Medical application of miR-497a-5p inhibitor

Abstract

The invention discloses application of a miR-497a-5p inhibitor in preparation of a medicine for preventing or treating liver diseases, and the miR-497a-5p gene can be used as a regulation target or a regulation marker in the medicine for preventing or treating the liver diseases. The liver diseases include non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), primary biliary cholangitis (PBC), primary sclerosing cholangitis (PSC), alcoholic fatty liver disease (AFLD), hepatic fibrosis, or cirrhosis. The invention proves that the miR-497a-5p inhibitor can be used for preventing or treating the liver diseases on an animal model of the liver related diseases.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to the application of a miR-497a-5p inhibitor in preparing a medicine for preventing or treating liver diseases. Background Art

[0002] Non-alcoholic fatty liver disease (NAFLD) is a clinical pathological syndrome characterized by fatty degeneration and lipid storage in hepatocytes (Nat. Rev. Drug. Discov. 2016, 15, 249). The disease spectrum of non-alcoholic fatty liver disease (NAFLD) includes: non-alcoholic simple fatty liver (NAFL), non-alcoholic steatohepatitis (NASH) and NASH-induced cirrhosis (Science 2011, 332, 1519). The recognized pathological mechanism is the "two-hit" hypothesis (J. Gastroenterol. Hepatol. 2013, 28 (SI 1), 68): the "first hit" is liver fat accumulation and insulin resistance; the "second hit" is the excessive release of oxidative stress and inflammatory cytokines caused by liver fat accumulation, leading to liver inflammation and liver fibrosis, and then to cirrhosis and liver cancer. At present, there is no effective clinical treatment for NASH (Med. Res. Rev. 2019, 39, 328).

[0003] Primary biliary cholangitis (PBC) and primary sclerosing cholangitis (PSC) are two common cholestatic liver diseases in clinical practice. Among them, PBC is characterized by intrahepatic cholestasis, the appearance of antimitochondrial antibodies in the circulating blood, and progressive, non-suppurative inflammatory destruction of small intrahepatic bile ducts, which eventually leads to extensive hepatic duct destruction, biliary cirrhosis and even liver failure. At present, the drugs approved for the treatment of PBC mainly include ursodeoxycholic acid, obeticholic acid, glucocorticoids and cyclosporine, etc. However, there are problems with the effectiveness and safety of the above drugs. PSC is also a chronic cholestatic disease characterized by progressive inflammation and fibrosis of the intrahepatic and extrahepatic bile ducts, which leads to multifocal bile duct stenosis. Most patients eventually develop cirrhosis, portal hypertension and liver decompensation. The exact pathological mechanism of PSC is unknown, and there is no effective treatment for PSC.

[0004] Alcoholic fatty liver disease (AFLD) is a liver disease caused by long-term heavy drinking and is a subtype of alcoholic liver disease. Patients have a long history of drinking, generally more than 5 years. Clinical symptoms are non-specific and may be asymptomatic or may include right upper abdominal distension and pain, loss of appetite, fatigue, weight loss, etc. Currently, there is no effective treatment for AFLD.

[0005] Liver fibrosis refers to the abnormal proliferation of connective tissue in the liver caused by various pathogenic factors. Any liver damage will cause liver fibrosis during the process of liver repair and healing. If the damaging factors cannot be removed for a long time, the fibrosis process will develop into cirrhosis. At present, there is no effective treatment for liver fibrosis and cirrhosis. The main prevention and treatment methods are early detection and prevention of disease progression, especially prevention and treatment of complications of cirrhosis.

[0006] miRNA, as a class of non-coding small molecule RNA with a length of about 22 nucleotides, is widely present in eukaryotes. It plays an important role in post-transcriptional regulation of genes by complementary pairing with the target mRNA 3'-UTR, degrading mRNA or repressing gene translation. miRNA has a wide range of regulatory functions in life activities and is closely related to life activities such as biological development, cell growth and differentiation, apoptosis and organ formation. In recent years, more and more miRNAs have been reported to be closely related to the occurrence and development of liver diseases such as NASH, PBC, PSC and liver fibrosis (Gut 2021, 70: 784; Curr. Protein Pept. Sc. 2022, 23: 369).

[0007] miR-497a-5p is a miRNA whose biological function remains to be clarified. miR-497a-5p has been reported to be associated with neuroinflammation caused by microglial activation, and its inhibitor can reduce the inflammatory response of BV2 cells induced by LPS (BrainBehav.2023, DOI: 10.1002 / brb3.2935). It has been reported that metformin can inhibit the expression of VEGF-A by upregulating miR-497a-5p, thereby slowing the occurrence of diabetic retinopathy (Am.J.Transl.Res.2018,9:5558). miR-497a-5p has also been reported to reduce LPS-induced acute lung injury by regulating the expression of IRAK2 (J.Cell.Physiol.2019,234:22874). However, the function and application of miR-497a-5p in the above-mentioned liver diseases are still unclear. Summary of the invention:

[0008] Purpose of the invention: To solve the defects and deficiencies of existing clinical treatment methods for preventing and treating liver diseases, the present invention, based on revealing the relationship between the expression of miR-497a-5p and liver diseases, provides a use of a miR-497a-5p inhibitor in the preparation of a drug for preventing or treating liver diseases, that is, a use of a miR-497a-5p inhibitor for preventing or treating liver diseases, and then applies the miR-497a-5p inhibitor to the prevention or treatment of liver diseases. The present invention is the first to discover that miR-497a-5p inhibitors have significant effects in preventing or treating liver diseases. Therefore, the miR-497a-5p inhibitor is an effective ingredient and has important social and economic significance in the preparation of drugs or reagents for preventing or treating liver diseases.

[0009] Technical solution: In order to achieve the above-mentioned purpose, the miR-497a-5p inhibitor of the present invention is used in the preparation of a drug for preventing or treating liver diseases, and the sequence (RNA) of the miR-497a-5p is: CAGCAGCACACUGUGGUUUGU.

[0010] Among them, the inhibitors include gene editing reagents that specifically knock out the miR-497a-5p gene, interfering molecules that specifically interfere with the expression of the miR-497a-5p gene, small molecule compounds that specifically inhibit the miR-497a-5p gene expression protein, antibodies or ligands that specifically bind to the miR-497a-5p gene expression protein, or antibodies or ligands that specifically bind to polypeptides targeting the miR-497a-5p gene.

[0011] Among them, the inhibitor is selected from nucleic acid products that can reduce the expression or activity of miR-497a-5p, including small interfering RNA, dsRNA, shRNA, microRNA, antisense nucleotides; or a construct that can express or form the small interfering RNA, dsRNA, shRNA, microRNA, antisense nucleotides; the small interfering RNA, dsRNA, shRNA, microRNA, antisense nucleotides can be methylated, thiolated and cholesterol-modified.

[0012] Furthermore, the inhibitor is an adeno-associated virus carrying miR-497a-5p sponge, and miR-497a-5p sponge contains one or more antagonistic sequences.

[0013] Furthermore, the miR-497a-5p inhibitor comprises at least one antagonist sequence (RNA): ACAAACCACAGUGUGCUGCUG, and preferably may carry four repeats of the above antagonist sequence.

[0014] Preferably, the miR-497a-5p inhibitor is AAV8-miR497a-5p sponge, which contains one to four identical repeated antagonistic sequences ACAAACCACAGUGUGCUGCUG.

[0015] Among them, the liver diseases include non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), primary biliary cholangitis (PBC), primary sclerosing cholangitis (PSC), alcoholic fatty liver disease (AFLD), liver fibrosis or cirrhosis.

[0016] The drug for preventing or treating liver diseases of the present invention comprises a miR-497a-5p inhibitor and a drug carrier encapsulating the inhibitor.

[0017] The drug carrier may be a lipid, a liposome, a lipid complex, a lipid nanoparticle, a polymer compound, a peptide, a protein, a cell, a nanoparticle mimetic, a nanotube or a conjugate.

[0018] The miR-497a-5p gene or the polypeptide targeting the miR-497a-5p gene of the present invention is used as a regulatory target or a regulatory marker in a drug for preventing or treating liver diseases.

[0019] Among them, the liver diseases include non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), primary biliary cholangitis (PBC), primary sclerosing cholangitis (PSC), alcoholic fatty liver disease (AFLD), liver fibrosis or cirrhosis.

[0020] The present invention has found that in the liver of various NASH disease animal models, the expression level of miR-497a-5p is abnormally increased. On this basis, the present invention has found that administering miR-497a-5p inhibitors to NASH model mice can effectively reverse liver lipid accumulation, inflammatory response and fibrosis, and improve liver function. In terms of mechanism of action, the present invention has found that miR-497a-5p can reduce the level of ERRα protein in the liver of NASH model mice by intervening in the translation of ERRα mRNA. The downregulation of ERRα protein levels has been reported to be closely related to the occurrence and development of various liver diseases (CN113117097A). The present invention has found that administering miR-497a-5p inhibitors can effectively reverse the downregulation of ERRα protein levels in the liver of NASH model mice, thereby exerting a therapeutic effect. In short, miR-497a-5p inhibitors can prevent and treat various liver diseases by reversing the downregulation of ERRα protein levels.

[0021] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0022] The present invention discovers for the first time that miR-497a-5p inhibitors are significantly effective in preventing or treating liver diseases, which is mainly reflected in that by administering miR-497a-5p inhibitors, lipid accumulation in the liver can be reduced, liver damage can be improved, and liver inflammation and fibrosis can be reduced, and thus, miR-497a-5p inhibitors can be used to prevent and treat various liver diseases.

[0023] In terms of mechanism of action,

[0024] The present invention provides a miR-497a-5p gene as a new target for liver disease intervention, so that the miR-497a-5p inhibitor synthesized by the present invention can be used in the preparation of drugs for preventing or treating liver diseases. The miR-497a-5p inhibitor can upregulate the protein level of ERRα by inhibiting miR-497a-5p, thereby exerting biological effects such as regulating mitochondrial synthesis, oxidative metabolism, inflammatory immunity, and cell autophagy, and ultimately improving the pathological characteristics of various liver diseases. The pharmaceutical composition including the miR-497a-5p inhibitor of the present invention can become a new drug for preventing and / or treating liver and kidney diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The level of miR-497a-5p in the liver of NASH model mice was significantly upregulated (n=6, compared with the ND group ***p<0.001);

[0026] Figure 2 Figure 3 Effects of inhibiting miR-497a-5p on liver weight, liver triglyceride and liver cholesterol in HF-CDAA-induced NASH model mice (n=8, compared with ND+Mock sponge ### p<0.001; *p<0.01, ***p<0.001 compared with HF-CDAA+Mock sponge);

[0027] Figure 3 HE staining and oil red staining of liver of HF-CDAA-induced NASH model mice to inhibit miR-497a-5p;

[0028] Figure 4 Figure 3 Effect of inhibiting miR-497a-5p on serum transaminases in HF-CDAA-induced NASH model mice (n=8, compared with ND+Mock sponge ### p<0.001; ***p<0.001 compared with HF-CDAA+Mock sponge);

[0029] Figure 5Figure 3 shows the effect of inhibiting miR-497a-5p on genes related to liver inflammation in HF-CDAA-induced NASH model mice (n=8, compared with ND+Mock sponge # p<0.05, ## p<0.01, ### p<0.001; *p<0.05, **p<0.01, ***p<0.001 compared with HF-CDAA+Mock sponge);

[0030] Figure 6 Figure 3 shows the effect of inhibiting miR-497a-5p on liver fibrosis-related genes in HF-CDAA-induced NASH model mice (n=8, compared with ND+Mock sponge ### p<0.001; **p<0.01, ***p<0.001 compared with HF-CDAA+Mock sponge);

[0031] Figure 7 This is a graph showing the effect of transfection of miR-497a-5p mimic on ERRα protein level in AML12 cells;

[0032] Figure 8 Figure 3 Effect of inhibiting miR-497a-5p on the level of ERRα protein in the liver of HF-CDAA-induced NASH model mice (n=8, compared with ND+Mock sponge ### p<0.001; **p<0.01 compared with HF-CDAA+Mock sponge). DETAILED DESCRIPTION

[0033] The present invention is further described below in conjunction with specific embodiments, which are only used to explain the present invention and cannot be understood as limiting the present invention. It can be understood by those skilled in the art that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and purpose of the present invention, and the scope of the present invention is defined by the claims and their equivalents.

[0034] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent companies unless otherwise specified.

[0035] Example 1

[0036] The level of miR-497a-5p in the liver of NASH model mice was significantly upregulated

[0037] The qPCR method was used to detect the expression level of miR-497a-5p in the liver of NASH model mice.

[0038] Animal modeling: (1) High-fat and high-sugar diet (HFHSD)-induced NASH model in mice: 4-week-old C57BL / 6J male mice (purchased from Beijing Weitong Lihua) were divided into two groups. The mice in the model group were given model diet (40% fat, 20% fructose, 2% cholesterol), and the mice in the control group were given low-calorie control diet (purchased from Trofi Feed Technology Co., Ltd.). The modeling lasted for 20 weeks, and the mice had free access to food and water during the modeling period. (2) High-fat combined with choline-deficient protein amino acid restricted diet (HF-CDAA)-induced NASH model in mice: 8-week-old C57BL / 6J male mice (purchased from Beijing Weitong Lihua) were divided into two groups. The mice in the model group were given model diet (Trofi Feed Technology Co., Ltd., TP36225 MCD), and the mice in the control group were given diet (Trofi Feed Technology Co., Ltd., TP36225 MCS). The modeling lasted for 10 weeks, and the mice had free access to food and water during the modeling period.

[0039] RNA extraction: Take out the liver tissue stored at -80℃, put it in liquid nitrogen, quickly cut off about 10mg of liver tissue, add about 1mL of pre-cooled Trizol reagent, and homogenize and lyse it with a tissue homogenizer. Subsequently, add 200μL of chloroform and shake vigorously for 15s, place it on ice for 10min, and centrifuge it at 4℃, 12000rpm for 15min. Transfer the upper aqueous phase (300μL) to a clean 1.5mL EP tube, add 300μL of isopropanol to precipitate RNA, place it on ice for 10min, and centrifuge it at 4℃, 12000rpm for 10min. Discard the supernatant, wash the precipitate with 75% ethanol, remove the supernatant after centrifugation, and dissolve the RNA precipitate with 40μL of DEPC-treated water after the ethanol evaporates completely.

[0040] MicroRNA reverse transcription: RNA concentration was quantified using Nano-drop. The “stem-loop method” was used to synthesize the first strand of cDNA. The experiment was performed according to the method in the commercially available kit (Novozyme Biotech Co., Ltd., MR101). The required primer sequences were:

[0041] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAC AAA.

[0042] Quantitative PCR: Quantitative PCR reagent (Novozyme Biotech, MQ101) was used to detect miR-497a-5p in the samples, and the required primer sequences were: F-CGCAGCAGCACACTGTGG; R-AGTGCAGGGTCCGAGGTATT. After amplification and quantification using a q-PCR instrument, the ΔΔCt value was used to characterize the difference in gene expression, and GraphPad Prism 7 software was used for data processing and statistical testing.

[0043] Experimental results: Figure 1 As shown, in the HFHSD-induced NASH mouse model and the HF-CDAA-induced NASH mouse model, the expression of miR-497a-5p in the liver of the model mice was significantly upregulated compared with that of the control mice.

[0044] Example 2

[0045] Protective effect of miR-497a-5p inhibitor on HF-CDAA-induced NASH model in mice

[0046] Animals: 40 male C57BL / 6J mice, SPF grade, 4 weeks old, purchased from Beijing Weitonglihua. All animals were kept on a 12-hour alternating circadian rhythm and had free access to food.

[0047] Instruments: Animal weighing scale; slicer; fully automatic biochemical analyzer; microscope

[0048] Reagents: AAV8-miR-497a-5p sponge-adeno-associated virus (i.e., conventional adeno-associated virus AAV8 vector, carrying a miRNAsponge containing four identical repeated mouse miR-497a-5p antagonistic sequences (UACAAACCACAGUGUGCUGCUG), which can reduce the level of miR-497a-5p in mouse liver), purchased from Shanghai Hanheng Biotechnology Co., Ltd.; corresponding control adeno-associated virus (AAV8 type empty adeno-associated virus), purchased from Shanghai Hanheng Biotechnology Co., Ltd.; HF-CDAA feed (TP36225 MCD), purchased from Jiangsu Nantong Trofi Feed Technology Co., Ltd.; control feed (TP36225 MCS), purchased from Nantong Trofi Feed Technology Co., Ltd.

[0049] Experimental process:

[0050] 1. Animal grouping

[0051] The mice were randomly divided into three groups according to their body weight: control feed + control adeno-associated virus (ND + Mock sponge), model feed + control adeno-associated virus (HF-CDAA + Mock sponge), and model feed + therapeutic adeno-associated virus group (HF-CDAA + miR-497a-5p sponge).

[0052] 2. Modeling

[0053] After 1 week of adaptive feeding, the control feed + control adeno-associated virus group was fed with control feed, and the model feed + control adeno-associated virus group and the model feed + treatment adeno-associated virus group were given HF-CDAA feed to establish the model. During the modeling period, the mice were free to eat and drink. One week after the modeling, each mouse in the control virus group was injected with 100 μL of 1×10 12 vg / mL of control adeno-associated virus, and 100 μL of 1×10 vg / mL of virus-treated virus were injected into the tail vein of each mouse. 12 vg / mL of AAV8-miR-497a-5p sponge adeno-associated virus. The feeding was continued for 9 weeks, during which the control feed group was given a control feed, and the model group was given a HF-CDAA feed. During this period, their body weight, hair, feces and activity were carefully observed and recorded.

[0054] 3. Obtain materials

[0055] The animals were fasted but not watered for 6 hours in advance. Blood was collected from the eye sockets the next morning and the animals were killed to obtain the liver. The liver weight was weighed and recorded. The right lobule tissue of the liver was divided into two parts and fixed with 4% paraformaldehyde for subsequent paraffin sections and frozen sections. The remaining liver tissue was divided into two parts and quickly frozen in liquid nitrogen for subsequent detection of other indicators.

[0056] 4. Determination of biochemical indicators

[0057] The whole blood was left to stand at room temperature for 2 hours, centrifuged at 3000 rpm for 15 minutes, and the serum was collected. After being diluted 4 times, it was sent to Wuhan Sewell Biotechnology Co., Ltd. for biochemical detection of ALT and AST in the serum.

[0058] 5. Liver tissue section staining

[0059] The tissues fixed with 4% paraformaldehyde were sent to Wuhan Sewell Biological Co., Ltd. to prepare HE-stained sections and oil red-stained sections.

[0060] 6. Determination of triglyceride and cholesterol content in the liver

[0061] Weigh about 50 mg of liver tissue into a 2 mL EP tube. Then, add 400 μL of methanol. After the tissue is fully lysed, add 600 μL of chloroform and shake overnight at room temperature. Centrifuge at 12000 rpm for 10 min, and take the supernatant for the detection of lipids in the liver. The reagents used for the test were purchased from WAKO (Triglycerides: LabAssay TM Triglyceride; Cholesterol: WAKOLabAssay TM Cholesterol). The detection method was carried out according to the steps in the instruction manual. The final result was corrected to the lipid content per mg of tissue.

[0062] 7. Extraction of RNA from liver tissue and q-PCR detection

[0063] The RNA extraction method was the same as above. Reverse transcription and quantification were performed using Novozyme Biotech Co., Ltd. The target genes detected were (Tnf, Il1b, Il6, Ccl2, Ccl4, Ccl5, Acta2, Col1a1, Col3a1 and Tgfb1). ΔΔCt values ​​were used to characterize the differences in gene expression, and GraphPad Prism 7 software was used for data processing and statistical tests.

[0064] 8. Experimental results

[0065] Figure 2 A and Figure 3 The results showed that liver inhibition of miR497a-5p could significantly reduce the level of liver lipid accumulation, reduce fatty changes in the liver of HF-CDAA-fed mice, and reduce the aggregation of liver lipid droplets. At the same time, by detecting the content of lipids in the liver ( Figure 2 B and Figure 2 C), showing that reducing the abundance of miR-497a-5p can reduce the levels of triglycerides and cholesterol in the liver, indicating that inhibiting miR-497a-5p in the liver can play a role in reducing liver lipid accumulation.

[0066] like Figure 4 As shown in the results, inhibition of miR-497a-5p in the liver can significantly reduce the increase of ALT and AST caused by HF-CDAA, indicating that inhibition of miR-497a-5p in the liver can play a liver-protective role. Further test results showed that ( Figure 5 ), inhibition of miR-497a-5p could significantly reduce the mRNA levels of TNFα, Il-1β, Il-6, Ccl2, Ccl4, and Ccl5, indicating that inhibition of miR-497a-5p in the liver could play an anti-inflammatory role.

[0067] like Figure 6As shown, inhibition of miR-497a-5p can significantly reduce the expression of fibrosis-related genes (α-SMA, Col1a1, Col3a1 and Tgfb1) in the liver, indicating that inhibition of miR-497a-5p in the liver can play an anti-fibrotic role.

[0068] The above results show that inhibiting miR-497a-5p by injecting AAV8-miR497a-5p sponge can effectively reduce HF-CDAA-induced liver lipid accumulation in mice, inhibit inflammatory response and liver fibrosis. Therefore, inhibiting miR-497a-5p by the method described in the present invention can be used to prevent and treat chronic liver diseases such as fatty liver disease (especially non-alcoholic steatohepatitis), chronic hepatitis and liver fibrosis.

[0069] Example 3

[0070] Mechanism of the anti-NASH effect of inhibiting miR-497a-5p

[0071] 1. Cell level experiments

[0072] To further study the anti-NASH mechanism of miR-497a-5p inhibitor, sequence alignment revealed that miR-497a-5p may bind to the 3'UTR region of ERRαmRNA. Subsequently, the synthesized miR-497a-5p mimic (purchased from Jima Bio) was transfected into mouse hepatocytes AML12 using a transfection reagent (Lipofectamine 2000, purchased from Invitrogen).

[0073] Experimental results ( Figure 7 ) showed that it could significantly reduce the level of ERRα protein in AML12 cells.

[0074] 2. Animal level experiments

[0075] Take out the liver tissue stored at -80°C in Example 2, put it in liquid nitrogen, quickly cut off about 10 mg of liver tissue, add about 500 μL of pre-cooled RIPA tissue lysis solution, homogenize with a tissue homogenizer, lyse at 4°C for 30 minutes; centrifuge at 4°C, 12000rpm for 15 minutes, and aspirate the supernatant into a clean EP tube. After adding the loading buffer to some proteins, boil and denature them; after some proteins are quantified by BCA protein, determine the sample protein concentration. After the denatured sample enters SDS-PAGE, the protein is transferred from the gel to the PVDF membrane, and then incubated and eluted with relevant antibodies, and finally imaged and analyzed using a chemiluminescence instrument.

[0076] Experimental results ( Figure 8) showed that AAV8-miR497a-5p sponge could reverse HF-CDAA-induced downregulation of ERRα protein in mouse liver.

[0077] These results suggest that administration of miR-497a-5p inhibitors could exert a therapeutic effect by reversing the downregulation of ERRα in liver diseases.

Claims

1. Use of a miR-497a-5p inhibitor in the preparation of a drug for preventing or treating liver diseases, wherein the sequence of the miR-497a-5p is: CAGCAGCACACUGUGGUUUGU.

2. The use according to claim 1, characterized in that The inhibitors include gene editing reagents that specifically knock out the miR-497a-5p gene, interfering molecules that specifically interfere with the expression of the miR-497a-5p gene, small molecule compounds that specifically inhibit the miR-497a-5p gene expression protein, antibodies or ligands that specifically bind to the miR-497a-5p gene expression protein, or antibodies or ligands that specifically bind to polypeptides targeting the miR-497a-5p gene.

3. The use according to claim 1, characterized in that The inhibitor is selected from nucleic acid products that can reduce the expression or activity of miR-497a-5p, including small interfering RNA, dsRNA, shRNA, microRNA, antisense nucleotides; or constructs that can express or form the small interfering RNA, dsRNA, shRNA, microRNA, antisense nucleotides; the small interfering RNA, dsRNA, shRNA, microRNA, antisense nucleotides can be methylated, thiolated, and cholesterol-modified.

4. The use according to claim 1, characterized in that The inhibitor is an adeno-associated virus carrying miR-497a-5p sponge, and miR-497a-5p sponge contains one or more antagonistic sequences.

5. The use according to claim 1, characterized in that: The miR-497a-5p inhibitor preferably includes at least one antagonistic sequence: ACAAACCACAGUGUGCUGCUG.

6. The use according to claim 1, characterized in that: The liver diseases include non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), primary biliary cholangitis (PBC), primary sclerosing cholangitis (PSC), alcoholic fatty liver disease (AFLD), liver fibrosis or cirrhosis.

7. A drug for preventing or treating liver disease, characterized in that: The invention comprises a miR-497a-5p inhibitor and a drug carrier encapsulating the inhibitor.

8. The drug according to claim 7, characterized in that: The drug carrier can be a lipidoid, a liposome, a lipid complex, a lipid nanoparticle, a polymeric compound, a peptide, a protein, a cell, a nanoparticle mimetic, a nanotube or a conjugate.

9. Use of miR-497a-5p gene or a polypeptide targeting miR-497a-5p gene as a regulatory target or regulatory marker in drugs for preventing or treating liver diseases.

10. The use according to claim 9, characterized in that The liver diseases include non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), primary biliary cholangitis (PBC), primary sclerosing cholangitis (PSC), alcoholic fatty liver disease (AFLD), liver fibrosis or cirrhosis.

Images