Hebei, wherein the specific primers in the kit are HBZ1 and HBZ2. The invention provides a method for rapid and accurate identification of Atractylodes macrocephala in Hebei, which can be widely used in the selection and breeding of Atractylodes macrocephala in Hebei. However, the above invention can only identify the identification of specific Atractylodes macrocephala, but cannot perform molecular identification of whether multiple Atractylodes macrocephala are from the same source.

[0004] EST-SSR molecular markers (expressed sequence tag-Simple sequence repeats) are designed based on expressed sequence tags. In addition to the advantages of conventional SSR markers, such as co-dominance, conforming to Mendelian inheritance patterns, high repeatability and reliability, they also have the advantages of high sequence conservation and good universality between different species of the same genus, making them widely used in variety identification. However, there is currently no effective molecular identification method for Atractylodes macrocephala seed provenance, so it is necessary to establish a molecular method for rapid and accurate identification of Atractylodes macrocephala seed provenance. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings of the above-mentioned prior art. The present invention provides a method for analyzing the genetic diversity of Atractylodes macrocephala using EST-SSR primers to identify different provenances of Atractylodes macrocephala, which can quickly and effectively identify different provenances of Atractylodes macrocephala. This method uses common primers for amplification and agarose gel electrophoresis for detection, which is more economical and easy to operate compared with the capillary electrophoresis detection method of fluorescent labeled primers.

[0006] In order to achieve the above-mentioned purpose, the specific technical scheme of the present invention is as follows:

[0007] An EST-SSR primer for identifying Atractylodes macrocephala, comprising 10 pairs of primers, namely: SSR01, SSR02, SSR03, SSR04, SSR05, SSR06, SSR07, SSR08, SSR09, SSR10, and the sequences are as follows:

[0008] SSR01-F: GGGGATTACTGAAAATGACC,

[0009] SSR01-R: GTAGCAGTCACCAGTCAGGA;

[0010] SSR02-F: CAGTATCAAAGCCGACGAAT,

[0011] SSR02-R:CCCACATAGGAAGGAGAACA;

[0012] SSR03-F:GGAAGTGGTATGGATGGGTT,

[0013] SSR03-R: AAGTTTCGCTTTACGCTCG;

[0014] SSR04-F: CAGTATCAAAGCCGACGAAT,

[0015] SSR04-R:CCCACATAGGAAGGAGAACA;

[0016] SSR05-F:CATCATTGTAGATGCCAGAT,

[0017] SSR05-R: CCAAGGAAAGGAAAAGTAGA;

[0018] SSR06-F: GGACAACATTTCATCAGGGA,

[0019] SSR06-R: TGGCGTCATTCTCGTCTTCA;

[0020] SSR07-F: CACTGCCATTCCACATTCTC,

[0021] SSR07-R: GACTCGGTTTGACCCAGACT;

[0022] SSR08-F:TCTAAAAAGCCCTACCGTCT,

[0023] SSR08-R:ATGTAGCCTTCCTCGTCCTT;

[0024] SSR09-F:GGGGGTCTATTCAGAAACAA,

[0025] SSR09-R:ATACAATGTCAGGTTGCCAC;

[0026] SSR10-F:GGAGTAACACCTCAACACCA,

[0027] SSR10-R: TAACAAATAGAACTGCCCAA.

[0028] The present invention also provides the application of the EST-SSR primers in identifying the provenance of Atractylodes macrocephala.

[0029] The present invention also provides a kit for identifying the provenance of Atractylodes macrocephala, comprising the EST-SSR primers.

[0030] The present invention also provides a method for identifying the provenance of Atractylodes macrocephala using EST-SSR primers, comprising the following steps:

[0031] (1) Extracting DNA from the sample to be identified;

[0032] (2) using the DNA obtained in step (1) as a template, and performing PCR amplification using the EST-SSR primers for identifying Atractylodes macrocephala to obtain an amplified product;

[0033] (3) The amplified product obtained in step (2) is subjected to electrophoresis detection to detect the band pattern of the amplified product and compare it with the standard band pattern of known Atractylodes macrocephala. The Atractylodes macrocephala with the same band pattern of all 10 pairs of primers is the same Atractylodes macrocephala, thereby determining the variety of the sample to be identified.

[0034] Preferably, during the detection in step (2), each pair of primers is detected separately once.

[0035] Specifically, when each pair of primers was tested separately, the PCR amplification system was: 1 μL template, 5 μL 2×PCR Mix, 1 μL upstream primer, 1 μL downstream primer, 2 μL ddH 2 O.

[0036] When each pair of primers was tested separately, the PCR amplification program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, for a total of 32 cycles; extension at 72°C for 10 min; and hold at 4°C.

[0037] The present invention also provides a method for analyzing the genetic relationship of Atractylodes macrocephala using EST-SSR primers, comprising the following steps:

[0038] (1) Extracting DNA from samples to be analyzed;

[0039] (2) using the DNA obtained in step (1) as a template, and performing PCR amplification using the EST-SSR primers for identifying the provenance of Atractylodes macrocephala to obtain an amplified product;

[0040] (3) Performing electrophoresis on the amplified product obtained in step (2) to detect the band pattern of the amplified product, and comparing the band patterns of the samples to be analyzed. The fewer the number of different band patterns among the 10 pairs of primers, the closer the genetic relationship between the Atractylodes macrocephala to be analyzed, and the more the number of different band patterns among the 10 pairs of primers, the more distant the genetic relationship between the Atractylodes macrocephala to be analyzed.

[0041] Preferably, during the detection in step (2), each pair of primers is detected separately once.

[0042] Specifically, when each pair of primers was tested separately, the PCR amplification system was: 1 μL template, 5 μL 2×PCR Mix, 1 μL upstream primer, 1 μL downstream primer, 2 μL ddH 2 O;

[0043] When each pair of primers was tested separately, the PCR amplification program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, for a total of 32 cycles; extension at 72°C for 10 min; and hold at 4°C.

[0044] Beneficial effects of the present invention:

[0045] The present invention provides an EST-SSR primer for identifying Atractylodes macrocephala provenance. The primer can be used to quickly and effectively identify Atractylodes macrocephala provenance, and the identification result is not easily affected by the environment. The Atractylodes macrocephala can be effectively distinguished through tissue samples at the seedling stage, so that planting enterprises and farmers can avoid heavy losses caused by planting wrong varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 This is the result of PCR amplification and electrophoresis detection of 64 samples of Atractylodes macrocephala using EST-SSR primer SSR01;

[0047] Figure 2 This is the result of PCR amplification and electrophoresis detection of 64 samples of Atractylodes macrocephala using EST-SSR primer SSR02;

[0048] Figure 3 This is the result of PCR amplification and electrophoresis detection of 64 samples of Atractylodes macrocephala using EST-SSR primer SSR03;

[0049] Figure 4 This is the result of PCR amplification and electrophoresis detection of 64 samples of Atractylodes macrocephala using EST-SSR primer SSR04;

[0050] Figure 5 This is the result of PCR amplification and electrophoresis detection of 64 samples of Atractylodes macrocephala using EST-SSR primer SSR05;

[0051] Figure 6 This is the result of PCR amplification and electrophoresis detection of 64 samples of Atractylodes macrocephala using EST-SSR primer SSR06;

[0052] Figure 7 This is the result of PCR amplification and electrophoresis detection of 64 samples of Atractylodes macrocephala using EST-SSR primer SSR07;

[0053] Figure 8 This is the result of PCR amplification and electrophoresis detection of 64 samples of Atractylodes macrocephala using EST-SSR primer SSR08;

[0054] Fig. 9 This is the result of PCR amplification and electrophoresis detection of 64 samples of Atractylodes macrocephala using EST-SSR primer SSR09;

[0055] Fig.10 This is the result of PCR amplification and electrophoresis detection of 64 samples of Atractylodes macrocephala using EST-SSR primer SSR10;

[0056] Fig.11This is a tree diagram of the kinship among 64 Atractylodes samples; yellow: Pan'an County, Zhejiang Province; light green: Xinchang County, Zhejiang Province; green: Lin'an City, Zhejiang Province; light blue: Tiantai County, Zhejiang Province; red: Dancheng County, Henan Province; orange: Qiaocheng District, Bozhou City, Anhui Province; dark blue: Xianfeng County, Hubei Province; dark red: Pingjiang County, Hunan Province. DETAILED DESCRIPTION

[0057] Example 1

[0058] In this embodiment, 8 Atractylodes macrocephala strains with a total of 64 Atractylodes macrocephala samples were first selected. The specific Atractylodes macrocephala sampling materials are shown in Table 1, with 8 samples for each strain. The sampling method and sample preservation method all adopt the existing technology, which will not be described in detail here.

[0059] Table 1 Atractylodes macrocephala sample information

[0060] Serial number Material serial number Origin PA-1~PA-8 Atractylodes macrocephala PA Pan'an County, Zhejiang Province LA-1~LA-8 Atractylodes macrocephala LA Lin'an City, Zhejiang Province XC-1~XC-8 Atractylodes macrocephala XC Xinchang County, Zhejiang Province TT-1~TT-8 Atractylodes macrocephala TT Tiantai County, Zhejiang Province QC-1~QC-8 Atractylodes macrocephala QC Qiaocheng District, Bozhou City, Anhui Province HC-1~HC-8 Atractylodes macrocephala HC Dancheng County, Henan Province PJ-1~PJ-8 Atractylodes macrocephala PJ Pingjiang County, Hunan Province XF-1~XF-8 Atractylodes macrocephala XF Xianfeng County, Hubei Province

[0061] Extract DNA from the tested Atractylodes macrocephala samples.

[0062] In this example, the total genomic DNA was extracted from fresh leaves of Atractylodes macrocephala using the improved CTAB method, and the specific steps were as follows:

[0063] 1) Take 2-3 fresh and intact Atractylodes macrocephala leaves (about 0.5-1.5g);

[0064] 2) After cutting off the main vein of the leaf and chopping it into pieces, place the material in a clean mortar, add an appropriate amount of liquid nitrogen and quickly grind it several times into fine powder. Then use a medicine spoon to quickly scrape the powder and transfer it to a 1.5 mL round-bottom centrifuge tube containing 800 μL CTAB: β-mercaptoethanol (20:1, V / V) preheated at 65°C. Cover the centrifuge tube cap and seal it with a sealing film.

[0065] 3) Immediately place the sample in a 65°C water bath for heating, take it out and shake it every 5 minutes to ensure that the sample is in full contact with the extract, and take it out after 20 minutes to obtain a mixed solution;

[0066] 4) Cool to room temperature, add an equal volume (800 μL) of chloroform:isoamyl alcohol (24:1, V / V), mix well (slowly invert) for 15-30 min, and centrifuge at 12000 rpm for 8 min at room temperature;

[0067] 5) Pipette 600 μL of the supernatant into a new 1.5 mL conical centrifuge tube, add an equal amount of chloroform: isoamyl alcohol (24:1, V / V), and mix gently;

[0068] 6) Centrifuge at 12000 rpm for 8 min at room temperature, take out the supernatant, put 400 μL into a new 1.5 mL pointed centrifuge tube, add an equal volume of -20°C pre-cooled isopropanol, shake gently, and leave for 3 h or overnight; centrifuge at 12000 rpm for 3 min to allow the DNA to adhere to the bottom of the centrifuge tube, and discard the aqueous phase;

[0069] 7) Add 75% ethanol to rinse 2-3 times, wash once with anhydrous ethanol, remove the ethanol, then open the lid of the 1.5 mL conical bottom centrifuge tube, invert it on a tilted cardboard covered with absorbent paper, and air-dry at room temperature for about 1-2 hours;

[0070] 8) Dissolve the DNA precipitate with 100 μL 1×TE buffer and mix thoroughly by tapping regularly with tweezers to obtain the required DNA crude extract solution. The concentration and purity of the DNA crude extract solution are measured by UV spectrophotometer in the microplate reader. Prepare the labeled DNA crude extract solutions of each sample into working solutions with a concentration of about 100 ng / μL. Store at 4°C for later use.

[0071] 9) The purity of the crude DNA extract was determined by an ELISA instrument and detected by 1.5% agarose gel electrophoresis, with DL2000bp Marker as the standard molecular weight.

[0072] Example 2

[0073] EST-SSR primers were used for PCR amplification.

[0074] There are 10 pairs of EST-SSR primers, and their sequences are shown in Table 2. The SSR markers amplified by the EST-SSR primers are: SSR01, SSR02, SSR03, SSR04, SSR05, SSR06, SSR07, SSR08, SSR09, SSR10, and their sequences are shown in SEQ ID NOs. 21 to 30, respectively.

[0075] Table 210 pairs of EST-SSR primers

[0076] Primer name Forward primer (5'-3') Reverse primer (3'-5') Annealing temperature SSR01 GGGGATTACTGAAAATGACC GTAGCAGTCACCAGTCAGGA 53℃ SSR02 CAGTATCAAAGCCGACGAAT CCCACATAGGAAGGAGAACA 53℃ SSR03 GGAAGTGGTATGGATGGGTT AAGTTTCGCTTTACGCTCG 53℃ SSR04 CAGTATCAAAGCCGACGAAT CCCACATAGGAAGGAGAACA 53℃ SSR05 CATCATTGTAGATGCCAGAT CCAAGGAAAGGAAAAGTAGA 53℃ SSR06 GGACAACATTTCATCAGGGA TGGCGTCATTCTCGTCTTCA 53℃ SSR07 CACTGCCATTCCACATTCTC GACTCGGTTTGACCCAGACT 53℃ SSR08 TCTAAAAAGCCCTACCGTCT ATGTAGCCTTCCTCGTCCTT 53℃ SSR09 GGGGGTCTATTCAGAAACAA ATACAATGTCAGGTTGCCAC 53℃ SSR10 GGAGTAACACCTCAACACCA TAACAAATAGAACTGCCCAA 53℃

[0077] All PCR amplification reaction procedures were performed by a PCR amplification instrument, and the appropriate EST-SSR marker reaction system and procedure were screened out through optimization.

[0078] The reaction system is: 1 μL template, 5 μL 2×PCR Mix, 1 μL upstream primer F, 1 μL downstream primer R, 2 μL ddH 2 O.

[0079] The reaction procedure was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s, for a total of 32 cycles; extension at 72°C for 10 min; maintain at 4°C; after the PCR amplification reaction was completed, 2 μL of 1× Loading buffer was added, the mixture was mixed thoroughly on a vortex oscillator, and then placed in a 4°C refrigerator for later use.

[0080] Example 3

[0081] 1. Agarose gel electrophoresis analysis:

[0082] 1.5% agarose gel was used for electrophoresis separation in a horizontal electrophoresis tank with a medium of 1×TAE. DL2000bp Marker was used as a standard molecular weight marker fragment size. The electrophoresis product was recorded in a gel imager. The electrophoresis separation method was as follows: 5.0 μL of the PCR product with buffer added was loaded into the spotting well with a gun tip, and electrophoresis was performed at a constant voltage of 120V for 1 hour. The glass plate was placed in a gel imager for observation, and finally photographed and recorded. The results of PCR amplification electrophoresis of 64 samples of Atractylodes macrocephala with 10 pairs of primers are shown in Figures 1 to 10 .

[0083] 2. EST-SSR band analysis:

[0084] EST-SSR is a co-dominant marker. If the amplification products of the same primers for different templates have the same mobility under electrophoresis, they are considered to be the same site, that is, they have homology. Figures 1 to 10 The gel image data was interpreted by multiple people for comparison, and all electrophoresis bands were accurately read. Clear or weak bands were recorded as "1", and no bands were recorded as "0". If at least one of the 10 EST-SSR amplification products of two varieties of Atractylodes macrocephala has a different amplification band type, the two varieties are from different sources; if more than 6 of the 10 EST-SSR amplification products of two varieties of Atractylodes macrocephala have different amplification band types, the origins of the two varieties are far apart. As shown in Tables 3 and 4. After the band analysis is completed, all the results are input into the corresponding software according to the software format requirements for experimental data processing and statistics.

[0085] Table 3 Primer reading information of Atractylodes macrocephala samples (L1~L13)

[0086]

[0087]

[0088] Table 4 Primer reading information of Atractylodes macrocephala samples (L14~L23)

[0089]

[0090]

[0091] 3. Analysis of the relationship of 64 samples of Atractylodes macrocephala:

[0092] In this example, all 10 pairs of EST-SSR primers obtained good polymorphic amplification in the test samples. 64 Atractylodes macrocephala materials from different origins were analyzed using the genetic matrix and cluster analysis was performed using the unweighted group pair method (UPGMA) using NTSYS-pc 2.1 software. Fig.11 , a phylogenetic tree diagram of 64 Atractylodes materials was established. From the clustering results, the gene exchange of Atractylodes production populations in each production area was frequent, and the degree of mixing between the provenances was high. At a genetic distance of 0.84, the Atractylodes in Pan'an, Xinchang, Tiantai, and Lin'an, Zhejiang Province, can be roughly distinguished from the Atractylodes in other production areas; at a genetic distance of 0.72, the Atractylodes in Xianfeng County, Hubei Province can be distinguished from the Atractylodes in other production areas; the degree of mixing between the Atractylodes provenances in Qiaocheng District, Bozhou City, Anhui Province, Pingjiang County, Hunan Province, and Dancheng County, Henan Province is high and difficult to distinguish.

[0093] The embodiment of the present invention provides an application of the above method, and the EST-SSR band analysis is performed after PCR amplification with 10 pairs of EST-SSR primers to distinguish the provenance of the tested Atractylodes macrocephala, and the identification result is not easily affected by the age of the plant, and can more accurately distinguish the Atractylodes macrocephala in the seedling stage, and can quickly and effectively distinguish and identify the current cultivated species. It can prevent planting enterprises and farmers from suffering heavy losses from planting the wrong varieties, and the Atractylodes macrocephala EST-SSR fingerprint established based on the above method is of great significance.

Claims

1. An EST-SSR primer for identifying the provenance of Atractylodes macrocephala, characterized in that: It includes 10 pairs of primers, namely: SSR01, SSR02, SSR03, SSR04, SSR05, SSR06, SSR07, SSR08, SSR09, SSR10, SSR10, and the sequences are as follows: SSR01-F: GGGGATTACTGAAAATGACC, SSR01-R: GTAGCAGTCACCAGTCAGGA; SSR02-F: CAGTATCAAAGCCGACGAAT, SSR02-R:CCCACATAGGAAGGAGAACA; SSR03-F:GGAAGTGGTATGGATGGGTT, SSR03-R: AAGTTTCGCTTTACGCTCG; SSR04-F: CAGTATCAAAGCCGACGAAT, SSR04-R:CCCACATAGGAAGGAGAACA; SSR05-F:CATCATTGTAGATGCCAGAT, SSR05-R: CCAAGGAAAGGAAAAGTAGA; SSR06-F: GGACAACATTTCATCAGGGA, SSR06-R: TGGCGTCATTCTCGTCTTCA; SSR07-F: CACTGCCATTCCACATTCTC, SSR07-R: GACTCGGTTTGACCCAGACT; SSR08-F:TCTAAAAAGCCCTACCGTCT, SSR08-R:ATGTAGCCTTCCTCGTCCTT; SSR09-F:GGGGGTCTATTCAGAAACAA, SSR09-R:ATACAATGTCAGGTTGCCAC; SSR10-F:GGAGTAACACCTCAACACCA, SSR10-R: TAACAAATAGAACTGCCCAA.

2. Use of the EST-SSR primers described in claim 1 in identifying the provenance of Atractylodes macrocephala.

3. A kit for identifying the provenance of Atractylodes macrocephala, characterized in that: Including the EST-SSR primers described in claim 1.

4. A method for identifying the provenance of Atractylodes macrocephala using EST-SSR primers, characterized in that: The following steps are involved: (1) Extracting DNA from the sample to be identified; (2) using the DNA obtained in step (1) as a template, and performing PCR amplification using the EST-SSR primers for identifying Atractylodes macrocephala as described in claim 1 to obtain an amplified product; (3) The amplified product obtained in step (2) is subjected to electrophoresis detection to detect the band pattern of the amplified product and compare it with the standard band pattern of known Atractylodes macrocephala. The 10 primer pairs with the same band pattern are the same Atractylodes macrocephala, thereby determining the provenance of the sample to be identified.

5. The method for identifying the provenance of Atractylodes macrocephala using EST-SSR primers according to claim 4, characterized in that: During the detection in step (2), each pair of primers is detected once individually.

6. The method for identifying the provenance of Atractylodes macrocephala using EST-SSR primers according to claim 5, characterized in that: When each pair of primers was tested separately, the PCR amplification system was: 1 μL template, 5 μL 2×PCR Mix, 1 μL upstream primer, 1 μL downstream primer, and 2 μL ddH2O.

7. The method for identifying the provenance of Atractylodes macrocephala using EST-SSR primers according to claim 5, characterized in that: When each pair of primers was tested separately, the PCR amplification program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, for a total of 32 cycles; extension at 72°C for 10 min; and hold at 4°C.

8. A method for analyzing the provenance of Atractylodes macrocephala using EST-SSR primers, characterized in that: The following steps are involved: (1) Extracting DNA from samples to be analyzed; (2) using the DNA obtained in step (1) as a template, and performing PCR amplification using the EST-SSR primers for identifying Atractylodes macrocephala as described in claim 1 to obtain an amplified product; (3) Performing electrophoresis on the amplified product obtained in step (2) to detect the band pattern of the amplified product, and comparing the band patterns of the samples to be analyzed. The fewer the number of different band patterns among the 10 pairs of primers, the closer the genetic relationship between the Atractylodes macrocephala to be analyzed, and the more the number of different band patterns among the 10 pairs of primers, the more distant the genetic relationship between the Atractylodes macrocephala to be analyzed.

9. The method for analyzing the provenance of Atractylodes macrocephala using EST-SSR primers according to claim 8, characterized in that: During the detection in step (2), each pair of primers is detected once individually.

10. The method for analyzing the provenance of Atractylodes macrocephala using EST-SSR primers according to claim 9, characterized in that: When each pair of primers was tested separately, the PCR amplification system was: 1 μL template, 5 μL 2×PCR Mix, 1 μL upstream primer, 1 μL downstream primer, and 2 μL ddH2O. When each pair of primers was tested separately, the PCR amplification program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, for a total of 32 cycles; extension at 72°C for 10 min; and hold at 4°C.

Images