Ketoalkyd reductoisomerase mutant and genetically engineered bacterium for high yield of D-pantothenic acid

Abstract

The invention provides a keto-alcohol acid reductoisomerase mutant and application of the keto-alcohol acid reductoisomerase mutant in construction of genetically engineered bacteria for high yield of D-pantothenic acid. In order to solve the technical problem that in the prior art, the yield of D-pantothenic acid synthesized through microbial fermentation is not high, semi-rational design of enzyme is adopted, and a keto-alcohol acid reductoisomerase mutant with substrate specificity is obtained and applied to construction of genetically engineered bacteria for high yield of D-pantothenic acid. According to the invention, a genetically engineered bacterium with high yield of D-pantothenic acid is constructed by utilizing the keto-alcohol acid reductoisomerase mutant through a CRISPR-Cas9 gene editing technology, so that the yield of D-pantothenic acid is increased by about 12.04%, and compared with an original strain, the valine accumulation amount in obtained fermentation liquor is almost unchanged compared with that of a control, and the yield of D-pantothenic acid is greatly improved. However, the accumulation of branched chain amino acid isoleucine is less, so that the modification of the substrate specificity of the keto-alcohol acid reductoisomerase is achieved.

Description

Technical Field

[0001] The invention belongs to the field of bioengineering, and specifically relates to a ketol-acid reductoisomerase mutant with substrate specificity and its application in constructing a genetic engineering bacterium with high D-pantothenic acid production, a genetic engineering bacterium with high D-pantothenic acid production and a construction method thereof. Background Art

[0002] Pantothenic acid (PA) is an important member of the vitamin B family, also known as vitamin B5 or pantothenic acid. It is an essential vitamin for maintaining normal energy metabolism. Pantothenic acid was first isolated from yeast in 1933. It is widely present in various foods in nature, especially animal liver, vegetables and whole grains. As a component of coenzyme A (CoA) and acyl carrier protein (ACP), D-pantothenic acid participates in biochemical reactions such as fatty acid synthesis, protein metabolism, and energy metabolism. It has multiple biological functions and is essential for maintaining normal physiological functions. It is widely used in the pharmaceutical industry, food industry, feed processing, cosmetics and other industries.

[0003] Currently, the chemical enzymatic method is the mainstream production method of D-pantothenic acid, which has the advantages of substrate specificity and mild reaction conditions, but has low productivity, high cost, difficulty in industrialization, and the generation of toxic and harmful substances during the production process. Compared with traditional chemical production methods, the products produced by microbial cell factories are more environmentally friendly, reduce pollution to the environment, and meet the urgent needs of modern society for green production. In addition, this production method will reduce carbon emissions to zero or negative values ​​during the production process, thereby reducing the negative impact on the carbon dioxide content in the atmosphere, which is conducive to meeting the challenges of climate change and provides a more environmentally friendly and economically efficient method for producing D-pantothenic acid.

[0004] However, the current chemical enzymatic method for producing D-pantothenic acid still has some drawbacks, such as unstable fermentation process and low yield. Therefore, constructing a strain with higher yield of D-pantothenic acid is still a major challenge. Summary of the invention

[0005] In order to solve the technical problem of low yield of D-pantothenic acid synthesized by microbial fermentation in the prior art, the present invention uses semi-rational design of enzymes to obtain a ketol-acid reductoisomerase mutant with substrate specificity, and applies it to construct a genetically engineered bacterium with high yield of D-pantothenic acid. The present invention also constructs a genetically engineered bacterium with high yield of D-pantothenic acid by using the ketol-acid reductoisomerase mutant through CRISPR-Cas9 gene editing technology.

[0006] The technical solution adopted by the present invention is: a ketol-acid reductoisomerase mutant is obtained by single mutation at the 47th, 69th, 75th, 115th and 414th positions of the amino acid sequence shown in SEQ ID NO.1.

[0007] Ketol-acid reductoisomerase (EC 1.1.1.86, AHAIR), also known as acetolactate reductoisomerase, is involved in the biosynthesis of branched-chain amino acids. It is a bifunctional enzyme that catalyzes two distinct reactions at a common active site; it can catalyze two completely different reactions, acting as both an isomerase and a reductase. In the isomerase reaction, 2-acetolactate is converted to Mg via the 2+ The rearrangement-dependent methyl transfer generates 2,3-dihydroxyisovalerate, an intermediate in the pantothenate pathway, and thus it is one of the key enzymes in the D-pantothenate biosynthesis pathway, which is produced in Escherichia coli by ilvC Genetic coding.

[0008] In order to construct a D-pantothenic acid producing strain with better performance, the present invention transforms the sites near the interaction between the substrate acetolactate molecule and ketol-acid reductoisomerase to change its substrate promiscuity. The active pocket of the enzyme molecule is shallow, and the substrate is easier to bind to the enzyme, so the ketol-acid reductoisomerase can catalyze the reaction of a variety of 2-keto acids. On the one hand, the present invention selects 6 amino acid sites 68, 75, 110, 132, 155, and 414 from the positions near the binding of the substrate and the enzyme as objects of site-directed mutation. Since alanine will not significantly change the spatial configuration of the protein due to its simple structure, all 7 sites are mutated to alanine; on the other hand, the present invention also selects 4 amino acid sites 47, 69, 43, and 115 that are beneficial to enhancing the affinity of acetolactate as a substrate and ketol-acid reductoisomerase for site-directed mutation. Subsequently, the above mutants are introduced into the plasmid pACYC. ilvC Overexpression in gene-knockout bacteria to screen for better ketol-acid reductoisomerase mutants ilvC A47S , ilvC K69L , ilvC K75A , ilvC V115I , ilvC S414A And a genetically engineered bacterium containing the above-mentioned superior mutant coding gene for high production of D-pantothenic acid.

[0009] Preferably, the ketol-acid reductoisomerase mutant is obtained by subjecting the amino acid sequence shown in SEQ ID NO.1 to one of the following mutations: (1) Alanine at position 47 mutated to serine; (2) Lysine 69 mutated to leucine; (3) Lysine 75 mutated to alanine; (4) Valine at position 115 mutated to isoleucine; (5) Serine at position 414 mutated to alanine.

[0010] The present invention also provides a gene encoding the ketol-acid reductoisomerase mutant.

[0011] The invention also provides a recombinant vector containing the ketol-acid reductoisomerase mutant encoding gene.

[0012] The invention also provides a genetically engineered bacterium containing the ketol-acid reductoisomerase mutant encoding gene.

[0013] The present invention also provides the use of the ketol-acid reductoisomerase mutant in constructing a genetic engineering bacterium with high production of D-pantothenic acid.

[0014] The present invention also provides a method for constructing a genetically engineered bacterium with high production of D-pantothenic acid, comprising: knocking out a gene in the genome of the bottom plate bacterium; ilvC Gene, the coding gene of the ketol-acid reductoisomerase mutant is introduced into the chassis bacteria and overexpressed, so as to construct a genetically engineered bacterium with high production of D-pantothenic acid.

[0015] Preferably, the gene encoding the ketol-acid reductoisomerase mutant is introduced into the chassis bacteria using the low copy plasmid pACYC and overexpressed.

[0016] Preferably, the bottom plate bacteria is Escherichia coli W3110 , Trc-panCpanEpanBilvC / ilvG* / ΔavtA / ilvE* / coaA* / Δ ilvA / Trc-lpd / Δglk / ilvA* / Trc-pck / Trc-maeB / Trc-ilvBN / gdhA* T (denoted as DPAL6), which has been disclosed in CN113637618A.

[0017] Preferably, the method for constructing the genetically engineered bacteria with high production of D-pantothenic acid comprises: (1) Using CRISPR-Cas9 gene editing technology, we knocked out the DPAL6 gene in the genome of the fungus ilvC gene, resulting in strain DPAL6 / Δ ilvC ; (2) The coding gene of the keto-acid reductoisomerase mutant was introduced into strain DPAL6 / Δ by using the low-copy plasmid pACYC. ilvC Overexpression in the medium resulted in a genetically engineered bacterium with high production of D-pantothenic acid.

[0018] The invention also provides a genetic engineering bacterium with high D-pantothenic acid production obtained by the method.

[0019] Preferably, the genetically engineered bacteria that produces high levels of D-pantothenic acid is one of the following: (1) Escherichia coli W3110 , Trc-panCpanEpanBilvC / ilvG* / ΔavtA / ilvE* / coaA* / ΔilvA / Trc-lpd / Δglk / ilvA* / Trc-pck / Trc-maeB / Trc-ilvBN / gdhA* T / Δ ilvC / pACYC- ilvC A47S ; (2) Escherichia coli W3110 , Trc-panCpanEpanBilvC / ilvG* / ΔavtA / ilvE* / coaA* / ΔilvA / Trc-lpd / Δglk / ilvA* / Trc-pck / Trc-maeB / Trc-ilvBN / gdhA* T / Δ ilvC / pACYC- ilvC K69L ; (3) Escherichia coli W3110 , Trc-panCpanEpanBilvC / ilvG* / ΔavtA / ilvE* / coaA* / ΔilvA / Trc-lpd / Δglk / ilvA* / Trc-pck / Trc-maeB / Trc-ilvBN / gdhA* T / Δ ilvC / pACYC- ilvC K75A ; (4) Escherichia coli W3110 , Trc-panCpanEpanBilvC / ilvG* / ΔavtA / ilvE* / coaA* / ΔilvA / Trc-lpd / Δglk / ilvA* / Trc-pck / Trc-maeB / Trc-ilvBN / gdhA* T / Δ ilvC / pACYC- ilvC S414A ; (5) Escherichia coli W3110 , Trc-panCpanEpanBilvC / ilvG* / ΔavtA / ilvE* / coaA* / ΔilvA / Trc-lpd / Δglk / ilvA* / Trc-pck / Trc-maeB / Trc-ilvBN / gdhA* T / Δ ilvC / pACYC- ilvC V115I .

[0020] The present invention also provides the use of the genetic engineering bacteria with high D-pantothenic acid production in the preparation of D-pantothenic acid by microbial fermentation.

[0021] Preferably, the application comprises: inoculating the genetically engineered bacteria with high D-pantothenic acid production into a fermentation medium containing chloramphenicol resistance, and fermenting and culturing at 37°C and 100-200 rpm until OD reaches 0. 600 =0.8~1.0, then transfer to 30°C, 180 rpm and continue fermenting for 48 h. After the fermentation is completed, the supernatant of the fermentation liquid is separated and purified to obtain the D-pantothenic acid.

[0022] Among them, the fermentation medium composition is preferably as follows: 10~30 g / L glucose, 10~25 g / L ammonium sulfate, 1~5 g / L anhydrous betaine, 1~5 g / L yeast powder, 1~5 g / L potassium dihydrogen phosphate, 0.5~2 g / L anhydrous magnesium sulfate, 1~5 g / L β-alanine, 1~5 ml / L trace element solution, the solvent is deionized water, and the pH value is natural; the trace element solution composition is: 10g / LCuCl2, 10g / L FeSO4·7H2O, 10g / L ZnSO4·7H2O, 0.2g / L CuSO4, 0.02g / L NiCl2·7H2O, and the solvent is deionized water.

[0023] Specifically, the fermentation culture method includes: taking out the high-yield D-pantothenic acid-producing genetically engineered bacterial strain to be fermented, streaking it on an LB solid plate, culturing it at 37°C overnight for 12 to 16 hours, picking a single colony and inoculating it in an LB test tube, culturing it at 37°C and 180 rpm for 12 hours to obtain a seed solution. 1.5 mL of the seed solution was inoculated into a 250 mL shake flask containing 50 mL of culture medium, and culturing it at 30°C and 180 rpm for 48 hours.

[0024] Beneficial effects of the present invention: The present invention uses molecular docking to carry out site-directed mutation of ketol-acid reductoisomerase, and by enhancing the binding ability between substrate and enzyme, the affinity of acetolactate to substrate is improved, and finally a better ketol-acid reductoisomerase mutant is obtained. Among them, the ketol-acid reductoisomerase mutant ilvC V115I While strengthening the D-pantothenic acid pathway, the synthesis of L-valine was not affected; finally, through shake flask fermentation, the D-pantothenic acid production was increased by about 12.04%, and relative to the starting strain, the accumulation of valine in the obtained fermentation broth was almost unchanged compared with the control, but the accumulation of branched-chain amino acid isoleucine was less, achieving the modification of the substrate specificity of keto-acid reductoisomerase. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 DPAL7 (DPAL6 / Δ ilvC )'s OD600 and D-pantothenic acid titer.

[0026] Figure 2 DPAL8 (DPAL7 / pACYC- ilvC )'s OD600 and D-pantothenic acid titer.

[0027] Figure 3 DPAL15 (DPAL7 / pACYC- ilvC A47S )'s OD600 and D-pantothenic acid titer.

[0028] Figure 4 DPAL16 (DPAL7 / pACYC- ilvC K69L )'s OD600 and D-pantothenic acid titer.

[0029] Figure 5 DPAL10 (DPAL7 / pACYC- ilvC K75A )'s OD600 and D-pantothenic acid titer.

[0030] Figure 6 DPAL18 (DPAL7 / pACYC- ilvC V115I ) and changes in the titers of amino acids and D-pantothenic acid.

[0031] Figure 7 DPAL14 (DPAL7 / pACYC- ilvC S414A )'s OD600 and D-pantothenic acid titer.

[0032] Figure 8 DPAL9 (DPAL7 / pACYC- ilvC R68A )'s OD600 and D-pantothenic acid titer.

[0033] Figure 9 DPAL11 (DPAL7 / pACYC- ilvC Q110A )'s OD600 and D-pantothenic acid titer.

[0034] Figure 10 DPAL12 (DPAL7 / pACYC- ilvC H132A )'s OD600 and D-pantothenic acid titer.

[0035] Figure 11 DPAL13 (DPAL7 / pACYC- ilvC K155A )'s OD600 and D-pantothenic acid titer.

[0036] Figure 12 DPAL17 (DPAL7 / pACYC- ilvC V43I )'s OD600 and D-pantothenic acid titer. DETAILED DESCRIPTION

[0037] The following is an explanation of the embodiments of the present invention by specific specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied by other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, in the absence of conflict, the features in the following embodiments and embodiments can be combined with each other. In the embodiments of the present invention, the methods used are all conventional methods unless otherwise specified, and the reagents used can be obtained from commercial sources.

[0038] In the following examples, the final concentration of spectinomycin in the culture medium is 0.05 mg / L, and the final concentration of kanamycin in the culture medium is 0.05 mg / L.

[0039] LB medium: 10 g / L peptone, 5 g / L yeast extract, 5 g / L NaCl, solvent is deionized water, pH value is natural.

[0040] MS culture medium: glucose 20 g / L, (NH4)2SO4 16 g / L, KH2PO4 2 g / L, MgSO4 0.5 g / L, yeast extract 2 g / L, CaCO3 10 g / L, 1 ml / L trace element solution, the solvent is deionized water, pH value is natural; 10 g / L calcium carbonate (sterilized separately); the composition of the trace element solution is: 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 1 g / L ZnSO4·7H2O, 0.20 g / L CuSO4, 0.02 g / L NiCl2·7H2O, the solvent is deionized water.

[0041] The parent strain of the present invention E. coli W3110 is from the Coli Genetic Stock Center of Yale University, with a deposit date of August 5, 1975 and a deposit number of CGSC#4474, and has been disclosed in patents US 2009 / 0298135A1 and US2010 / 0248311 A1.

[0042] HPLC determination of D-pantothenic acid content: Chromatographic conditions: C18 column (250 × 4.6 mm, particle size 5 μm, Agilent Technologies Co., Santa Clara, CA, USA), detection wavelength: 200 nm, column temperature: 30°C; sample treatment: dilute the sample with ultrapure water to keep the D-pantothenic acid content between 0.05 g / L and 0.40 g / L; mobile phase: acetonitrile / water / phosphoric acid: (50 / 949 / 1); data acquisition time: 25 min.

[0043] Determination of amino acid content: Analytical conditions: Hitachi custom ion exchange resin (4.6mm ID×60mm*), wavelength: 570nm, 440nm, separation column temperature: 57℃: reaction column temperature: 135℃; sample treatment: dilute the sample with ultrapure water to keep the L-Valine content between 0.05g / L and 0.4g / L; mobile phase: B1 (water 700 mL / sodium citrate 6.19 g / 1 M NaOH / sodium chloride 5.66 g / citric acid 19.8 g / ethanol 135mL); R3 (ethanol 50 mL / water 950 mL); data acquisition time: 30min.

[0044] The primer sequence information used in the examples is shown in Table 1.

[0045] Table 1: Primer sequences Primer Name Sequence (5’-3’) pACYC-F GAAGCTTAGATCTATTACCCTG pACYC-R GGTCTGTTTCCTGTGTGAAA ilvCEc-F TTTCACACAGGAAACAGACCATGGCTAACTACTTCAATACAC ilvCEc-R ATCCGCCAAAACAGCCAAGCTTTTAACCCGCAACAGCAATAC pT-ΔilvC-F TAATACTAGTCAGGTAGGTAAGAAACTGCGGTTTTAGAGCTAGAAATAGC pT-ΔilvC-R GCTCTAAAACCGCAGTTTCTTACCTACCTGACTAGTATTATACCTAGGAC ΔilvC-up-F ATTCTCTAGAGTCGACCTGCGTGTTCCGCGCGGAAGCGAT ΔilvC-up-R GTGAGGGCATCAGCGCGCACGGTGATTCCTCGTGATGTTG ΔilvC-down-F GTGCGCGCTGATGCCCTCAC ΔilvC-down-R GGGTAATAGATCTAAGCTTCGGGACCTGCGAAGCCCGGAT ΔilvC-VF GCGCCAGCAGCTGGCACAGC ΔilvC-VR GCAGACATACAGAGGGCGGT R68A-F TACGCTCTGGCGAAAGAAGCGATTGCCGAGAAG R68A-R CGCTTCTTTCGCCAGAGCGTAGGAGATATCGA K75A-F GATTGCCGAGGCGCGCGCGTCCTGGCGTAAAG K75A-R GACGCGCGCGCCTCGGCAATCGCTTCTTTAC Q110A--F CCGGACAAGGCGCACTCTGATGTAGTGCGCAC Q110A-R TCAGAGTGCGCCTTGTCCGGCGTCAGGTTAA H132A-F GGCTACTCGGCGGGTTTCAACATCGTCGAAGT H132A-R GTTGAAACCCGCCGAGTAGCCCAGCGCCGCGC K155A-F GTTGCGCCGGCGTGCCCAGGCACCGAAGTGCG K155A-R GCCTGGGCACGCCGGCGCAACCATCACTACGG S414A-F CGTGGTTATCGCGGATACCGCTGAGTACGGTAAC S414A-R CAGCGGTATCCGCGATAACCACGTTCATTTCGTA A47S-F GGCTGTGGCAGCCAGGGTCTGAACCAGGGCCTG A47S-R CAGACCCTGGCTGCCACAGCCGACGATGACTAC K69L-F ATCGCTTCCAAGCGCAGAGCGTAGGAGATATCGAGACCAG K69L-R GCTCTGCGCTTGGAAGCGATTGCCGAGAAGCGCGCGTCCT V43I-F GTAGTCATCCTGGGCTGTGGCGCACAGGGTCT V43I-R GCCACAGCCCAGGATGACTACTTTTTTACCCTG V115I-F CTGATGTAATTCGCACCGTACAGCCACTGATG V115I-R TACGGTGCGAATTACATCAGAGTGCTGCTTGTC Comparative Example 1: DPAL7(DPAL6 / Δ ilvC ) Construction and shake flask fermentation Using DPAL6 as the starting strain, we used CRISPR-Cas9-mediated gene editing technology to modify the genome ilvC Gene knockout for subsequent determination of the effects of ketol-acid reductoisomerase mutants on the pantothenate pathway.

[0046] (1) Construction of pTarget-Δ ilvC Plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as template and pT-Δ ilvC -F / pT-Δ ilvC -R is primer PCR amplification, and the PCR product was digested by Dpn I at 37℃ for 3 h; pTarget-Δ ilvC The PCR product was amplified with linearized primers pTarget-XF and pTarget-XR, and pTarget-Δ ilvC Linearize the vector for subsequent ligation with Donor DNA.

[0047] (2) Construction of pTD-Δ ilvC Plasmid: E. coli W3110 genome was used as a template, Δ ilvC -up-F, Δ ilvC -up-R is the upstream part of the donor DNA amplified by primers (F1), Δ ilvC -down-F and Δ ilvC -down-R was used as primer to amplify the downstream part (F2) of donor DNA, and the PCR fragments were purified by gel recovery to obtain F1 and F2; pTarget-Δ ilvC The linearized vector, fragments F1 and F2 were connected together and verified by sequencing to obtain pTD-Δ ilvC Plasmid.

[0048] (3) Introduce the pCas plasmid (Addgene Plasmid #62225) into DPAL6, transfer the monoclonal colony to an LB tube containing 0.05 mg / L kanamycin, and culture at 30°C overnight; then inoculate it into a 250 mL shake flask containing 50 mL LB medium at a volume concentration of 1%, add 500 μl 1 mol / L L-arabinose, and culture at 150 rpm and 30°C until the OD 600 0.4~0.6; 4000 rpm, 4℃ centrifugation for 10 min to collect cells and prepare electroporation competent cells. For detailed procedures, see (Molecular Cloning: A Laboratory Manual, 3ed Edition, 99-102).

[0049] (4) Use a pipette to draw an appropriate amount of pTD-Δ ilvC (about 200 ng) plasmid was mixed with 100 μl of electroporated competent cells prepared in advance and transferred into a pre-cooled 2 mm electroporation cup. After an ice bath for about 1 to 2 min, an electroporator (MicroPluser TM , BIO-RAD) for electroporation transformation. After electroporation, 800 μl LB medium was immediately added and gently aspirated, transferred to a 2 mL Eppendorf tube, and thawed at 30°C for 3-4 h before coating on a LB solid plate containing 0.05 mg / L kanamycin and 0.05 mg / L spectinomycin. The plate was inverted and cultured at 30°C for 12-16 h. ilvC-VF / R were used as primers for colony PCR verification. If a fragment of about 1500 bp was successfully cloned, it was proved to be DPAL7 (DPAL6derivative, Δ ilvC ) positive colonies.

[0050] (5) Plasmid elimination: Use an inoculation loop to pick up a positive single colony and inoculate it into a LB liquid test tube containing 1 mM IPTG and 0.05 mg / L kanamycin. Culture it at 30°C overnight. The next day, streak the bacterial liquid onto a LB solid plate containing 0.05 mg / L kanamycin. Culture it at 30°C for 24 h. When the bacteria grow to a certain size, pick some single colonies and streak them onto a LB plate containing 0.05 mg / L spectinomycin. Single colonies that cannot be streaked onto the LB plate containing 0.05 mg / L spectinomycin show that their pTarget-Δ ilvC The plasmid was successfully eliminated, and then pTarget-Δ was picked ilvC The single colonies with successful elimination of plasmid were placed in LB test tubes and cultured at 37 °C overnight to eliminate the pCas plasmid. The next day, the bacterial solution was streaked on LB plates. After culturing at 37 °C for 12 h, some single colonies were picked and streaked on LB plates containing 0.05 mg / L kanamycin. The single colonies that could not be streaked on the LB plate containing 0.05 mg / L kanamycin had their pCas plasmids successfully eliminated, and finally the plasmid-free strain DPAL7 (DPAL6derivative, Δ ilvC ).

[0051] (6) Shake flask fermentation: DPAL7 (DPAL6 derivative, Δ ilvC ), with the starting strain DPAL6 as the control group, they were inoculated into 10 mL of LB medium and cultured at 37°C and 200 rpm as pre-cultures; after 8-12 h, 1 mL of the pre-culture was inoculated into a 500 mL shake flask containing 50 mL of MS medium at a 2% inoculum, and then cultured in a constant temperature shaker at 30°C and 180 rpm for 48 h for strain fermentation; after the fermentation, 1 mL of the fermentation liquid was taken to measure the OD 600 At the same time, 1 mL of fermentation liquid was drawn with a pipette and centrifuged at 12000 rpm for 3 min at room temperature. The fermentation supernatant was diluted 5 times and the diluted sample was treated with a water filter membrane to remove impurities. The OD 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 1 shown.

[0052] As can be seen from the figure, the genome ilvC Gene knockout, compared with DPAL6 knockout ilvCThe DPA production of the strain decreased by about 80%, indicating that ketol-acid reductoisomerase plays a key role in the DPA production pathway.

[0053] Comparative Example 2: DPAL8 (DPAL7 / pACYC- ilvC ) Construction and shake flask fermentation Using DPAL7 as the starting strain, the recombinant plasmid pACYC- ilvC , and then transfected into the DPAL7 bacterial strain to verify ilvC Effect on the potency of D-pantothenic acid (1) Construction of pACYC plasmid linearization vector: The original pACYC plasmid was used as a template and the primers pACYC-F and pACYC-R were used to linearize and open the loop. After the PCR product was verified by nucleic acid gel electrophoresis, the residual template was digested with DPNⅠ at 37°C for 1 h. After the digestion, the product was cleaned up and purified, and the nucleic acid concentration was measured to finally obtain the pACYC linearization vector fragment. (2) Original ilvC Fragment amplification: wild type E. coli The W3110 genome was used as a template and PCR amplified using primers ilvCEc-F and ilvCEc-R. After the product was verified by nucleic acid gel electrophoresis, the product was cleaned up and purified, and the nucleic acid concentration was measured. Finally, the amplified ilvC Fragment (nucleotide sequence is shown in SEQ ID NO.2).

[0054] (3) Plasmid pACYC- ilvC Construction: Linearize the pACYC vector and amplify ilvC The fragment was used as a template, and the reaction system was added according to the instructions of the one-step cloning kit (ClonExpress Ultra One Step Cloning Kit). After being placed at 50°C for 15 min, it was immediately placed on ice to cool down. ilvC The gene fragment was integrated into the multiple cloning site of the pACYC plasmid, and then the ligation product was transformed into DH5α competent cells. After successful colony PCR verification, the recombinant plasmid pACYC- ilvC .

[0055] (4) Plasmid pACYC- ilvC The specific steps are as follows: step (6) of comparative example 1. After fermentation of strain DPAL8, the OD600 and the D-pantothenic acid content in the supernatant of the fermentation liquid are as follows: Figure 2 shown.

[0056] As can be seen from the figure, by constructing the recombinant plasmid pACYC-ilvC Overexpression ilvC In contrast, DPAL6 restored its isomerase activity, making the D-pantothenate production almost the same as that of the control.

[0057] Example 1: DPAL15 (DPAL7 / pACYC-ilvC A47S ) Construction and shake flask fermentation Using DPAL7 as the starting strain, site-directed mutagenesis was performed to transform the original E. coli ilvC The 47th codon gca mutates to agc, causing the amino acid it encodes to mutate from alanine to serine, thereby changing the substrate preference of ketol-acid reductoisomerase.

[0058] (1) Plasmid pACYC-ilvC A47S Construction: Plasmid pACYC-ilvC was used as a template, and primers A47S-F and A47S-R were used for site-directed mutagenesis. The mutated PCR product was verified by nucleic acid gel electrophoresis, and the residual template was digested with DPNⅠ at 37°C for 1 h. After the digestion, the product was cleaned up and purified, and the nucleic acid concentration was measured. Finally, the product with ilvC Mutated pACYC- ilvC A47S Plasmid linearization vector fragment.

[0059] (2) Plasmid pACYC- ilvC A47S Transformed to the base strain DPAL7, DPAL15 was obtained. For the specific steps, refer to step (6) of comparative example 1. The OD600 of strain DPAL15 after fermentation and the D-pantothenic acid content in the supernatant of the fermentation broth are as follows: Figure 3 shown.

[0060] As can be seen from the figure, compared with the DPAL6 strain, the OD of the strain DPAL15 has been greatly improved, and the pantothenic acid production has increased, which indicates that ilvC Mutation of codon 47 may increase its isomerase activity, thereby increasing the production of D-pantothenic acid.

[0061] Example 2: DPAL16 (DPAL7 / pACYC-ilvC K69L ) Construction and shake flask fermentation Using DPAL7 as the starting strain, site-directed mutagenesis was performed to transform the original E. coli ilvC The 69th codon aaa mutated to ctg, causing the amino acid it encodes to mutate from lysine to leucine, thereby changing the substrate preference of ketol-acid reductoisomerase.

[0062] The plasmid pACYC- ilvCAs a template, primers K69L-F and K69L-R were used for site-directed mutagenesis to construct plasmid pACYC- ilvC K69L . The plasmid pACYC- ilvC K69L The DPAL16 was obtained by transforming the DPAL16 strain into the base strain DPAL7. The specific steps are shown in Example 1. The OD600 of the DPAL16 strain after fermentation and the D-pantothenic acid content in the supernatant of the fermentation broth are as follows: Figure 4 shown.

[0063] As can be seen from the figure, compared with the DPAL6 strain, the OD of the strain DPAL16 has been greatly improved, and the pantothenic acid production has increased, which indicates that ilvC Mutation of codon 69 may increase its isomerase activity, thereby increasing the production of D-pantothenic acid.

[0064] Example 3: DPAL10 (DPAL7 / pACYC- ilvC K75A ) Construction and shake flask fermentation Using DPAL7 as the starting strain, site-directed mutagenesis was performed to transform the original E. coli ilvC The 75th codon aag mutated to gcg, causing the amino acid it encodes to mutate from lysine to alanine, thereby changing the substrate preference of ketol-acid reductoisomerase.

[0065] The plasmid pACYC- ilvC As a template, primers K75A-F and K75A-R were used for site-directed mutagenesis to construct plasmid pACYC- ilvC K75A . The plasmid pACYC- ilvC K75A The DPAL10 was obtained by transforming the DPAL10 strain into the base strain DPAL7. The specific steps are shown in Example 1. The OD600 of the DPAL10 strain after fermentation and the D-pantothenic acid content in the supernatant of the fermentation broth are as follows: Figure 5 shown.

[0066] As can be seen from the figure, compared with the DPAL6 strain, the D-pantothenic acid titer of the strain DPAL10 was slightly increased, which indicates that ilvC Mutation of codon 75 may increase its isomerase activity, resulting in a slight increase in D-pantothenate production.

[0067] Example 4: DPAL18 (DPAL7 / pACYC- ilvC V115I ) Construction and shake flask fermentation Using DPAL7 as the starting strain, site-directed mutagenesis was performed to transform the original E. coli ilvCThe 115th codon gtg mutated to att, causing the amino acid it encodes to mutate from valine to isoleucine, thereby changing the substrate preference of ketol-acid reductoisomerase.

[0068] The plasmid pACYC- ilvC As a template, primers V115I-F and V115I-R were used for site-directed mutagenesis to construct plasmid pACYC- ilvC V115I . The plasmid pACYC- ilvC V115I The DPAL18 was obtained by transforming the DPAL18 strain into the base strain DPAL7. The specific steps are shown in Example 1. The OD600 of the DPAL18 strain after fermentation and the D-pantothenic acid content in the supernatant of the fermentation broth are as follows: Figure 6 shown.

[0069] As can be seen from the figure, through ilvC Mutation, construction of recombinant plasmid pACYC- ilvC V115I , compared with the DPAL6 strain, the D-pantothenic acid production increased by about 12.04%, the valine accumulation remained almost unchanged, but the isoleucine accumulation decreased by 54.1%, achieving the ketoacid substrate specificity modification and strengthening the D-pantothenate synthesis pathway.

[0070] Example 5: DPAL14 (DPAL7 / pACYC- ilvC S414A ) Construction and shake flask fermentation Using DPAL7 as the starting strain, site-directed mutagenesis was performed to transform the original E. coli ilvC The 414th codon tct mutated to gcg, causing the amino acid it encodes to mutate from serine to alanine, thereby changing the substrate preference of ketol-acid reductoisomerase.

[0071] The plasmid pACYC- ilvC As a template, primers S414A-F and S414A-R were used for site-directed mutagenesis to construct plasmid pACYC- ilvC S414A . The plasmid pACYC- ilvC S414A The DPAL14 was obtained by transforming the DPAL14 strain into the base strain DPAL7. The specific steps are shown in Example 1. The OD600 of the DPAL14 strain after fermentation and the D-pantothenic acid content in the supernatant of the fermentation broth are as follows: Figure 7 shown.

[0072] As can be seen from the figure, compared with the DPAL6 strain, the OD of the strain DPAL14 has been greatly improved, and its yield has also increased to a certain extent. It is speculated that its enzyme activity may have been improved and the pantothenic acid synthesis pathway has been strengthened.

[0073] Comparative Example 3: DPAL9 (DPAL7 / pACYC- ilvC R68A ) Construction and shake flask fermentation Using DPAL7 as the starting strain, site-directed mutagenesis was performed to transform the original E. coli ilvC The codon cgt at position 68 mutates to gcg, causing the amino acid it encodes to mutate from arginine to alanine, thereby changing the substrate preference of ketol-acid reductoisomerase.

[0074] The plasmid pACYC- ilvC As a template, primers R68A-F and R68A-R were used for site-directed mutagenesis to construct plasmid pACYC- ilvC R68A . The plasmid pACYC- ilvC R68A The DPAL9 was obtained by transforming the DPAL9 strain into the base strain DPAL7. The specific steps are shown in Example 1. The OD600 of the DPAL9 strain after fermentation and the D-pantothenic acid content in the supernatant of the fermentation broth are as follows: Figure 8 shown.

[0075] As can be seen from the figure, compared with the DPAL6 strain, the D-pantothenic acid of the DPAL9 strain has almost no change, indicating that ilvC Mutation at position 68 may not have much effect on its enzyme activity.

[0076] Comparative Example 4: DPAL11 (DPAL7 / pACYC- ilvC Q110A ) Construction and shake flask fermentation Using DPAL7 as the starting strain, site-directed mutagenesis was performed to transform the original E. coli ilvC The 110th codon cag mutated to gcg, causing the amino acid it encodes to mutate from glutamine to alanine, thereby changing the substrate preference of ketol-acid reductoisomerase.

[0077] The plasmid pACYC- ilvC As a template, primers Q110A-F and Q110A-R were used for site-directed mutagenesis to construct plasmid pACYC- ilvC Q110A . The plasmid pACYC- ilvC Q110A The DPAL11 was obtained by transforming the DPAL11 strain into the base strain DPAL7. The specific steps are shown in Example 1. The OD600 of the DPAL11 strain after fermentation and the D-pantothenic acid content in the supernatant of the fermentation broth are as follows: Figure 9 shown.

[0078] As can be seen from the figure, compared with the DPAL6 strain, the D-pantothenic acid production of the strain DPAL11 is reduced, indicating thatilvC Mutation at codon 110 may reduce its isomerase activity, thereby resulting in reduced D-pantothenate production.

[0079] Comparative Example 5: DPAL12 (DPAL7 / pACYC- ilvC H132A ) Construction and shake flask fermentation Using DPAL7 as the starting strain, site-directed mutagenesis was performed to transform the original E. coli ilvC The 132nd codon cac mutated to gcg, causing the amino acid it encodes to mutate from histidine to alanine, thereby changing the substrate preference of ketol-acid reductoisomerase.

[0080] The plasmid pACYC- ilvC As a template, primers H132A-F and H132A-R were used for site-directed mutagenesis to construct plasmid pACYC- ilvC H132A . The plasmid pACYC- ilvC H132A The DPAL12 was obtained by transforming the DPAL12 strain into the base strain DPAL7. The specific steps are shown in Example 1. The OD600 of the DPAL12 strain after fermentation and the D-pantothenic acid content in the supernatant of the fermentation broth are as follows: Figure 10 shown.

[0081] As can be seen from the figure, compared with the DPAL6 strain, the OD of the strain DPAL12 has been greatly improved, but the D-pantothenic acid production has decreased. ilvC Mutation at codon 132 may reduce its isomerase activity.

[0082] Comparative Example 6: DPAL13 (DPAL7 / pACYC- ilvC K155A ) Construction and shake flask fermentation Using DPAL7 as the starting strain, site-directed mutagenesis was performed to transform the original E. coli ilvC The 155th codon aaa mutated to gcg, causing the amino acid it encodes to mutate from lysine to alanine, thereby changing the substrate preference of ketol-acid reductoisomerase.

[0083] The plasmid pACYC- ilvC As a template, primers K155A-F and K155A-R were used for site-directed mutagenesis to construct plasmid pACYC- ilvC K155A . The plasmid pACYC- ilvC K155A The DPAL13 was obtained by transforming the DPAL13 strain into the base strain DPAL7. The specific steps are shown in Example 1. The OD600 of the DPAL13 strain after fermentation and the D-pantothenic acid content in the supernatant of the fermentation broth are as follows:Figure 11 shown.

[0084] As can be seen from the figure, compared with the DPAL6 strain, the OD of the strain DPAL13 has been greatly improved, but the isomerase activity has been reduced, resulting in a decrease in the production of D-pantothenic acid.

[0085] Comparative Example 7: DPAL17 (DPAL7 / pACYC- ilvC V43I ) Construction and shake flask fermentation Using DPAL7 as the starting strain, site-directed mutagenesis was performed to transform the original E. coli ilvC The 43rd codon gtc mutates to atc, causing the amino acid it encodes to mutate from valine to isoleucine, thereby changing the substrate preference of ketol-acid reductoisomerase.

[0086] The plasmid pACYC- ilvC As a template, primers V43I-F and V43I-R were used for site-directed mutagenesis to construct plasmid pACYC- ilvC V43I . The plasmid pACYC- ilvC V43I The DPAL17 was obtained by transforming the DPAL17 strain into the base strain DPAL7. The specific steps are shown in Example 1. The OD600 of the DPAL17 strain after fermentation and the D-pantothenic acid content in the supernatant of the fermentation broth are as follows: Figure 12 shown.

[0087] As can be seen from the figure, compared with the DPAL6 strain, the OD of the strain DPAL17 has been greatly improved, but it is speculated that ilvC Mutation of codon 43 reduces its isomerase activity, resulting in reduced production of D-pantothenate.

[0088] The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope of the present invention.

Claims

1. A keto-acid reductoisomerase mutant, characterized in that: It is obtained by single mutation at positions 47, 69, 75, 115 and 414 of the amino acid sequence shown in SEQ ID NO.

1.

2. The ketol-acid reductoisomerase mutant according to claim 1, characterized in that The mutation is one of the following: (1) Alanine at position 47 mutated to serine; (2) Lysine 69 mutated to leucine; (3) Lysine 75 mutated to alanine; (4) Valine at position 115 mutated to isoleucine; (5) Serine at position 414 mutated to alanine.

3. A gene encoding the ketol-acid reductoisomerase mutant according to any one of claims 1 or 2.

4. A recombinant vector containing the gene encoding the ketol-acid reductoisomerase mutant according to claim 3.

5. A genetically engineered bacterium containing the gene encoding the ketol-acid reductoisomerase mutant according to claim 3.

6. Use of the ketol-acid reductoisomerase mutant according to any one of claims 1 or 2 in constructing a genetically engineered bacterium that produces high amounts of D-pantothenic acid.

7. A method for constructing a genetically engineered bacterium that produces high levels of D-pantothenic acid, characterized in that: include: Knockout in the genome of the fungus ilvC Gene, the coding gene of the ketol-acid reductoisomerase mutant described in any one of claims 1 or 2 is introduced into the chassis bacteria and overexpressed, so as to construct a genetically engineered bacterium with high production of D-pantothenic acid.

8. The method according to claim 7, characterized in that The bottom plate bacteria is Escherichia coli W3110 , Trc-panCpanEpanBilvC / ilvG* / Δ avtA / ilvE* / coaA* / Δ ilvA / Trc-lpd / Δ glk / ilvA* / Trc-pck / Trc-maeB / Trc-ilvBN / gdhA* T .

9. The genetically engineered bacteria for high production of D-pantothenic acid obtained by the method of claim 7.

10. Use of the genetically engineered bacteria with high D-pantothenic acid production as claimed in claim 9 in the preparation of D-pantothenic acid by microbial fermentation.

Images