Application of DspckA gene in regulation and control of pathogenicity of D.segeticola and application of DspckA gene as bactericide target

Abstract

The invention discloses an application of DspckA in regulation and control of the pathogenicity of Didymeria segeticola and application of the DspckA as a bactericide target. The DspckA gene disclosed by the invention is derived from D.segeticola, and a knockout mutant is obtained by constructing a knockout gene segment of the DspckA gene and introducing the knockout gene segment into a D.segeticola protoplast. It is found through experiments that the DspckA gene plays a role in the pathogenicity of D.segeticola and the sensitivity of the DspckA gene to ningnanmycin. Molecular docking analysis and trace thermophoresis experiments prove that the DspckA protein can be used as a bactericide target and has interaction with ningnanmycin, and amino acids at T264, T265 and E306 are key binding sites. The DspckA can be used as a bactericide target and a key protein of a disease pathogenic mechanism, and has a wide application prospect in prevention and treatment of plant pathogenic fungal diseases.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to the application of the DspckA gene in regulating the pathogenicity of D. segeticola and as a fungicide target. Background Art

[0002] Didymella belongs to the family Didymellaceae, class Dothideomycetes, order Pleosporales, phylum Ascomycota. The fungi of this genus are pathogenic to some plants. Didymella segeticola is a plant pathogen in this genus that can cause a variety of plant diseases, especially harming a variety of economic crops and other important plant species, causing huge economic losses. For example, it can cause pepper leaf spot disease (Yang, JZ, Chen, CX, et al. Didymella segeticola is a new pathogen causing leaf spot disease on Zanthoxylum bungeanum. New Zealand Journal of Crop and Horticultural Science, 2022, 51: 694-703), tobacco leaf spot disease (Guo, ZN, Xie, HL, et al. Leaf spot caused by Didymella segeticola on tobacco in China. Plant Disease, 2019, 104: 1559-1560), tea leaf spot disease (Deng, XY, Yang, J., et al. Characteristics of leaf spot disease caused by Didymella species and the influence of infection on tea D. segeticola strain GZSQ-4 (China General Microbiological Culture Collection Center, strain collection number CGMCC3.20152) was isolated and identified by the inventor's research group from tea leaf spot disease in Shiqian County, Guizhou Province. The pathogen can infect new shoots, young leaves and mature leaves of tea trees, causing serious impact on the quality and yield of tea.

[0003] However, the research on the pathogenic biology of D. segeticola is still relatively weak at home and abroad, especially the lack of reports on the pathogenic mechanism and host defense response mechanism.Although there are some studies on the pathogen D. segeticola, and fungicides that can prevent and control D. segeticola have been screened in production, such as zhongshengmycin, shenqinmycin, griseofulvin, carvacrol and other biological pesticides (Ren, YF, Li, DX, et al. Integration of transcriptomic and proteomic data reveals the possible action mechanism of the antimicrobialzhongshengmycin against Didymella segeticola, the causal agent of tea leafspot. Phytopathology, 2021, 111: 2238-2249; Zhao, XZ, Chen, Z., et al. Investigating the antifungal activity and mechanism of a microbial pesticide shenqinmycin against Phoma sp. Pesticide Biochemistry and Physiology, 2018, 147: 46-50; Huang, HK, Li, DX, et al. Integrated transcriptome and proteome analysis reveals that the antimicrobial griseofulvin targets Didymella segeticola beta-tubulinto control tea leaf spot.Phytopathology,2023,113:194-205;Yin,JY,Wu,S.,etal.In addition to damaging the plasma membrane,phenolic monoterpenoidcarvacrol can bind to minor groove of DNA of Phytopathogenic fungi topotentially control tea leaf spot caused by Lasiodiplodiatheobromae. Phytopathology, 2023,114:700-716).However, the unclear pathogenicity and infection mechanisms of D. segeticola limit the development and application of fungicides. Therefore, it is very important to construct a D. segeticola insecticide target screening model and study the mechanism of action of fungicides.

[0004] Phosphoenolpyruvate carboxykinase gene family is widely present in a variety of organisms, including bacteria, protozoa and yeast. Some play a role in gluconeogenesis, especially in organisms where fatty acids are the main carbon source (Liu, K., Yu, J., Russell, DGpckA-deficient Mycobacterium bovis BCG shows attenuated virulence in mice and in macrophages. Microbiology, 2003, 149, 1829-1835). Some catalyze the conversion of oxaloacetate into phosphoenolpyruvate, which is the first step in the gluconeogenesis pathway and the key link connecting the tricarboxylic acid cycle and the glycolysis pathway. A phosphoenolpyruvate carboxykinase family gene (named DspckA) obtained from D. segeticola in the present invention is related to the pathogenicity of D. segeticola, and provides important data for a comprehensive understanding of the pathogenicity of D. segeticola, the prevention and control of diseases caused by D. segeticola and the breeding of disease-resistant plant varieties. Summary of the invention

[0005] In view of this, the present invention provides a phosphoenolpyruvate carboxykinase family gene, which is derived from Didymellasegeticola and is named DspckA in the present invention. The nucleotide sequence of the gene is shown in SEQ ID NO.1 or SEQ ID NO.2, and the encoded amino acid sequence is shown in SEQ ID NO.3. The gene can solve the problem of preventing and controlling the pathogen D.segeticola. Therefore, the specific purpose of the present invention is:

[0006] In the first aspect, the invention provides the use of the DspckA gene in regulating the pathogenicity of D. segeticola, or the sensitivity to Ningnanmycin, or in designing and screening antifungal drugs.

[0007] Furthermore, the regulation of the pathogenicity of D. segeticola and the sensitivity to Ningnanmycin is reduced. For example, after knocking out the DspckA gene in D. segeticola, the pathogenicity of D. segeticola is reduced, and the sensitivity to Ningnanmycin is also reduced.

[0008] In a second aspect, the invention provides the use of the DspckA gene in cultivating transgenic D. segeticola with reduced pathogenicity and / or reduced sensitivity to Ningnanmycin. For example, a knockout mutant of the DspckA gene can be constructed to obtain transgenic D. segeticola with reduced pathogenicity and reduced sensitivity to Ningnanmycin.

[0009] In a third aspect, a method for cultivating transgenic D. segeticola with reduced pathogenicity and / or reduced sensitivity to ningnanmycin is provided, the method comprising the step of reducing the expression level and / or activity of mRNA or protein of the DspckA gene in the recipient D. segeticola to obtain the transgenic D. segeticola.

[0010] Further, the reduction of the expression amount and / or activity of the mRNA or protein of the DspckA gene is achieved by knocking out or inhibiting or silencing the expression of the DspckA gene in the receptor D. segeticola. For example, by homologous recombination, the homologous recombination fragment used for homologous recombination is introduced into the protoplast of the receptor to knock out the DspckA gene in the receptor D. segeticola.

[0011] In a fourth aspect, the present invention provides the use of the above method in preventing and controlling diseases caused by D. segeticola. After reducing the expression level and / or activity of the mRNA or protein of the DspckA gene in the recipient D. segeticola, the pathogenicity of D. segeticola is reduced, thereby preventing and controlling the diseases caused by it.

[0012] In a fifth aspect, the invention provides the use of DspckA protein as a drug target in screening fungicides. DspckA protein is encoded by DspckA gene.

[0013] Furthermore, the amino acids T264, T265 and E306 in the DspckA protein were used as drug targets to screen fungicides.

[0014] In a sixth aspect, a method is provided for using Ningnanmycin as a fungicide component in preventing and controlling diseases caused by D. segeticola. Ningnanmycin interacts with DspckA protein, and the two have strong binding affinity. The binding of Ningnanmycin to DspckA protein changes the structure of DspckA protein, reduces or inhibits its activity, thereby inhibiting the harm of pathogens to plants.

[0015] In the seventh aspect, the invention provides the use of Ningnanmycin in regulating the structure or activity of DspckA protein.

[0016] The present invention provides an application of a phosphoenolpyruvate carboxykinase family gene DspckA derived from D.segeticola in regulating the pathogenicity of D.segeticola and the sensitivity to Ningnanmycin. After knocking out the DspckA gene in the wild-type D.segeticola, it was found that the pathogenicity of the knocked-out D.segeticola and the sensitivity to Ningnanmycin were significantly reduced. The DspckA protein of the present invention is encoded by the DspckA gene, and can be used as a drug target to screen fungicides. It interacts with the fungicide component Ningnanmycin, and the two have a strong binding affinity. The structural change, activity reduction or inhibition of the DspckA protein can be achieved by combining Ningnanmycin with the DspckA protein, thereby inhibiting the harm of pathogens to plants. Thus, DspckA can be used as a key protein of the fungicide target and the disease pathogenesis, and the amino acids at positions T264, T265 and E306 are key binding sites, which has broad application prospects in the prevention and treatment of plant pathogenic fungal diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Schematic diagram of the DspckA gene knockout and mutant screening strategy of D. segeticola of the present invention;

[0018] Figure 2 is a map of the plasmid pCT74 of the present invention;

[0019] Figure 3 This is the PCR electrophoresis diagram during the knockout detection of the present invention;

[0020] Figure 4 The results of the pathogenicity test of wild-type and ΔDspckA mutant mycelia of D. segeticola on tea leaves of the present invention are shown in FIG.

[0021] Figure 5 The colony diagram of the sensitivity of the wild type and ΔDspckA mutant of D. segeticola to Ningnanmycin of the present invention;

[0022] Figure 6 This is an analysis diagram of the inhibition rate of the Ningnanmycin agent of the present invention on the wild type and ΔDspckA mutant of D. segeticola;

[0023] Figure 7 This is a result diagram of the interaction between DspckA and Ningnanmycin analyzed by molecular docking technology in the present invention;

[0024] Figure 8 Schematic diagram of the CDS sequence point mutation strategy of D. segeticola;

[0025] Fig. 9The SDS-PAGE analysis diagram of the protein purified DspckA and 3 site mutations of the present invention;

[0026] Fig.10 This is a diagram showing the results of the in vitro interaction study of DspckA and three-site mutant proteins with Ningnanmycin using MST in the present invention. DETAILED DESCRIPTION

[0027] The present invention will be described in detail below in conjunction with examples, which are merely illustrative and are not intended to limit the scope of application of the present invention. The present invention is not limited to the following embodiments or examples, and any modifications and variations made without violating the spirit of the present invention should be included within the scope of the present invention. The experimental materials used in the following examples are commercially available unless otherwise specified.

[0028] In the following example, the wild strain GZSQ-4 of D. segeticola was isolated and identified from tea leaf spot in Shiqian County, Guizhou Province, and sent to China General Microbiological Culture Collection Administration Center for preservation, with the culture collection number of CGMCC3.20152. The genomic DNA sequence of the DspckA gene in the strain is shown in SEQ ID NO.1, the CDS sequence is shown in SEQ ID NO.2, and the amino acid sequence of the DspckA protein encoded by the gene is shown in SEQ ID NO.3. After sequence alignment, the gene should belong to the phosphoenolpyruvate carboxykinase (PCK) family gene.

[0029] Experimental Example 1: Construction of D. segeticola gene knockout mutant ΔDspckA

[0030] Schematic diagram of the knockout and mutant screening strategy of the DspckA gene of D. segeticola Figure 1 As shown, the specific construction and screening methods are:

[0031] 1. Construction of knockout gene fragments

[0032] 1) Amplification of upstream and downstream homologous sequences of the target gene: Using the genomic DNA of the wild-type strain CGMCC3.20152 of D. segeticola as a template, primers 1F and 2R were used to amplify the upstream A fragment, and primers 3F and 4R were used to amplify the downstream B fragment. The 5' end of primer 2R has a reverse complementary sequence of primer HYGF, and the 5' end of primer 3F has a reverse complementary sequence of primer HYGR. The sequences of primers 1F, 2R, 3F, 4R, HYGF and HYGR (5' to 3') are:

[0033] 1F:ACGATTGCGAGGTACTTTCTG

[0034] 2R:ACCTCCACTAGCTCCAGCCAAGATGGAAATGTGATCGCTGC

[0035] 3F: GAATAGAGTAGATGCCGACCGGGTCCTGACGTCAGCATAATCG

[0036] 4R:TTCAACGTCGGATTGTTCAAC

[0037] HYGF: CTTGGCTGGAGCTAGTGGAGGT

[0038] HYGR:CCCGGTCGGCATCTACTCTATTC

[0039] 2) Amplification of the hygromycin resistance gene hph: Using plasmid pct74 (map as shown Figure 2 As shown in Figure 2, the first half of the hygromycin resistance gene H1 (1094 bp) was amplified using primers HYGF and HYG-1R; the second half of the hygromycin resistance gene H2 (748 bp) was amplified using primers HYG-1F and HYG-1R. The sequences of primers HYG-1F and HYG-1R (5' to 3') are:

[0040] HYG-1F: CGTTGCAAGACCTGCCTGAA

[0041] HYG-1R: GGATGCCTCCGCTCGAAGTA

[0042] 3) Fusion of upstream and downstream fragments of the target gene with the hygromycin resistance gene: Overlapping PCR was used to overlap the recovered A and B fragments with the H1 and H2 fragments to obtain A-H1 connection fragments and H2-B connection fragments. Primers 1F / HYG-1R and HYG-1F / 4R were used to amplify A-H1 and H2-B fragments, respectively, and the knockout fragments were purified to a concentration of 500 ng / μL.

[0043] 2. Preparation of D. segeticola protoplasts

[0044] 1) Inoculate D. segeticola into potato dextrose broth (PDB) medium, culture at 25°C for 36 hours, collect mycelia into a 2 mL centrifuge tube, break the mycelia with a grinder, transfer the bacterial suspension to CM liquid medium and shake culture for 36 hours, and collect fresh mycelia of D. segeticola by filtration;

[0045] 2) Using 10 mL of 0.8 mol / L potassium chloride solution as an osmotic pressure stabilizer, a mixed enzymatic solution of Drislase, Lysozyme and Snailase was prepared to lyse 5 g of suspended mycelium, and the enzymatic hydrolysis was carried out at 30°C and 100 rpm for 4 h;

[0046] 3) Filter through 2-3 layers of sterilized lens paper (pore size of the fiber mesh is 45±12μm), rinse with 0.8mol / L potassium chloride, collect the filtrate, centrifuge the filtrate at 4°C and 4000rpm for 6min, and resuspend with 15mL 1.2mol / L sorbitol buffer (STC) solution;

[0047] 4) Discard the supernatant and resuspend the protoplast pellet in 1 mL STC buffer to a concentration of 1×10 7 The protoplast suspension of 100 g / mL was placed on ice for later use.

[0048] 3. D. segeticola protoplast transformation

[0049] 1) Take 200 μL of protoplast suspension and add it to a 50 mL centrifuge tube. Add 10-20 μg of A-H1 and H2-B knockout transformation fragments, mix gently, and let stand on ice for 20 min.

[0050] 2) Add 1.4 mL of 40% polyethylene glycol 4000 buffer (PTC) twice, gently invert and mix, let stand at room temperature for 20 min, add 5 mL of TB3 liquid culture medium, invert and mix, and culture at 25°C, 120 rpm for 12 to 16 h.

[0051] 3) Centrifuge at room temperature, 4000 rpm / min for 6 min, discard the supernatant, and resuspend the remaining 1 mL of resuspension with the regenerated protoplasts.

[0052] 4) Add to 50 mL of warm TB3 regeneration solid medium, mix well and prepare plates. After inverted culture at 25°C for 24 hours, cover with PDA medium containing 30 μg / mL hygromycin B and culture at 25°C for about 2 to 4 days until transformants grow, and then subculture and screen for 3 generations.

[0053] 4. PCR verification of transformants

[0054] After three generations of subculture on PDA medium containing hygromycin, ΔDspckA transformants can be obtained. DNA was extracted from the transformant colonies using the CTAB method, and PCR amplification was performed using primers. The primer pair HYGF / HYGR was used to amplify the hph gene; the primer pair 5F / 6R was used to amplify the fragment to detect whether the target gene was knocked out. The sequences of primers 5F and 6R (5' to 3') are:

[0055] 5F:CGTCGCTATCAACTTTGCCG

[0056] 6R:TGCTGGAATGGCTTCTCGTT

[0057] The gene knockout fragment was transferred into D. segeticola protoplasts by homologous recombination, and hygromycin-positive transformants were obtained. PCR verification analysis was performed on the positive transformants using hph gene-specific primers. The results are as follows: Figure 3 As shown, the hph gene, the occurrence of upstream homologous recombination and the occurrence of downstream homologous recombination were detected in the transformant, and the DspckA gene was not amplified in the transformant, so the corresponding positive transformant was screened, that is, the ΔDspckA knockout mutant was obtained.

[0058] Experimental Example 2: Analysis of properties of D. segeticola wild type WT and mutant ΔDspckA

[0059] 1. Pathogenicity analysis of WT and ΔDspckA

[0060] The wild type and knockout mutant ΔDspckA of D. segeticola were inoculated on PDA medium, respectively, and cultured upside down in an incubator at 25°C for 7 days. A sterile cork puncher with a diameter of 4 mm was used to punch several bacterial cakes at the edge of the colony. The cakes were inoculated on the surface of tea leaves with puncture wounds. The disease status of the tea leaves was investigated after 3 days.

[0061] The results of the pathogenicity test of the ΔDspckA knockout mutant of D. segeticola to tea leaves are shown in Figure 4 As shown, Figure 4 A is the lesion picture of the wild-type strain of D. segeticola and the mutant strain ΔDspckA after being inoculated on tea leaves for 3 days (the lesions on the left are WT, and the lesions on the right are ΔDspckA); Figure 4 B is the measurement result of the lesion area of ​​D. segeticola wild-type strain and mutant strain ΔDspckA inoculated on tea leaves 3 days later. The ordinate is the lesion area, and the value is the mean value based on 20 independent experiments. The data were analyzed by Duncan's new multiple range method (p < 0.05). Figure 4 It can be seen that on tea leaves, the lesion area of ​​the knockout mutant ΔDspckA was significantly reduced compared with the wild type, indicating that the pathogenicity of D. segeticola was inhibited after the DspckA gene was knocked out.

[0062] 2. Analysis of the difference in sensitivity between WT and ΔDspckA to Ningnanmycin

[0063] The wild-type D. segeticola WT and the knockout mutant ΔDspckA were inoculated on PDA medium containing different concentrations of ningnanmycin (0, 50, 100, 200 U / mL) and cultured at 25°C in the dark. The colony diameter was measured by the cross method at 7 days, and the colony morphology was observed; 5 replicates were set for each treatment. Figure 5 The colony morphology and Figure 6 As shown in the inhibition rate statistics (the dark color in the bar graph is WT and the light color is mutant), as the concentration of Ningnanmycin increases, the inhibition rate of Ningnanmycin on the wild type of D. segeticola increases significantly, while the knockout mutant ΔDspckA is almost unaffected, indicating that the knockout of the DspckA gene reduces the sensitivity of the strain to Ningnanmycin.

[0064] Experimental Example 3: Molecular docking experiment of Ningnanmycin with candidate target proteins involved in energy metabolism

[0065] The DNA sequences of candidate target proteins were converted into protein sequences using BLAST and screened in the UniProt database (http: / / www.uniprot.org). The target sequences were searched using BLAST with the primary amino acid sequences contained in the SWISS-MODEL template library (Bienert, S., Waterhouse, A., De, Beer., T. A., Tauriello, G., Studer, G., Bordoli, L., Schwede, T. The SWISS-MODEL Repository—new features and functionality. Nucleic Acids Research, 2017, 45(D1): D313-D319; Camacho, C., Coulouris, G., Avagyan, V., Ma, N., Papadopoulos, J., Bealer, K., Madden, T. B., TLBLAST. +: architecture and applications. BMC Bioinformatics, 2009, 10: 1-9), the crystal structure of phosphoenolpyruvate carboxylase (PEPCK) of Trypanosoma cruzi (1ii2.1) was selected as a homology model to construct the three-dimensional structure of DspckA. The active binding pockets of these models were predicted using fpocket (https: / / bio.tools / fpocket) (Schmidtke, C., Findeiβ, S., Sharma, CM, Kuhfuβ, J., Hoffmann, S., Vogel, J., Stadler, PF, Bonas, U. Genome-wide transcriptome analysis of the plant pathogen Xanthomonas identifies sRNAs with putative virulence functions. Nucleic Acids Research, 2012, 40(5): 2020-2031). Molecular docking programs AutoDock Tools and AutoDock vina were used to realize automatic molecular docking simulations between Ningnanmycin and each candidate target protein (Morris, GM, Huey, R., Lindstrom, W., Sanner, MF, Belew, RK, Goodsell, DS, Olson, AJ AutoDock4 and AutoDock Tools4: Automated docking with selective receptor flexibility. Journal of Computational Chemistry, 2009, 30(16): 2785-2791; Trott, O., Olson, AJ AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. Journal of Computational Chemistry, 2010, 31(2): 455-461). PyMOL was used for visualization analysis. Before molecular docking calculation, water molecules and ligands in the protein structure were removed, and hydrogens and Gasteiger were added to obtain 10 docking postures for molecular docking calculation. The docking conformation with the lowest binding energy was selected, such as. Figure 7 ( Figure 7 A: Molecular docking results of Ningnanmycin and DspckA; Figure 7 B: The results shown in the docking binding site of Ningnanmycin and DspckA show that the binding energy is -7.4 Kcal / mol, which reveals that Ningnanmycin interacts with DspckA and forms stable hydrogen bonds with amino acids T264, T265 and E306 of DspckA. Therefore, it is shown that DspckA can be used as a target for screening fungicides, and Ningnanmycin is screened as a candidate fungicide.

[0066] Experimental Example 4: Prokaryotic expression and protein purification

[0067] 1. Construction of prokaryotic expression vector

[0068] 1) Amplification of point mutation fragment and DspckA CDS sequence: Extract total RNA of D. segeticola (kit: Quanshijin ER501), and then use reverse transcription PCR (kit: Quanshijin AE311) to obtain cDNA of D. segeticola. Design primers for amplification of amino acid 264 (T264A), 265 (T265A), 306 (E306A) mutations and DspckA gene CDS sequence SEQ ID NO.2. Using the cDNA template of D. segeticola, primers 13-F / 8R, 13F / 10R, and 13F / 12R were used to amplify the first half of the point mutation fragment P1, and primers 7F / 14R, 9F / 14R, and 11F / 14R were used to amplify the second half of the point mutation P2 (such as Figure 8 ); primers 13F and 14R were used to amplify the DspckA CDS sequence. The sequences of primers 7F, 8R, 9F, 10R, 11F, 12R, 13F and 14R (5' to 3' end) are:

[0069] 7F:CTTCTCCGGTACTGGCAAGGCCACTCTCTCCCGCCGACCC

[0070] 8R: GGGTCGGCGGAGAGAGTGGCCTTGCCAGTACCGGAGAG

[0071] 9F:TCCGGTACTGGCAAGACCGCTCTCTCCGCCGACCC

[0072] 10R: GGGTCGGCGGAGAGAGCGGTCTTGCCAGTACCGGA

[0073] 11F:GGTCTCTCCGCCGAGAAGGCGCCCGATATCTTCAACG

[0074] 12R:CGTTGAAGATATCGGGCGCCTTCTCGGCGGAGAGACC

[0075] 13F:cagcaaatgggtcgcggatccATGGTTCCCCAAGTCAACAAGA

[0076] 14R:ttgtcgacggagctcgaattcTTATGCCTTGGTCTGTGGCC

[0077] 2) Fusion of point mutation fragment genes: Overlapping PCR was used to overlap the recovered P1 fragment and P2 fragment to obtain DNA fragments with T264A, T265A, and E306A point mutations.

[0078] 3) Construction of vector by homologous recombination: The amplified CDS sequence of DspckA gene and the DNA fragments with point mutations at three sites were respectively introduced into the pET-28a(+) vector by homologous recombination to obtain recombinant plasmids.

[0079] 2. Prokaryotic expression of proteins

[0080] Transformation: The four recombinant plasmids were transformed into competent E. coli Rosetta DE3 cells, heat-shocked at 42°C, plated on plates containing 50 μg / mL kanamycin, and cultured at 37°C;

[0081] Activation: Pick a monoclonal colony and culture it in liquid culture medium containing antibiotics at 37°C;

[0082] Induction: When the OD value reaches 0.6, add 0.8mM inducer IPTG and continue to culture at 16℃ overnight. The negative control is without the addition of inducer.

[0083] Collect the cells: centrifuge at 6000 rpm for 20 min, discard the supernatant, and collect the cells;

[0084] Expression detection: Add buffer A (0.2M PBS, 19mL NaH2PO4, 81mL Na2HPO4, sterile water to 1L) to the collected bacteria for suspension, and use an ultrasonic disruptor to fully dissolve them. Centrifuge to collect the supernatant crude protein, prepare the supernatant crude protein, and prepare for gel testing.

[0085] 3. Protein purification

[0086] The supernatant crude protein was affinity purified;

[0087] Balance: Take Ni-NTA filler and load the column, and wash and balance the column with buffer B (150 mL PBS, 0.2 M mercaptoethanol, 100 mL glycerol, 17.4 g sodium chloride, 1.36 g imidazole, and sterile water to 1 L);

[0088] Loading: Incubate the crude protein with the equilibrated column packing and collect the effluent;

[0089] Equilibration: Wash and equilibrate the column with buffer B;

[0090] Wash: Wash the column with buffer B;

[0091] Elution: Use buffer C (50 mL PBS, 0.2 M mercaptoethanol, 100 mL glycerol, 17.4 g sodium chloride, 27.2 g imidazole, sterile water to 1 L) to elute and collect the flow-through;

[0092] Purification detection: The crude protein, effluent fraction and purified protein were treated separately, and samples were prepared for SDS-PAGE (10% separation gel, 5% concentration gel) detection.

[0093] Collection and processing: The purified fractions were desalted into protein storage buffer D (150 mL PBS, 300 mM NaCl, pH 7.4), concentrated, sterilized by filtration, packaged at 1 mL / tube, and stored at -80°C.

[0094] The gel run test results are as follows Fig. 9 As shown ( Fig. 9 A is the protein expressed and purified by DspckA, where M is the standard molecular weight of the protein, lane 1 is the crude protein in the supernatant, lane 2 is the effluent after protein hanging on the column, and lanes 3 to 11 are the polytubular proteins obtained after purification; Fig. 9 B is T264A mutant protein, where M is the standard molecular weight of protein, lane 1 is the crude protein in the supernatant, lanes 2 and 3 are the effluent after protein hanging on the column, and lanes 4 to 11 are the polytubular proteins after purification; Fig. 9 C is the T265A mutant protein, where M is the standard molecular weight of the protein, lane 1 is the crude protein in the supernatant, lane 2 is the effluent after protein hanging on the column, and lanes 3 to 9 are the polytubular proteins obtained after purification; Fig. 9 D is the E306A mutant protein, where M is the standard molecular weight of the protein, lane 1 is the supernatant crude protein, lane 2 is the effluent after the protein is hung on the column, and lanes 3 to 8 are the polytubular proteins obtained after purification. It can be seen that DspckA and the T264A, T265A and E306A mutant proteins have been successfully purified.

[0095] Experimental Example 5: Microthermophoresis Experiment

[0096] Microscale thermophoresis (MST) was used to study the interaction of DspckA, T264A, T265A and E306A proteins with candidate fungicide molecules

[0097] Protein sample preparation: Take 5 μL of RED-NHS dye and NHS labeling buffer and mix them gently by pipetting. Take 10 μL of purified desalted protein (obtained in Experimental Example 4) and 90 μL of the above RED-NHS solution and add them to a 1.5 mL centrifuge tube with enzyme inactivated. Mix well on ice, place in a dark environment, and incubate at room temperature for 30 min. Take 10 μL of protein fluorescent labeling solution with a capillary tube and place it on a micro-thermophoresis instrument for measurement. Keep the protein labeling solution with a fluorescence value of 400 to 1200 for subsequent experiments.

[0098] Setting of microthermophoresis instrument parameters: Monolith NT.115 microthermophoresis instrument will be used to study the interaction between DspckA, T264A, T265A and E306A proteins and Ningnanmycin. The instrument parameters are LED power 40%, Laserpower 30%, Red excitation;

[0099] Protein-Ningnanmycin interaction analysis: Results Fig.10 As shown, DspckA interacts with Ningnanmycin, and the dissociation constant K d =4.51±1.76, indicating that DspckA can be used as a target for screening fungicides; and it was found that T264A, T265A and E306A did not interact with Ningnanmycin, and the dissociation constants were increased, K d =80.61±30.59, K d =22.87±8.50 and K d =14.03±2.73. This indicates that amino acid substitution weakens the binding affinity, revealing that amino acids 264, 265, and 306 of DspckA protein are important binding sites.

[0100] The conventional techniques and schemes not described in detail in the above embodiments are well known in the art, so they will not be described in detail here. The above embodiments and / or experimental examples describe the preferred embodiments of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, the technical scheme of the present invention can be subjected to a variety of simple modifications, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. Application of the DspckA gene in regulating the pathogenicity of Didymella segeticola or its sensitivity to Ningnanmycin or in designing and screening antifungal drugs; the nucleotide sequence of the DspckA gene is as shown in SEQ ID NO.1 or SEQ ID NO.2, or the encoded amino acid sequence is as shown in SEQ ID NO.

3.

2. The use according to claim 1, characterized in that The regulation of the pathogenicity of Didymella segeticola and the sensitivity to Ningnanmycin are both reduced.

3. Use of the DspckA gene in cultivating transgenic D. segeticola with reduced pathogenicity and / or reduced sensitivity to Ningnanmycin, characterized in that: The nucleotide sequence of the DspckA gene is shown in SEQ ID NO.1 or SEQ ID NO.2, or the encoded amino acid sequence is shown in SEQ ID NO.

3.

4. A method for cultivating transgenic D. segeticola with reduced pathogenicity and / or reduced sensitivity to Ningnanmycin, characterized in that: The method comprises the steps of reducing the expression amount or / and activity of the mRNA or protein of the DspckA gene in the receptor D. segeticola to obtain the transgenic D. segeticola; the nucleotide sequence of the DspckA gene is shown as SEQ ID NO.1 or SEQ ID NO.2, or the encoded amino acid sequence is shown as SEQ ID NO.

3.

5. The method according to claim 4, characterized in that The method for reducing the expression amount and / or activity of the mRNA or protein of the DspckA gene in the receptor D. segeticola is achieved by knocking out, inhibiting or silencing the expression of the DspckA gene in the receptor.

6. Use of the method according to claim 4 or 5 in controlling diseases caused by D. segeticola.

7. Application of DspckA protein as a drug target in screening fungicides, characterized in that: The amino acid sequence of the DspckA protein is shown in SEQ ID NO.

3.

8. The use according to claim 7, characterized in that Amino acids T264, T265 and E306 in the DspckA protein are used as drug targets.

9. Application of Ningnanmycin as a fungicide ingredient in the prevention and control of diseases caused by D. segeticola.

10. The use of Ningnanmycin in regulating the structure or activity of DspckA protein, characterized in that: The amino acid sequence of the DspckA protein is shown in SEQ ID NO.3.

Images