Fecal sample filtering separation method, filtering assembly and DNA extraction method

Abstract

According to the fecal sample filtering and separating method, the filtering assembly and the DNA extraction method, rapid filtering and separating of the fecal sample are achieved through the filtering procedure with at least two layers of specific filtering apertures, cfDNA in supernate of the fecal sample filtered through the filtering procedure, and the cfDNA in the supernate of the fecal sample filtered through the filtering procedure is high in cfDNA extraction efficiency. The separation quality can reach or even be superior to that of a high-speed centrifugal separation method, and the requirement of DNA methylation detection of intestinal tumors can be met. The filtering method is combined with the filtering assembly, so that automatic extraction from the excrement sample to DNA can be realized.

Description

Technical Field

[0001] The present application belongs to the field of medical testing, and more specifically, relates to a filtration separation method for fecal samples, a filtration component, and a DNA extraction method. Background Art

[0002] The detection and analysis of cfDNA (cell-free DNA) in stool samples is currently an effective method for diagnosing intestinal diseases. In the cfDNA detection method of stool samples, the stool samples must first be pre-treated by solid-liquid separation to remove impurities, thereby facilitating the subsequent extraction and purification of cfDNA. The quality of the solid-liquid separation process will directly affect the quality of cfDNA.

[0003] At present, the commonly used method for solid-liquid separation and impurity removal of fecal samples is centrifugation, that is, adding the fecal sample dilution into a centrifuge tube, using a centrifuge for high-speed centrifugation, and then using a pipette to remove the supernatant from the centrifuge tube for subsequent DNA extraction, transformation and other processes. However, this method requires a certain amount of operation time, the number of samples processed by the centrifuge at one time is limited, and it is restricted by objective conditions such as equipment and site. Conventional sampling tubes cannot enter high-speed centrifuges, so the centrifugal separation of fecal samples requires manual removal of samples from the sampling tube and placing them in a centrifuge tube suitable for high-speed centrifuges. This process is highly dependent on manual labor, which reduces the efficiency of sample processing. In addition, centrifugation is more suitable for separating impurities with higher density, and cannot effectively separate some impurities with lower density. Summary of the invention

[0004] In view of the defects of the prior art, the purpose of this application is to provide a filtration separation method, a filtration component and a cfDNA extraction method for fecal samples, which can improve the solid-liquid separation efficiency of fecal samples, reduce manual operation steps, and facilitate the full-process automated processing of fecal samples from sampling tubes directly to DNA detection samples.

[0005] To achieve the above objectives, this application provides the following technical solutions:

[0006] A method for filtering and separating a stool sample, comprising:

[0007] The object to be filtered containing the fecal sample is subjected to a filtering process using a filter element to obtain a separated filtrate and a filter residue;

[0008] Wherein, the object to be filtered is a solid-liquid mixture;

[0009] The filtering procedure includes a first filtering procedure and a second filtering procedure which are performed sequentially;

[0010] The filtration pore size of the first filtration procedure is 100-425 μm;

[0011] The filtration pore size of the second filtration procedure is 3-20 μm.

[0012] In some embodiments, the solid content of the material to be filtered is 2% to 20%.

[0013] In some embodiments, in the object to be filtered, the filter element includes a first filter layer and a second filter layer, the first filter layer is used to implement the first filtering procedure, and the second filter layer is used to implement the second filtering procedure.

[0014] In some embodiments, the object to be filtered undergoes the filtering procedure under the action of mechanical force; preferably, the mechanical force is selected from one or more of oscillation, pressing, and suction filtration.

[0015] In some embodiments, the mechanical force includes a force that presses the filter element toward the object to be filtered, and the pressure applied to the filter element is 0.02-0.5 MPa, preferably 0.1-0.25 MPa.

[0016] In some embodiments, the method includes: applying the pressing force to the filter element toward the object to be filtered to move the filter element toward the object to be filtered, and the object to be filtered passes through the first filter layer and the second filter layer in sequence to obtain the filtrate.

[0017] In some embodiments, the filtration pore size of the first filtration procedure is 100-300 μm, preferably 125-180 μm, and the filtration pore size of the second filtration procedure is 5-15 μm.

[0018] In some embodiments, the filter element is a polyamide mesh.

[0019] In some embodiments, the method further comprises the step of uniformly mixing the stool sample and stool preservation solution to form the material to be filtered.

[0020] The present application provides a filter assembly, comprising

[0021] a container having a first opening at an upper end for containing a solid-liquid mixture to be filtered; and

[0022] a filter tube, which can be accommodated in the container and is adapted to the container, the filter tube has a hollow cavity, the upper end of the cavity has a second opening, the bottom and / or side wall of the cavity are sequentially provided with a first filter layer and a second filter layer from the outside to the inside, so that the to-be-filtered material in the container can pass through the first filter layer and the filter layer in sequence;

[0023] The filtration pore size of the first filtration layer is 100-425 μm;

[0024] The filtration pore size of the second filter layer is 3-20 μm.

[0025] In some embodiments, the outer diameter of the filter tube is smaller than the inner diameter of the container, and the filter tube is coaxially arranged with the container opening facing upward; preferably, the filter tube is configured to be able to slide up and down along the inner wall of the container.

[0026] In some embodiments, a sealing ring is provided on the side wall of the filter tube, and when the filter tube slides in the container, the sealing ring is used to fluid-seal the gap between the filter tube and the inner wall of the container.

[0027] In some embodiments, the container is provided with a cover adapted to the first opening for sealing the first opening; preferably, the cover is adapted to both the first opening and the second opening.

[0028] In some embodiments, the filtration pore size of the first filter layer is 100-300 μm, preferably 125-180 μm, and the filtration pore size of the second filter layer is 5-15 μm.

[0029] The present application also provides a method for extracting cfDNA from a stool sample, comprising:

[0030] Filtering the stool sample by the method described above, or filtering through the filtering component described above, to obtain a filtrate; and

[0031] cfDNA was extracted from the filtrate.

[0032] In some embodiments, the extraction method is performed in an automated device, which is configured to automatically perform a filtration procedure and automatically collect the filtrate to perform the step of extracting cfDNA.

[0033] Beneficial effects:

[0034] The present application provides a method for filtering and separating stool samples, which realizes rapid filtering and separation of stool samples through at least two layers of filtering procedures with specific filter pore sizes. The cfDNA in the supernatant of the stool sample filtered through the filtering procedure can reach or even exceed the quality of separation by high-speed centrifugation separation, and can meet the requirements of intestinal tumor DNA methylation detection.

[0035] The present application also provides a filter assembly, which can be used to implement the aforementioned stool sample filtering and separation method. The filter assembly has a simple structure and can be simply manufactured in a form that is compatible with various existing sampling tubes without the need to produce additional sampling tubes.

[0036] The feces sample filtration and separation method and filtration component of the present application can be integrated and applied to an automated sample processing system and an automated DNA extraction system. The automated processing platform can realize processes such as sample filtration, filtrate collection, and DNA extraction and purification. It can easily realize a fully automatic solution in which the feces sample sampling tube directly enters the system and directly outputs the material to be tested. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 It is a schematic diagram of the overall assembly structure of the filter assembly provided in an embodiment of the present application;

[0038] Figure 2 It is a structural schematic diagram of a filter assembly push-type filter tube provided in an embodiment of the present application without a cylindrical filter screen installed;

[0039] Figure 3 It is an exploded view of a push-type filter tube in a sample tube of a filter assembly provided in an embodiment of the present application;

[0040] Figure 4 This is a fully automatic sample processing process provided by the embodiment of the present application;

[0041] Figure 5 It is a structural schematic diagram of a workbench of a fully automatic sample processing device provided by the present invention;

[0042] Figure 6 is a schematic structural diagram of a translation component of a fully automatic sample processing system provided by the present invention;

[0043] Figure 7 It is a structural schematic diagram of a material taking mechanism of a fully automatic sample processing system provided by the present invention;

[0044] Figure 8 is a structural schematic diagram of a fully automatic sample processing system provided by the present invention;

[0045] Fig. 9 It is a structural schematic diagram of a sample tube clamping mechanism of a fully automatic sample processing system provided by the present invention; DETAILED DESCRIPTION

[0046] In order to make the purpose, technical solution and advantages of the present application more clearly understood, the present application is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0047] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application belongs. The terms used herein in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application.

[0048] The term "and / or" includes any and all combinations of one or more of the associated listed items.

[0049] The "feces" herein includes feces derived from mammals, and may be intestinal excrement of primates or non-primate mammals, for example, intestinal excrement derived from humans.

[0050] Herein, "sample" and "sample" are used interchangeably and refer to substances to be processed or detected, mainly feces in this article, or solutions, preparations, etc. in various forms including feces or derived from feces. It also includes fecal samples containing cfDNA obtained from individuals. The sample can be obtained by any suitable method. The term also includes samples that have been treated in any way after sample collection, such as samples treated with reagents, washing or enrichment of specific types of molecules (e.g., methylated cfDNA biomarkers). In some embodiments, the fecal sample is a mixture of feces and other substances, such as a mixture of water, feces preservation solution, or other substances that can be used to disperse feces and feces.

[0051] The centrifugation method has limitations such as equipment restrictions and manual operation, and the centrifuge is difficult to integrate into systems such as automatic DNA extractors. The centrifugation method is inefficient in processing fecal samples. In addition, the composition of feces is complex and contains many types of impurities. The centrifugation method can only separate impurities with higher density, and cannot effectively separate some impurities with lower density and lighter weight.

[0052] The present application provides a filtration separation method for a stool sample, comprising:

[0053] The object to be filtered containing the fecal sample is subjected to a filtering process using a filter element to obtain a separated filtrate and a filter residue;

[0054] Wherein, the object to be filtered is a solid-liquid mixture;

[0055] The filtering procedure includes a first filtering procedure and a second filtering procedure which are performed sequentially;

[0056] The filtration pore size of the first filtration procedure is 100-425 μm;

[0057] The filtration pore size of the second filtration procedure is 3-20 μm.

[0058] In the filtration separation method of the present application, for human fecal samples, both the first filtration procedure and the second filtration procedure are necessary. The first filtration procedure is used to remove larger particles of solid impurities, and the second filtration procedure is used to further remove smaller particles of solid impurities and some suspended small particles or flocculent impurities. If only the first filtration procedure or only the second filtration procedure is used, the filtration purpose cannot be achieved due to frequent clogging of the filter holes or low purity of the filtrate.

[0059] The specific filter pore size can ensure that the impurities not needed for DNA testing are removed as much as possible, and the intestinal exfoliated cells and cfDNA are retained in the filtrate as much as possible. If the filter pore size of the first filter program is less than 100μm, the impurities in the stool sample can easily clog the filter holes, resulting in the first filter program not being able to proceed smoothly; if the filter pore size of the first filter program is too large, it cannot effectively intercept large particles of impurities, resulting in the filter layer of the second filter program being easily clogged and unable to achieve the purpose of filtering. In some embodiments, the filter pore size of the first filter program is 125-300μm, or 150-180μm, and the filter pore size of the second filter program is 5-15μm. This filter pore size can effectively separate unnecessary impurities, including light floating objects or flocs, retain cfDNA from exfoliated cells as much as possible, and is particularly suitable for DNA methylation detection.

[0060] In some embodiments, the filtrate containing a fecal sample is a solid-liquid mixture containing feces. The solid components include dietary fiber, bacteria, fat, protein and other undigested or incompletely digested food residues often contained in human fecal samples. To ensure the feasibility of the filtration procedure, the filtrate can be configured as a solid-liquid mixture with a solid content (wt%) of 2% to 20%, such as 2.5% to 20%, 4% to 10%, and 5% to 12%. When the solid content is too high, the viscosity of the filtrate is large, it is easy to clog the filter screen, it is difficult to obtain enough filtrate, and the filtration efficiency is reduced. When the solid content is too low, the target detection object contained in the filtrate is too little, and feces preservation solution, TE buffer, and purified water can be added to achieve the above-mentioned solid content of the solid-liquid mixture.

[0061] The filtering process can be implemented by two or more independent filter elements, for example, the object to be filtered is filtered through a first filter element, and the filtrate of the first filter element is filtered through a second filter element. As another embodiment, the filtering process can be implemented by a filter element, which is provided with a first filter layer and a second filter layer, and the object to be filtered passes through the first filter layer and the second filter layer in sequence to obtain a filtrate.

[0062] The filtration procedure may further include a third filtration procedure, a fourth filtration procedure, ... an Nth filtration procedure. However, when there are more than three filtration procedures, the filtration time may be too long or the filtrate obtained may be too little.

[0063] In some embodiments, after the filtration process, a centrifugation process may be further included, that is, the filtrate is subjected to high-speed centrifugation at 8000× to 12000×.

[0064] In order to facilitate the filtration, mechanical force may be applied to the filtrate to promote the filtrate to pass through the filter holes of the filter element. The mechanical force that can be applied is not particularly limited, and may be any force that promotes the filtrate to pass through the filter holes, such as one or more of oscillation, pressing, and suction filtration (vacuum suction). In some embodiments, pressing may provide a faster filtration process.

[0065] As an implementation method, pressure may be applied to the filter material by means of filter pressing, so that the filtrate passes through the filter layer under the action of the squeezing force. However, it is better to apply a pressing force to the filter element toward the filter material to be filtered, so that the filter element moves toward the filter material to be filtered, and the filter material sequentially passes through the first filter layer and the second filter layer to obtain the filtrate. As a specific example, the filter material to be filtered is placed in a container, and a pressing force is applied to the filter element from top to bottom toward the filter material to be filtered, so that the filter element moves from top to bottom toward the filter material to be filtered, and the filter material sequentially passes through the first filter layer and the second filter layer to obtain the filtrate. This filtering method can avoid compacting the filter residue on the filter screen surface at the beginning of the filtering process, improve the blockage of the filter holes, and effectively promote the filtrate to pass through the filter screen.

[0066] During the filtering process, the pressure applied to the filter element is 0.02-0.6 MPa, such as 0.02-0.5 MPa, 0.05-0.3 MPa, 0.1-0.25 MPa, or 0.1-0.2 MPa. In some embodiments, the magnitude of the mechanical force applied to the filter element is between 20 and 400 N, such as 35-200 N, 60-180 N, 70-150 N, or 70-110 N. If the pressure is too high, liquid may be ejected, causing pollution.

[0067] In order to realize the above-mentioned method for filtering and separating stool samples, the present application also provides a filtering component, including a container and a filter tube, the upper end of the container has a first opening, and the container is used to accommodate a solid-liquid mixture to be filtered; the filter tube can be accommodated in the container and adapted to the container, the filter tube has a hollow cavity, the upper end of the cavity has a second opening, and the bottom and / or side walls of the cavity are sequentially provided with filter elements from the outside to the inside, the filter element includes a first filter layer and a second filter layer, and can make the filter in the container pass through the first filter layer and the filter layer in sequence; the filter pore size of the first filter layer is 100-425μm; the filter pore size of the second filter layer is 3-20μm.

[0068] The outer diameter of the filter tube is smaller than the inner diameter of the container, and the filter tube is coaxially arranged with the container opening facing upward. When using the filter assembly, the object to be filtered is placed in the container, and then the filter tube is placed in the container. In one embodiment, there is a gap between the side wall of the filter tube and the side wall of the container. Under the action of oscillation, the part of the object to be filtered that can pass through the aperture of the filter element passes through the first filter layer and the second filter layer and enters the hollow cavity of the filter tube.

[0069] In another embodiment, the filter tube is configured to slide up and down along the inner wall of the container. When filtering, the object to be filtered is placed in the container, and then the filter tube is placed in the container and pushed downward to move the filter element toward the object to be filtered. Under the downward pressure of the filter tube, the portion of the object to be filtered that can pass through the aperture of the filter element passes upward through the first filter layer and the second filter layer and enters the hollow cavity of the filter tube. The side wall of the filter tube may be provided with a sealing ring; when the filter tube slides on the inner wall of the container, the sealing ring is used to fluid-seal the gap between the filter tube and the inner wall of the container.

[0070] The container is provided with a cover adapted to the first opening for sealing the first opening. The cover can be configured to be adapted to the first opening and the second opening at the same time, so that when no filtering is performed, the container can be sealed with the cover, and when filtering is performed, the filter tube is placed in the container, and the gap between the filter tube and the inner wall of the container is sealed by a sealing ring, and the cover can be used to seal the second opening of the filter tube, so that the filter assembly forms a closed whole and can prevent liquid from leaking out. After the filtrate is sucked out from the hollow cavity of the filter tube, the cover can also be used to seal the second opening of the filter tube and the filter assembly containing the filter residue can be processed as a whole.

[0071] In some embodiments, the container may be a stool sample sampling tube, such as a 50 mL centrifuge tube or other forms of stool sample sampling tubes, so that the sampler can directly filter the stool sample in the sampling tube using a filter tube after completing the sampling.

[0072] As an exemplary embodiment, the filter assembly has the following Figure 1-Figure 4The structure shown in the figure provides a push-type filter assembly, including a sampling tube 110 and a push-type filter tube 121, wherein the sampling tube 110 is used to accommodate a sample; the push-type filter tube 121 includes a filter portion 122 at the lower end and a tube body 123 at the upper end, wherein the filter portion 122 includes multiple layers of coaxially arranged cylindrical filter screens 124, and the aperture of the cylindrical filter screens 124 decreases from the outside to the inside, and is used to perform multi-layer solid-liquid separation on the sample to obtain a filtrate; a sealing ring 1 is circumferentially arranged at the top of the filter portion 122 25, the sealing ring 125 is connected to the outermost cylindrical filter screen 124, and when in use, it abuts against the inner wall of the sampling tube 110, and is used to seal the gap between the inner wall of the sampling tube 110 and the outer wall of the press-type filter tube 121; the tube body 123 is concentrically connected to the innermost cylindrical filter screen 124, and is used to contain the filtrate obtained after filtration; the press-type filter tube is configured to be able to extend into the sampling tube 110 along the length direction and can slide along the inner wall of the sampling tube 110 to achieve solid-liquid separation of the sample by pressing. Specifically, the filter part 122 includes less than or equal to three layers of cylindrical filter screens 124, preferably two layers of cylindrical filter screens 124, wherein the pore size of the outer layer of cylindrical filter screen 124 is 100μm to 425μm, and the pore size of the inner layer of cylindrical filter screen 124 is 3μm to 20μm, and the outer side of each layer of cylindrical filter screen 124 is provided with a reinforcing connecting rib 126 for support.

[0073] During operation, a stool sample formed by mixing stool and preservation fluid is added into the sampling tube 110 , and then the push-type filter tube 121 is vertically inserted along the inner wall of the sampling tube 110 . The liquid in the stool sample passes through the cylindrical filter mesh 124 under pressure, and the filtrate enters the interior of the cylindrical filter mesh 124 and the tube body 123 .

[0074] Based on the above-mentioned filtration method and filtration component, the present application also provides a method for extracting cfDNA from a stool sample, comprising filtering the stool sample using the above-mentioned method, and then extracting cfDNA from the filtrate.

[0075] As an embodiment, the extraction method is performed in an automated device, which is configured to automatically perform a filtration process and automatically collect the filtrate to perform the step of extracting cfDNA.

[0076] In one embodiment, an automated device including a filtration module and an integrated DNA extraction module may be used. In the automated device, a manipulator is provided, which can realize the opening or taking of the sampling tube, and a manipulator for taking and pressing the filter tube may also be provided. The filter tube is placed in the sampling tube and pressed downward by the manipulator to achieve filtration, and then the filtrate is sucked from the filter tube by the pipetting mechanism and transferred to the DNA extraction module for DNA extraction. It can be understood by those skilled in the art that the DNA extraction module may include necessary mechanical mechanisms and control systems such as the orifice plate placement area, the reagent placement area, and the EP tube opening mechanism.

[0077] In one embodiment, the automated device may further include a module for performing a bisulfite conversion reaction.

[0078] As a specific embodiment, the automation device can implement the following Figure 4 The procedure shown.

[0079] In a specific embodiment, the present application also provides a device for implementing the above-mentioned automation program, such as Figure 5-Figure 9 As shown, it includes a workbench 1, a support 2 is provided on the workbench 1, a translation assembly 3 is horizontally provided on the support, and a sample tube storage area 4, a sample addition reaction area 5 and a gun tip storage area 6 are provided in sequence from left to right on the front side of the support 2, wherein the sample tube storage area 4 is provided with a sample tube rack 41 and a sample tube clamping mechanism 42, and a first oscillation mechanism is provided below the sample tube rack 41, which can drive the sample tube rack to oscillate, so that the sample oscillation is uniform. In one embodiment, the sample tube storage area 4 or the sample addition reaction area 5 is also provided with a filter tube storage area, which can be used to store the filter tube 112 or the press-type filter tube 121.

[0080] In order to facilitate the taking and placing of sample tubes, and to cooperate with the sample tube clamping mechanism 42 to rotate and open and close the sample tube cover, a material taking mechanism 7 is provided above the sample tube rack 41, and the material taking mechanism 7 can move left and right under the drive of the translation component 3; the sample addition reaction area 5 is provided with a centrifuge tube rack 51 and a reagent storage box 52, and the reagent storage box 52 is provided with one or more storage areas for storing different detection reagents.

[0081] In this embodiment, in order to improve the sample processing efficiency, the number of centrifuge tube racks 51 is multiple, and the number of sample tube clamping mechanisms 42 is also multiple, so that multiple groups of samples can be processed simultaneously, and the corresponding number can be adjusted according to actual detection needs; centrifuge tubes (for example, the centrifuge tubes are EP tubes) are evenly distributed on the centrifuge tube rack 51, and the centrifuge tubes are used as reaction vessels to add samples and detection reagents and react. In order to promote the reaction of samples and detection reagents, a second oscillation mechanism is provided below the centrifuge tube rack 51; the gun tip storage area 6 is provided with a gun tip rack 61, and pipetting gun tips 62 are evenly distributed on the gun tip rack 61. A pipetting mechanism 8 is provided above the gun tip rack 61, and the pipetting mechanism 8 and the material taking mechanism 7 are arranged in parallel, and move left and right synchronously under the drive of the translation component 3; Figure 1 As shown, the pipetting mechanism 8 is used to automatically absorb the sample in the sample tube, the reaction reagent in the reagent storage box 52, and the sample in the centrifuge tube that has completed the reaction with the detection reagent. Specifically, the first oscillation mechanism and the second oscillation mechanism can be implemented using solutions known in the art, such as an oscillation mechanism of a shaking table. In one embodiment, the oscillation mechanism includes an oscillation drive motor connected to the sample tube rack, which can drive the sample tube rack to oscillate, and drive the sample tube or centrifuge tube to perform mixing oscillation.

[0082] For details, see Figure 6 The translation assembly 3 includes a motor 31 and a rotating shaft 32 vertically mounted on the side wall of the bracket 2, wherein the motor 31 is used as a power output element, and a driving pulley is fixed on its output shaft. At the same time, a driven pulley is provided on the rotating shaft 32, and a synchronous belt 33 is tensioned and connected between the driving pulley and the driven pulley; in order to facilitate the movement of the material picking mechanism 7 and the liquid transfer mechanism 8, a clamping block assembly 34 for fixedly connecting with the material picking mechanism 7 and the liquid transfer mechanism 8 is provided on the synchronous belt 33, such as Figure 2 As shown, the clamping block assembly 34 and the synchronous belt are clamped and fixed. In order to facilitate the guidance of the movement of the material picking mechanism 7 and the liquid transfer mechanism 8, a guide rail 35 is also provided on the bracket 2, and the sliders on the guide rail 35 are fixedly connected to the material picking mechanism 7 and the liquid transfer mechanism 8 respectively.

[0083] In this embodiment, if Fig. 9 As shown, the sample tube clamping mechanism 42 includes a base 421 , on which a clamping jaw motor 422 is vertically provided.

[0084] Further, such as Figure 5 and Figure 7 As shown, the material taking mechanism 7 includes a first driving component 71 and a first lifting component 72, wherein the first driving component 71 and the translation component 3 have the same structure, and both use a motor synchronous belt to realize linear motion. Assuming that the motion direction of the translation component 3 is the X axis, the motion direction of the first driving component 71 is the Y axis, and the motion direction of the first lifting component 72 is the Z axis, the first driving component 71 can drive the first lifting component 72 to move forward and backward along the Y axis direction, and the output end of the first lifting component 72 is provided with a rotating jaw component 73 for clamping the sample tube and rotating to open the sample tube cover. In this embodiment, the rotating jaw component 73 includes a rotating jaw motor 731, and a clamping block 732 is provided at the output end of the rotating jaw motor. At the same time, in order to facilitate the recording of the information of the sample tube, a QR code is attached to the sample tube, and a code scanning component 74 for scanning and recording the clamped sample tube is fixedly provided on the first lifting component 72. In this embodiment, the code scanning component 74 uses a common QR code image scanner.

[0085] Specifically, Figure 7 As shown, the first lifting assembly 72 includes a vertically arranged fixed plate 721, on which linear guide rails 722 are symmetrically arranged, and a connecting plate 723 for installing the rotating clamping jaw assembly 73 is fixed on the slider of the linear guide rail 722. A lifting motor 724 is also provided on the fixed plate 721, and a lead screw 725 is connected to the output end of the lifting motor 724. The lead screw 725 and the connecting plate 723 are threadedly connected. When the lifting motor 724 is working, the connecting plate 723 is driven to rise and fall through the lead screw 725.

[0086] like Figure 1As shown, the liquid transfer mechanism 8 includes a second drive assembly 81 and a second lifting assembly 82, wherein the second drive assembly 81 and the first drive assembly 71 have the same structure, the second lifting assembly 82 and the first lifting assembly 72 have the same structure, or the second lifting assembly 82 uses an electric cylinder as a power element. The second drive assembly 81 can drive the second lifting assembly 82 to move forward and backward along the Y-axis direction, and the output end of the second lifting assembly 82 is provided with a liquid transfer gun 83 and a centrifuge tube opening assembly 84. Among them, the liquid transfer gun 83 is a standard part known in the industry, and the lower end of the liquid transfer gun 83 is provided with a suction head, which can realize the automatic disassembly and assembly of the liquid transfer gun head 62 under pressure. When the liquid transfer gun head 62 needs to be installed, the liquid transfer gun 83 is aligned with the liquid transfer gun head 62 under the drive of the second drive assembly 81, and the second lifting assembly 82 drives the liquid transfer gun 83 to move downward to sleeve the liquid transfer gun head 62 on the liquid transfer gun 83.

[0087] In one embodiment, the device can perform the following procedures when in operation.

[0088] 1. Add stool sample preservation solution into the sampling tube 110, take a sample and add it into the stool preservation solution, and cover the tube tightly.

[0089] 2. Place the sampling tube 110 on the sample tube rack 41. The material taking mechanism 7 clamps a sampling tube 110 from the sample tube rack 41, moves to the code scanning component 74 to scan the code, obtains the information on the sampling tube 110 and records the data.

[0090] 3. The material taking mechanism 7 transports the sampling tube 110 to the sample tube clamping mechanism 42 to clamp the lower part of the sample tube, and the rotating jaw assembly 73 opens the cover of the sampling tube 110. The rotating jaw assembly 73 grabs the press-type filter tube 121 and inserts it into the sampling tube 110. The sample liquid is filtered by pressing and a complete sample tube is obtained;

[0091] 4. The pipetting mechanism 8 directly moves to the tip box to install the pipette tip 62, and then moves to the sample tube clamping mechanism 42, sucks the filtered sample liquid from the opening of the tube body 123 of the push-type filter tube 121, and fills it into the opened EP tube, and then moves to the trash can to discard the used pipette tip 62 into the trash can; then, the material taking mechanism 7 puts the sample tube back to the sample tube rack 41, and takes the next sampling tube 110 to start the next processing cycle;

[0092] 5. The pipetting mechanism moves to the tip box to install a new pipette tip, and then moves to the reagent storage area to absorb the lysing agent and add it to the EP tube, then discards the pipette tip 62 and closes the EP tube; sets the reaction temperature of the heating temperature control module, turns on or off the second oscillation mechanism according to the reaction needs, and performs the reaction;

[0093] 6. The centrifuge tube cover opening mechanism opens the EP tube, the pipetting mechanism moves to the tip box to install a new pipette tip 62, and then moves to the reagent storage area to absorb the magnetic bead suspension and add it to the EP tube, and then close the EP tube and start the second oscillation mechanism to capture the magnetic beads. After the reaction is completed, the magnetic separation module is turned on to adsorb the magnetic beads at a position of the EP tube;

[0094] 7. The centrifuge tube cover opening mechanism opens the EP tube, the pipetting mechanism moves to the tip box to install a new pipette tip, and moves to the EP tube rack to absorb the supernatant from the EP tube and discharge the supernatant into the trash can to complete the solid-liquid separation, and discard the pipette tip.

[0095] Based on the above methods and devices, unwanted impurities, including light floating matter or floccules, can be separated from stool samples, and cfDNA from exfoliated cells can be retained as much as possible. In addition, there is no need to use a centrifuge, and the filtration process can be integrated with DNA extraction, bisulfite conversion and other procedures in an automated device, realizing a fully automated process from the sampling tube directly to the output of the DNA sample to be tested.

[0096] To further illustrate the technical solution, application and technical effects of the present application, specific embodiments are described below.

[0097] Example 1

[0098] Stool samples were filtered using different filtration procedures.

[0099] 1. Sample preparation: 300g human fecal sample and fecal sample preservation solution were mixed evenly at a mass volume ratio (g:mL) of 1:3 to prepare fecal dilution solution with a solid content of 8.6%. Each 20mL portion was used as the material to be filtered. Another 10mL of fecal dilution solution was taken into a clean 15mL centrifuge tube for later use. Fecal sample preservation solution (ingredients: 300mmol / L EDTA, 200mmol / LTris·HCl and 150mmol / LNaCl, pH 9.0).

[0100] 2. Sample filtration: The fecal dilution is filtered naturally through a filter with a preset aperture under the action of gravity. According to Table 2, the fecal dilutions of different groups pass through the first filter layer, the second filter layer (if any) and the third filter layer (if any) in turn, and the filtrate is collected. The filtration can be terminated if no filtrate drips out for 10 consecutive minutes.

[0101] The fecal dilution in a 15 mL centrifuge tube was centrifuged at 3500 × g for 10 min.

[0102] 3. DNA Extraction

[0103] DNA was extracted from the collected filtrate to extract DNA from human exfoliated cells.

[0104] (1) Adsorption: Take 5 mL of filtrate or supernatant after centrifugation and transfer it to a new centrifuge tube. If the filtrate is less than 5 mL, add purified water to make up the difference. Add PVPP (final concentration of 50 mg / mL) for adsorption treatment, vortex to mix thoroughly, and centrifuge at 3500 × g for 10 min.

[0105] (2) Binding: Transfer the supernatant to a new 15 mL centrifuge tube, add an equal volume of 5 mol / L guanidine thiocyanate to the supernatant, and gently invert to mix.

[0106] (3) Nucleic acid denaturation: Place in a 90°C water bath for 10 min and remove immediately.

[0107] (4) Hybridization incubation: Add 5 μL of ACTB capture agent, invert to mix, and incubate at room temperature for 40 min; the capture agent is a magnetic bead capture solution combined with a biotin-streptavidin capture probe, and the capture probe sequence is: ATTGGCAAGAGCCCGGCTCAGACAAAGACCC.

[0108] (5) Magnetic separation: Magnetic separation for 5 min and discard the supernatant.

[0109] (6) Rinse: Add 1 mL of buffer C (EDTA (pH 8.0, 5 mM), Tris-HCl (pH 8.0, 20 mM)) to a 2 mL centrifuge tube, shake and mix for 5 seconds, place on a magnetic stand and absorb for 2 minutes, discard the supernatant, and repeat once.

[0110] (7) Elution: Add 40 μL of elution buffer TE to a 2 mL centrifuge tube, gently shake to mix, and transfer the supernatant to a clean centrifuge tube to obtain the desired DNA solution.

[0111] 4. DNA testing

[0112] The β-actin gene (ACTB) was detected by fluorescent PCR. The primers and probes for β-actin were as follows:

[0113] β-actin forward primer 5'-3'CAAGATGAGATTGGCATGGCT (SEQ ID NO.1)

[0114] β-actin reverse primer 5'-3'TGTGAACTTTGGGGGATGCTC (SEQ ID NO.2)

[0115] β-actin probe 5'-3'CCAGTTTTTAAATCCTGAGTCAAGC (SEQ ID NO. 3), the fluorescent group is VIC, and the quenching group is MGB-NFQ;

[0116] ABI7500 was used for fluorescence PCR detection, and the PCR reaction system is shown in Table 1 below.

[0117] Table 1 PCR reaction system

[0118] Components Specification Volume (μL) <![CDATA[Taq PCR Buffer(15mM MgCl2)]]> 10× 2.5 dNTPs 2.5mM each 2 β-actin forward primer 10μM 0.5 β-actin reverse primer 10μM 0.5 β-actin probe 10μM 0.5 Hot Start Taq DNA Polymerase 5U / μL 0.5 DNA sample to be tested / 5 Purified water / Up to 25

[0119] The fluorescence PCR reaction conditions are shown in Table 2 below.

[0120] Table 2 PCR reaction conditions

[0121]

[0122]

[0123] Quality control and result reading: Negative and positive controls were tested simultaneously in each test, where the negative control was ultrapure water and the positive control was β-actin plasmid (concentration of 1×10 4 After each PCR, adjust the baseline and threshold, read the Ct value of the sample, and the negative control should have no obvious exponential growth period, the Ct value should be Undet / NoCt or Ct>40, the positive control should have an obvious exponential growth period, and the Ct value of β-actin should meet 26≤Ct≤30.

[0124] The filtration quality was evaluated according to the indicators in Table 3, and the CT value of ACTB in the filtrate was detected, as shown in Table 4.

[0125] Determination of solid content in stool sample dilution: After sampling the stool sample, take a certain mass (m0) of the original stool sample and measure its solid content p1 by drying method, and then calculate the solid content p2 of the stool dilution according to the mass ratio (m1:m2) mixed with the stool preservation solution, where the density of the stool preservation solution is calculated as 1g / mL, for example, 10mL of stool preservation solution has a mass of 10g. p2 = (m1×p1) / (m1+m2)×100%.

[0126] Table 3 Qualitative evaluation indexes of fecal dilution filtration effect

[0127]

[0128] Table 4 Filter layer pore size and filtration effect

[0129]

[0130] According to Table 2, when the pore size of the final filtration is below 20 μm, a filtrate with better clarity can be obtained, which can filter out most of the solid impurities. When a single-layer filter is used, the filter with a large pore size allows the filtrate to pass easily and more filtrate can be obtained, but it cannot effectively intercept impurities and the filtrate is turbid; when the pore size is below 20 μm, although a clearer filtrate can be obtained, the pores of the filter are easily blocked due to the small pore size, and the volume of filtrate obtained is very small.

[0131] When using two or three layers of screens, the screen with a larger filter aperture on the outer layer can effectively intercept larger solid or flocculent impurities, and the filtrate quickly passes through the first filter on the outer layer. However, when the aperture of the first filter on the outer layer is too large, large particles of impurities pass through the first filter, which can easily cause blockage of the second or third filter with a small aperture; when the aperture of the first filter on the outer layer is too small, it is easily blocked by impurities, resulting in low filtration efficiency and increased difficulty in operation. When a three-layer filter is used, due to the superposition of two consecutive layers of small-aperture filters, the resistance to the passage of the filtrate is greatly increased, the difficulty of the filtration operation is increased compared to the two-layer filter, and the overall volume of the filtrate is reduced. On the whole, at least two layers of filters are required to achieve the purpose of filtration.

[0132] Example 2

[0133] This embodiment provides a filtering component and a filtering program.

[0134] A filter assembly is used for filtration, and the filter assembly includes a filter tube and a sample tube. The filter tube includes a filter element 1 at the lower end and a tube body 2 at the upper end, wherein: the filter element 1 includes two or three layers of coaxially arranged cylindrical filter screens, and the pore size of the cylindrical filter screens decreases from the outside to the inside, and is used to perform multi-layer solid-liquid separation on the sample to obtain a filtrate; the tube body 2 is concentrically connected to the innermost cylindrical filter screen, and is used to contain the filtrate obtained after filtration.

[0135] When two layers of filter screens are provided, the outer filter screen can be coaxially arranged and fixed with the inner filter screen. The first connection part is integrated with the reinforcing connection rib of the inner filter screen, and the second connection part is integrated with the reinforcing connection rib of the outer filter screen. When three layers of filter screens are provided, the second filter screen and the third filter screen are connected and fixed with the same structure.

[0136] A sealing ring is arranged on the outside of the connection part of the outermost filter screen, and the sealing ring is used to seal the gap between the filter tube and the inner wall of the sample tube.

[0137] The sample tube is a 50mL centrifuge tube, and the filter tube (including the filter mesh) is made of polyamide and is integrally formed through a 3D printing process.

[0138] A stool sample from three different subjects was collected, and stool diluents were prepared according to the method of Example 1, marked as stool diluents 1, 2, and 3, with solid contents of 7.5%, 9.3%, and 5.6%, respectively. Each stool diluent was divided into 13 samples of 20 mL / portion and 1 sample of 1.8 mL. During filtration, 20 mL / portion of stool diluent sample was added to sample tube 3, and a press filter tube was assembled on sample tube 3. The filter part 1 was equipped with a cylindrical filter screen with different filter apertures (see the filter aperture in Table 4), and was slowly pressed manually to the bottom of sample tube 3 (Corning 43089750 mL vertical centrifuge tube, tube diameter of about 30 mm), so that the supernatant passed through each layer of the cylindrical filter screen in turn and entered the tube body 2, and the filtrate was sucked out from the tube body 2 with a pipette. The sample of 1.8 mL stool diluent was centrifuged at 10000× high speed for 2 min.

[0139] The filtrate was subjected to DNA extraction according to the DNA extraction steps in Example 2, and the CT value of the ACTB gene was detected according to the DNA detection method in Example 2. The experimental grouping settings and experimental results are shown in Table 5.

[0140] The filtrate was subjected to DNA extraction according to the DNA extraction steps in Example 1, and the CT value of the ACTB gene was detected according to the DNA detection method in Example 1. The experimental grouping settings and experimental results are shown in Table 5 below.

[0141] Table 5 Filtration effect of different fecal samples

[0142]

[0143] According to the above experiments, the CT value of ACTB of the filtrate obtained by the double-layer filter or triple-layer filter with an outer filter of 125-425μm and an inner filter of 5-20μm is equivalent to the CT value of the supernatant obtained by centrifugation, and the △Ct is basically around 1CT, indicating that the filtration device provided in this embodiment can achieve a solid-liquid separation effect equivalent to that of the existing centrifugal separation procedure. Among them, the CT value of the filtrate filtered by the double-layer filter with an outer filter of 125-180μm and an inner filter of 5-10μm is earlier or equivalent to that of centrifugation, indicating that more target DNA can be obtained in the filtrate, with better filtering effect. However, the three-layer filter has no significant improvement in DNA acquisition in the filtrate compared with the two-layer filter, and can only achieve an effect equivalent to that of the two-layer filter. This may be due to the increase in the number of filter layers, the filter is adsorbed too much due to surface tension, and the difficulty of filtration is greatly increased. The operator needs to press the filter tube vigorously, and the operation is difficult.

[0144] Example 3

[0145] This embodiment provides an optimized filtering procedure.

[0146] In addition, 150g of stool samples were collected from three different subjects (if one defecation is insufficient, two consecutive defecation samples can be collected, and each sample is immediately mixed with stool preservation solution at a ratio of 1:3), marked as stool diluent 4, 5, and 6, with solid contents of 7.7%, 6.2%, and 8.1%, respectively. The filtration assembly and filtration method of Example 2 were used for filtration, and DNA extraction and detection were performed. The difference is that two layers of filter screens are set, and the filter apertures are shown in Table 6 (where F15, F16, F17, F19, F20, and F21 are the same as Table 4), and the pressure applied to the filter tube by the mechanical arm is set to 0.13MPa for pressing (about 10kg of force, which is the force that can be applied manually by humans). The results are shown in Table 7.

[0147] Table 6 Filter layer pore size settings

[0148] Group First filter layer (μm) Second filter layer (μm) F46 100 20 F47 100 15 F48 100 10 F49 100 5 F50 100 3 F51 150 20 F52 150 15 F53 150 10 F54 150 5 F55 150 3 F56 200 20 F57 200 15 F58 200 10 F59 200 5 F60 200 3 F15 125 20 F61 125 15 F16 125 10 F17 125 5 F62 125 3 F19 180 20 F63 180 15 F20 180 10 F21 180 5 F64 180 3

[0149] Table 7 Filtration effect of double filter layers on different samples

[0150]

[0151] In the double-layer filter filtration process, the filtration purpose can be achieved in the case of a filter mesh aperture combination of 100-200μm + 5-20μm, and the target DNA can be detected. When the outer filter mesh aperture is 125-180μm and the inner filter mesh is in the range of 5-15μm, the filtration effect is the best, and the CT value is advanced relative to the centrifugation process, indicating that more target DNA is separated.

[0152] Example 4

[0153] This embodiment provides filtering procedures with different pressure levels.

[0154] 50g of stool samples were collected from three different subjects, and stool diluents were prepared according to the method of Example 1, marked as stool diluents 7, 8, and 9, with solid contents of 5.8%, 8.4%, and 6.7%, respectively. The filtration assembly and filtration method of Example 2 were used for filtration, and DNA extraction and detection were performed. The difference is that two layers of filter screens were set, the filter aperture setting was selected to be F20, and the pressure applied to the filter tube was set by the mechanical arm to be 0.05MPa~0.5MPa for pressing (about 35N~353N force). The results are shown in Table 8.

[0155] Table 8 Effect of different pressures on filtration effect

[0156]

[0157] Experiments show that when the pressure is too high, for example, greater than 0.35 MPa, the target DNA content in the filtrate decreases. This may be because the excessive pressure causes the polyamide filter to deform, and the impurities in the filtrate increase, causing adsorption and interference. But overall, they can be detected and the filtering purpose is achieved.

[0158] Example 5

[0159] This embodiment provides a filtration procedure for stool dilutions with different solid contents.

[0160] 50g of stool samples from three different subjects were collected, recorded as samples 10, 11, and 12, and the original sample solid contents were 34.5%, 27.5%, and 25.3%, respectively. The original stool samples were taken, and stool preservation solution was added to be configured as stool diluents with different solid contents, and 8g of original stool samples were prepared, as shown in Table 9. After preparation, 1.8mL was taken from each stool dilution as a centrifugal group, and the rest was used as a filtration group. The filtration assembly and filtration method of Example 2 were used for filtration, and DNA extraction and detection were performed. Two layers of filter screens were set, and the filter aperture setting selected F20, and the pressure applied to the filter tube was set by the mechanical arm to be 0.15MPa for pressing (a force of about 105N). The results are shown in Table 9.

[0161] Table 9 Filtration effect of filtration procedures on stool samples with different solid contents

[0162]

[0163] According to Table 9, when the solid content is too high, both the solid content and centrifugal separation are not as good as when the solid content is low. This may be due to too many solid impurities, which increase the difficulty of filtration and block the filter holes. Centrifugation is also difficult to precipitate excessive solid impurities, resulting in poor detection of target DNA. When the solid content is low, filtration treatment generally has a better separation effect than centrifugation, especially when the solid content is 5%-10%, the CT value of filtration treatment is about 1 ahead of centrifugation. This may be because within the solid content range, impurities can be better separated, and sufficient filtration can be ensured. Compared with centrifugation, filtration can remove more light impurities, and push-type filtration is faster, reducing the damage of PCR inhibitors to DNA. However, when the solid content is less than 2%, the CT value may be delayed due to too little target DNA content in the system.

[0164] Example 6

[0165] This example uses a filtering procedure to process clinical samples and conducts fecal DNA methylation detection.

[0166] A total of 237 stool samples were collected from a hospital in Wuhan and a hospital in Shanghai, of which 125 were from patients diagnosed with colorectal cancer by pathology, and 112 were normal samples from people with healthy gastrointestinal tracts. The samples were mixed with stool sample preservation fluid when they were collected to ensure effective sampling.

[0167] After sampling, each sample was divided into two equal parts, namely, a filtration group and a centrifugation group. The filtration group was filtered according to the filtration pore size of the F20 group and the force of 0.15 MPa (105N); the centrifugation group was centrifuged at 3500×10min.

[0168] Then, DNA extraction was performed according to step "3. DNA extraction" in Example 1; in addition to capturing the ACTB gene, capture agents for SDC2 and TFPI2 were also added.

[0169] Capture probe for SDC2: TGCTTCGGCACTCCCGTGTAACTCCTATG

[0170] Capture probe for TFPI2: AAACTTTCTCCTGTAGTCCAGACGGGGACG.

[0171] After DNA extraction, ZYMO RESEARCH's EZ DNA Methylation-Gold TM The kit was used to convert DNA into bisulfite, and the specific experimental operations were completed according to the instructions of the kit.

[0172] Methylation-specific PCR was used for detection, and the primer pairs and fluorescent probe sequences used were shown in Table 10. The PCR reaction system was referred to Table 1, and the primer pairs and detection probes of SDC2 and TFPI2 were added at 10 μM specifications, 0.5 μL each, with a total volume of 25 μL; the reaction conditions were shown in Table 2. The fluorescent group of the SDC2 probe was ROX, the fluorescent group of TFPI2 was FAM, and the quenching group was MGB-NFQ.

[0173] Table 10 Primer pairs and probe sequences for methylation-specific PCR

[0174] name Sequence 5'-3' Sequence number SDC2 Primer F CGAGTTTGAGTCGTAATCGTTGC SEQ ID NO.4 SDC2 Primer R TCCGCCGACACGCAAACCACCAAACC SEQ ID NO.5 SDC2 detection probe AACAAAACGAAACCTOCTACCCAAC SEQ ID NO.6 TFPI2 Primer F CGCGGAGATTTGTTTTTTGT SEQ ID NO.7 TFPI2 Primer R AACAAACATCGTOGCAAACCTC SEQ ID NO.8 TFPI2 detection probe ATAAAACCCGACAAAATCCG SEQ ID NO.9 β-actin Primer F CAAGATGAGATTGGCATGGCT SEQ ID NO.1 β-actin Primer R TGTGAACTTTGGGGGATGCTC SEQ ID NO.2 β-actm detection probe CCAGTTTTTAAATCCTGAGTCAAGC SEQ ID NO.3

[0175] Quality control: This test was designed with positive and negative controls. The negative control was TE buffer, and the positive control was a mixture of equal volumes of SDC2, TFPI2 methylation plasmids and β-actin plasmids. The SDC2 methylation plasmid was prepared by introducing the artificially synthesized DNA fragment of fully methylated chr8: 96494140-96494327 (GRCh38.p14) into the pMD18T vector, and the TFPI2 methylation plasmid was prepared by introducing the artificially synthesized DNA fragment of fully methylated chr7: 93890149-93890312 (GRCh38.p14) into the pMD18T vector. The concentrations of these three plasmids were 1×10 4 copies / μL. The negative control should have no obvious exponential growth period, and the Ct value should be Undet / NoCt or Ct>40. The positive control should have an obvious exponential growth period, and the Ct values ​​of SDC2, TFPI2 and β-actinactin should meet 26≤Ct≤30. In addition to the negative control and positive control, the Ct value of the internal reference gene of the test sample must meet Ct≤35; if the Ct value is >35, it means that the added sample DNA contains PCR inhibitors or the amount of DNA added is too little, and it is necessary to re-prepare DNA or increase the amount of DNA sample before testing. If the negative control, positive control and internal reference gene meet the above requirements, it means that this experiment is valid and the next step of sample result determination can be carried out. Otherwise, the experiment is invalid and must be re-tested.

[0176] Result determination: After PCR is completed, the baseline and threshold lines are set to obtain the Ct value of the target region in each sample amplified, and the data are exported and analyzed in combination with the amplification curve. If the Ct value of the SDC2 gene of the sample to be tested satisfies Ct≤38, the sample is SDC2 methylation positive; if Ct>38, the sample is SDC2 methylation negative; if the Ct value of the TFPI2 gene of the sample to be tested satisfies Ct≤38, the sample is TFPI2 methylation positive; if Ct>38, the sample is TFPI2 methylation negative. Only when SDC2 and TFPI2 are both methylation negative, it is judged as negative, and when at least one of SDC2 and TFPI2 is methylation positive, it is judged as positive.

[0177] Sensitivity = number of true positives / (number of true positives + number of false negatives) × 100%;

[0178] Specificity = number of true negatives / (number of true negatives + number of false positives) × 100%.

[0179] The sensitivity and specificity are shown in Table 11.

[0180] Table 11 Sensitivity and specificity results of clinical sample detection

[0181] Group Sensitivity Specificity Filter Group 92.00％ 95.53％ Centrifugal Group 92.80％ 93.75％

[0182] It can be seen from the testing of clinical samples that the stool sample filtration method provided in the embodiments of the present application can achieve a sensitivity and specificity comparable to that of the existing centrifugation method, and can be applied to the solid-liquid separation treatment of clinical stool samples before DNA testing.

[0183] It will be easily understood by those skilled in the art that the above description is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present application shall be included in the scope of protection of the present application.

Claims

1. A method for filtering and separating a stool sample, characterized in that: include: The object to be filtered containing the fecal sample is subjected to a filtering process using a filter element to obtain a separated filtrate and a filter residue; Wherein, the object to be filtered is a solid-liquid mixture; The filtering procedure includes a first filtering procedure and a second filtering procedure which are performed sequentially; The filtration pore size of the first filtration procedure is 100-425 μm; The filtration pore size of the second filtration procedure is 3-20 μm.

2. The method according to claim 1, characterized in that The solid content of the material to be filtered is 2% to 20%.

3. The method according to claim 1, characterized in that: The filter element includes a first filter layer and a second filter layer. The first filter layer implements the first filter procedure, and the second filter layer implements the second filter procedure.

4. The method according to any one of claim 3, characterized in that: The object to be filtered undergoes the filtering procedure under the action of mechanical force; preferably, the mechanical force is selected from one or more of oscillation, pressing, and suction filtration.

5. The method according to claim 4, characterized in that The mechanical force includes a force that presses the filter element toward the object to be filtered, and the pressure applied to the filter element is 0.02-0.5 MPa, preferably 0.1-0.25 MPa.

6. The method according to claim 5, characterized in that The method comprises: applying the pressing force to the filter element toward the object to be filtered, so that the filter element moves toward the object to be filtered, and the object to be filtered passes through the first filter layer and the second filter layer in sequence to obtain the filtrate.

7. The method according to any one of claims 1 to 6, characterized in that: The filtration pore size of the first filtration procedure is 100-300 μm, preferably 125-180 μm, and the filtration pore size of the second filtration procedure is 5-15 μm.

8. The method according to any one of claims 1 to 6, characterized in that: The filter element is a polyamide screen.

9. The method according to claim 1 or 2, characterized in that: The method further comprises the step of uniformly mixing the stool sample and the stool preservation solution to form the object to be filtered.

10. A filter assembly, characterized in that: include a container having a first opening at an upper end for containing a solid-liquid mixture to be filtered; and a filter tube, which can be accommodated in the container and is adapted to the container, the filter tube has a hollow cavity, the upper end of the cavity has a second opening, the bottom and / or side wall of the cavity are sequentially provided with a first filter layer and a second filter layer from the outside to the inside, so that the to-be-filtered material in the container can pass through the first filter layer and the filter layer in sequence; The filtration pore size of the first filtration layer is 100-425 μm; The filtration pore size of the second filter layer is 3-20 μm.

11. The filter assembly according to claim 11, characterized in that The outer diameter of the filter tube is smaller than the inner diameter of the container, and the filter tube is coaxially arranged with the container opening facing upward; preferably, the filter tube is configured to be able to slide up and down along the inner wall of the container.

12. The filter assembly according to claim 11, characterized in that The side wall of the filter tube is provided with a sealing ring, and when the filter tube slides in the container, the sealing ring is used for fluid-sealing the gap between the filter tube and the inner wall of the container.

13. The filter assembly according to any one of claims 10 to 12, characterized in that: The container is provided with a cover adapted to the first opening for sealing the first opening; preferably, the cover is adapted to both the first opening and the second opening.

14. The filter assembly according to claim 10, characterized in that The filtration pore size of the first filter layer is 100-300 μm, preferably 125-180 μm, and the filtration pore size of the second filter layer is 5-15 μm.

15. A method for extracting DNA from a stool sample, characterized in that: include: Filtering the stool sample by the method described in any one of claims 1 to 9, or filtering by the filtering component described in any one of claims 10 to 14 to obtain a filtrate; and DNA was extracted from the filtrate.

16. The extraction method according to claim 15, characterized in that The extraction method is carried out in an automated device, which is configured to automatically perform a filtration procedure and automatically collect the filtrate to perform the step of extracting DNA.

Images