Reference gene related to gene expression change of Stylonychia and application thereof

Abstract

The invention relates to a reference gene related to gene expression change of Stylonychia and application of the reference gene, and belongs to the field of insect research, and the reference gene is ACTB, TUB and PPP4C; the nucleotide sequence of the reference gene ACTB is as shown in SEQ ID NO. 1; the nucleotide sequence of the reference gene TUB is as shown in SEQ ID NO. 2; the nucleotide sequence of the reference gene PPP4C is as shown in SEQ ID NO. 3. The method is used for screening a universal detection primer of the Stylonychia lemnae reference gene combination so as to meet the requirements of functional research of the Stylonychia lemnae related functional genes.

Description

Technical Field

[0001] The invention belongs to the research field of ciliates, and in particular relates to an internal reference gene related to gene expression changes of spinytails and an application thereof. Background Art

[0002] The genus Stylonychia belongs to the phylum Ciliophora, class Polyhymena, order Hypochaeta. There are currently 11 species in the genus. It is a common free-living freshwater ciliate widely distributed in ponds, rivers and swamps. The duckweed Stylonychia lemnae is the only species in the genus Stylonychia that has completed the large nuclear genome sequencing. It is the model species of the genus Stylonychia and is often used as a representative of the genus in the field of molecular biology research. As a single-cell model organism, Stylonychia plays an important role in the study of nuclear organization and development, chromosomes and chromatin, telomere biology and genome rearrangement. As early as 1876, the first report on chromosomes and mitotic spindles came from the observation of the structure of the micronucleus of Stylonychia. After the macronucleus of Stylonychia lemnae became polyploid, a large amount of DNA (about 90%) was lost in the genome, which has led to extensive research on the phenomenon of genome reduction and rearrangement in ciliates. Subsequently, the duckweed spinytail was widely used as a model single-cell organism to study the regulation of telomere structure and chromatin dynamics during genome recombination and macronuclear differentiation. In 2013, after the completion of the sequencing of the duckweed spinytail macronuclear genome, it provided a molecular biological basis for future studies of chromatin-mediated and RNA-guided developmental genome rearrangements.

[0003] Real-time fluorescent quantitative polymerase chain reaction (qPCR) technology was introduced by ABI in the United States in 1996. Compared with traditional PCR technology, fluorescent substances are added to the PCR reaction system. Fluorescent substances bind to nucleotide sequences and can release fluorescent signals. Each PCR reaction can be monitored in real time through the accumulation of fluorescent signals, thus realizing an experimental method for quantitative determination of the initial template. It has become an important means to study the expression and changes of specific functional genes. qPCR has the advantages of strong specificity and high sensitivity of ordinary PCR, and it also overcomes the shortcomings of ordinary PCR that it cannot be accurately quantified and is easy to be contaminated when agarose gel electrophoresis is used to detect the results. Therefore, it can be said that the experimental results of qPCR are more accurate. In addition, agarose gel electrophoresis is not required to detect the amplification of the target gene after the reaction is completed. Therefore, the emergence of qPCR experimental technology provides a very important technical means for molecular biology research.

[0004] To analyze gene expression using relative quantitative methods, in order to obtain more accurate qPCR experimental data, first of all, good experimental operation techniques and primer design are required, and secondly, each step of the experimental process should be done well, including the integrity of RNA extraction, prevention of contamination during the PCR experiment, etc. In addition to the above, it is also very important to select appropriate internal reference genes. Ideal internal reference genes should be constantly expressed under different treatment conditions and in different types of tissues or cells. However, a large number of research results have shown that the expression of the most commonly used internal reference genes is not absolutely stable. The so-called constant expression is only relatively stable under one type of cell or experimental condition. In addition, internal reference genes are not universal, and the optimal internal reference genes will change in different species and under different treatment conditions. Therefore, it is very necessary to analyze the stability of candidate internal reference genes in experimental materials.

[0005] There are currently no reports on reference genes that can be used in the study of gene expression changes in spinytails. In order to more accurately study the expression of differentially expressed genes in different growth periods of spinytails, it is necessary to screen out reference genes whose expression levels have no significant differences during the cell proliferation of spinytails. Summary of the invention

[0006] The purpose of the present invention is to solve the problem of no available internal reference genes in the study of gene expression changes of spinytails, and to provide an internal reference gene related to gene expression changes of spinytails and its application.

[0007] The present invention discloses an internal reference gene related to the gene expression change of acanthocephalus, wherein the internal reference genes are ACTB, TUB and PPP4C; the nucleotide sequence of the internal reference gene ACTB is shown in SEQ ID NO.1; the nucleotide sequence of the internal reference gene TUB is shown in SEQ ID NO.2; and the nucleotide sequence of the internal reference gene PPP4C is shown in SEQ ID NO.3.

[0008] The invention discloses an application of an internal reference gene related to gene expression changes of acanthochaetes, wherein the internal reference gene is used for screening and cloning duckweed acanthochaetes.

[0009] Furthermore, the internal reference gene is used to screen and clone duckweed spinytails in different growth stages.

[0010] Primer for amplifying internal reference gene of fluorescent quantitative PCR of spiny-necked parasites of the present invention

[0011] Actb-F: ATGTCAGATCAACAAACTT;

[0012] Actb-R:TCAGATGCACTTTCTGTG;

[0013] The dedicated primers for the fluorescence quantitative PCR of the internal reference gene TUB are

[0014] Tub-F: ATGAAGGAAATAATAAATATTGGAATTGG;

[0015] Tub-R: TCAATTACTTTCTGCTTCTACAAA;

[0016] The dedicated primers for the fluorescence quantitative PCR of the internal reference gene PPP4C are

[0017] PPP4C-F: ATGGCATCTGATGGAGAC;

[0018] PPP4C-R:CTTCCGCAATTTTAGGT.

[0019] A kit comprising the primers of the present invention.

[0020] The internal reference gene of the present invention has the following characteristics:

[0021] Improved research stability: The internal reference gene of the present invention can be stably expressed, meeting the requirements of real-time fluorescence quantitative detection of gene transcription expression levels, thereby improving the stability of gene expression analysis research.

[0022] Enhanced reliability of results: Using the stable internal reference gene of the present invention as a reference can more accurately evaluate the expression level of the target gene, thereby enhancing the reliability of the experimental results.

[0023] Improve research efficiency: By screening stable internal reference genes with the primers of the present invention, the experimental steps can be simplified, experimental errors can be reduced, and the overall research efficiency can be improved.

[0024] Reducing spatiotemporal specificity: The expression level of the stable internal reference gene screened by the present invention is relatively stable in different tissues, different developmental stages or different environmental conditions, which can reduce the influence of spatiotemporal specificity on the experimental results.

[0025] The present invention has the following beneficial effects:

[0026] The present invention uses ACTB, TUB and PPP4C as internal reference genes, compares the internal reference genes stably expressed in different growth periods of duckweed spinytail, and the results show that in different growth periods of duckweed spinytail, ACTB, TUB and PPP4C show higher stability and are the most stable internal reference genes in different growth periods of duckweed spinytail. The internal reference genes of the present invention can be used to screen and clone duckweed spinytail in the study of duckweed spinytail. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1Electrophoresis of total RNA extraction from duckweed thorntail (Stylonychia lemnae);

[0028] Figure 2 Electrophoresis diagram of PCR amplification detection of internal reference genes of Duckweed Echinococcus; (1-9 represent ACTB, PPP4C, VPS, PKD, TUB, TBP, Hyp1, Hyp2, Hyp3, and the marker is DL2000);

[0029] Figure 3 Melting curves of 9 candidate reference genes in different stages of Echinococcus spp.

[0030] Figure 4 Standard curves of 9 candidate internal reference genes;

[0031] Figure 5 The expression level diagram of 9 candidate reference genes during different growth periods of duckweed spinytail; the triangle in Figure a represents the arithmetic mean of the Ct value, the square represents the maximum value of the Ct value, the circle represents the minimum value of the Ct value, and Figure b represents the range of the Ct value;

[0032] Figure 6 M-value plot from Genorm software. DETAILED DESCRIPTION

[0033] In order to make the objectives, technical solutions and advantages of the embodiments of the present invention more clearly understood, the spirit of the contents disclosed by the present invention will be described in detail below. After understanding the embodiments of the contents of the present invention, any technician in the relevant technical field can change and modify them according to the techniques taught by the contents of the present invention without departing from the spirit and scope of the contents of the present invention.

[0034] The exemplary embodiments of the present invention and the description thereof are used to explain the present invention, but are not intended to limit the present invention.

[0035] Example

[0036] 1. Total RNA extraction and cDNA synthesis

[0037] 1.1 Cultivation of Duckweed Spinytail

[0038] The optimal ratio of the culture medium components is a nitrogen source concentration of 80 mg / mL, a K2HPO4·3H2O concentration of 0.65% (mg / mL), and a final carbon source concentration of 20 mg / mL; the culture conditions are a temperature of 25°C, an initial pH of 7.0, an inoculation size of 100 cells / mL, and static culture for 168 hours. This is the optimal culture condition for each factor, and a large amount of pure culture experimental materials can be obtained.

[0039] 1.2 RNA extraction

[0040] The selected extraction method was tested by agarose gel electrophoresis (see Figure 1 ), indicating that high-quality total RNA of Stylonychia lemnae was successfully extracted.

[0041] 1.3 cDNA synthesis

[0042] (1) Prepare the following RT-PreAmp Master Mix in a Nuclease free centrifuge tube: 2×Reaction Mix 2.5 μL, 0.1 μM Assay Pool 0.5 μL, RT / Taq enzyme 0.1 μL, Nuclease free ddH2O 1.9 μL, Total 5.0 μL.

[0043] (2) Place on ice until ready to use, add single cells, cap the tube tightly, immediately place in -80°C refrigerator for 2 min, centrifuge at 3000 rpm for 2 min, and immediately place in PCR instrument for the following reaction:

[0044]

[0045] After the reaction, add 20 μL Nuclease free ddH2O (1:5 dilution) to each tube, vortex to mix, centrifuge at 3000 rpm for 2 min, and immediately perform subsequent qPCR reaction or store at -20°C.

[0046] 2. Screening of candidate internal reference genes and primer design for qRT-PCR

[0047] By analyzing the transcriptome data of Duckweed spinytail, the expression changes of 21,062 genes in the treatment group and the control group were compared at 96h, 108h and 120h, and 0.95-1.05 was used as the standard for stable expression, and a total of 16 sequences were screened as candidate reference genes. Based on the sequences of species published in NCBI, and combined with the genes that have been used as references in other organisms in the Housekeeping-Wikipedia database (https: / / sv.wikipedia.org / wiki / Housekeepinggen), homologous comparisons were performed. After searching and comparing, a total of 9 gene sequences of ACTB, PPP4C, VPS, PKD, TUB, TBP, Hyp1, Hyp2, and Hyp3 were obtained.

[0048] 2.1 Primer design

[0049] Primer design was performed using Primer Premier 5.0 software, using the full-length sequence of each gene obtained from the transcriptome database (internal laboratory data) as a template to design primers and amplify the full-length gene.

[0050] Table 1 Reference gene cloning primer information

[0051]

[0052] 2.2 PCR amplification

[0053] (1) Reaction system: Template 1 μL, Primer-F 0.5 μL, Primer-R 0.5 μL, Mixture 10 μL, ddH2O 8 μL, Total 20 μL.

[0054] (2) Reaction procedure: Since the optimal annealing temperatures of primers are different, this experiment uses 35 cycles of gradient PCR. 95℃5min, 95℃20s, adjust the specific annealing temperature of each primer for 30s, 72℃1min30s, cycle number 35, 72℃5min. PCR products are stored in a refrigerator at 4℃.

[0055] 2.3 Electrophoresis results

[0056] The PCR amplification products were detected by 1% agarose gel electrophoresis (see Figure 2 ), the obtained fragment lengths were all the expected target gene sizes. After gel excision and recovery, the ligation and transformation were successful and then sent to Harbin Xinhai Biotechnology Co., Ltd. for sequencing. The sequencing results were compared using Mega 5.0 software, and all target genes were of the expected fragment sizes.

[0057] 2.4 Melting curve

[0058] In the analysis of the melting curve, as the reaction temperature gradually increases, the double-stranded DNA product gradually unwinds and unfolds. When the temperature rises to a certain value, the fluorescence intensity will be greatly reduced. At this time, half of the double-stranded DNA product will be unwound. This temperature is called the Tm value. The Tm value is related to the sequence of the amplified product. For a specific amplified product, its value is fixed. In this experiment, the Tm values ​​of each gene are distributed in the range of 68.5℃ to 78.5℃, indicating that the reaction product is the target product, not a primer dimer. The Tm values ​​of each gene are: ACTB: 70.8℃, PPP4C: 71.4℃, VPS: 73.2℃, PKD: 78.1℃, TUB: 68.5℃, TBP: 71.1℃, Hyp1: 71℃, Hyp2: 70.3℃, Hyp3: 70.8℃. For different cDNA templates, the peaks of the melting curves of each pair of primers are basically the same ( Figure 3), indicating that the designed primers have good specificity and no nonspecific amplification occurs during the reaction.

[0059] 2.5 Detection of primer amplification efficiency

[0060] After the sample is diluted in a gradient, the sample quality is tested by real-time fluorescence quantitative PCR experiment, the Ct value under gradient dilution is obtained, and the standard curve obtained by primer amplification is drawn. The obtained points are subjected to linear fitting regression analysis to obtain the linear regression equation. By calculating the slope of the linear regression equation, the amplification efficiency of each pair of primers can be calculated ( Figure 4 ). It can be seen from the figure that the R of the regression equation of the fitted standard curve 2 All of them are greater than 0.97, indicating that the credibility of these standard curves is high and the next step of real-time fluorescence quantitative PCR experiment can be carried out.

[0061] According to E=10 [-1 / slope] -1, the amplification efficiency of ACTB was 97.3%, the amplification efficiency of PPP4C was 98.2%, the amplification efficiency of VPS was 98.9%, the amplification efficiency of PKD was 97.9%, the amplification efficiency of TUB was 99.5%, the amplification efficiency of TBP was 99.5%, the amplification efficiency of Hyp1 was 99.7%, the amplification efficiency of Hyp2 was 98.2%, and the amplification efficiency of Hyp3 was 98.2%. The primer amplification efficiency of each gene was between 90% and 100%, with a high amplification efficiency.

[0062] 6 Analysis on the stability of internal reference genes in different stages of duckweed spinytail

[0063] 6.1 Statistical analysis of raw Ct values

[0064] Figure 5is the fluctuation range of the original Ct value of each candidate internal reference gene in different growth periods. As can be seen from Figure A, in different growth periods of Duckweed Spinytail, the overall fluctuation range of the Ct value of the candidate internal reference gene is 15-30.827. Among them, the Ct value of ACTB gene ranged from 25.299 to 30.827, the Ct value of PPP4C gene ranged from 19.24 to 25.216, the Ct value of VPS gene ranged from 21.816 to 24.715, the Ct value of PKD gene ranged from 23.807 to 28.34, the Ct value of TUB gene ranged from 16.047 to 29.923, the Ct value of TBP gene ranged from 15 to 25.369, the Ct value of Hyp1 gene ranged from 19.93 to 20.806, the Ct value of Hyp2 gene ranged from 23.101 to 28.788, and the Ct value of Hyp3 gene ranged from 19.5 to 23.541. The arithmetic mean of the Ct values ​​of the candidate reference genes is: ACTB: 27.14, PPP4C: 22.461, VPS: 22.83, PKD: 26.03, TUB: 23.32, TBP: 21.03, Hyp1: 20.51, Hyp2: 25.82, Hyp3: 21.35. The arithmetic mean of the Ct value of the Hyp1 gene is the smallest, so its average expression abundance in different periods of duckweed spinytails is the highest. The arithmetic mean of the Ct value of the ACTB gene is the largest, so its average expression abundance in different periods of duckweed spinytails is the lowest. From Figure B, we can intuitively observe the changes in the Ct value, among which the Ct value of the Hyp1 gene changes the least, and the Ct value of the TUB gene changes the most. The range of changes from small to large is: Hyp1<VPS<Hyp3<PKD<ACTB<PPP4C<Hyp2<TBP<TUB.

[0065] 6.2 Genorm software analysis results

[0066] Genorm software provides the M value of each sample of Duckweed Spinytail. The smaller the M value, the higher the stability of the sample. Figure 6It can be seen that at different growth stages of Duckweed Stingura, the M values ​​of each candidate reference gene are: ACTB = 0.385, PPP4C = 0.613, VPS = 0.000, PKD = 0.955, TUB = 0.712, TBP = 0.495, Hyp1 = 0.842, Hyp2 = 1.032, Hyp3 = 0.000. According to the M value, the candidate reference genes are ranked from the most stable to the most unstable as follows: VPS | Hyp3 > ACTB > TBP > PPP4C > TUB > Hyp1 > PKD > Hyp2. The optimal reference gene combination screened by Genorm software is: VPS, Hyp3 and ACTB. The results of the software screening are consistent with the results of the original statistics of the Ct value.

[0067] 6.3 Norm Finder software analysis results

[0068] The smaller the stability value provided by the Norm Finder software, the better the stability of the candidate internal reference gene represented. From the data in Table 2, it can be seen that the stability values ​​of the candidate internal reference genes are: ACTB = 0.367, PPP4C = 0.485, VPS = 0.708, PKD = 0.967, TUB = 0.499, TBP = 0.725, Hyp1 = 1.105, Hyp2 = 1.186, Hyp3 = 0.708. According to the stability value, the ranking of the candidate internal reference genes from stable to unstable is: ACTB>PPP4C>TUB>Hyp3>VPS>TBP>PKD>Hyp1>Hyp2. This is somewhat different from the original Ct value statistical analysis results and Genorm analysis results. However, the top three most stable candidate reference genes ACTB, PPP4C and TUB selected by Norm Finder software ranked 5, 6 and 9 in the original Ct value statistical analysis, and ranked 2, 4 and 6 in the analysis of Genorm software. ACTB and PPP4C are both among the top five most stable candidate reference genes. In addition, in the analysis results of Norm Finder software, the stability of Hyp2 is also the lowest.

[0069] Table 2 Results of Norm Finder software analysis of the expression stability of candidate reference genes in different growth periods

[0070]

[0071]

[0072] 6.4Best Keeper software analysis results

[0073] The analysis results of the Bestkeeper software are shown in Table 3. The Bestkeeper software calculates the correlation coefficient (Co-efficient of correlation) between each candidate internal reference gene pair, and can also perform variance analysis on the expression stability of each candidate internal reference gene. As can be seen from the table, the VPS and Hyp3 genes have the highest correlation coefficient of 0.974, indicating that it has the highest correlation with other candidate internal reference genes, but the coefficient of variation (Covariance) and standard deviation (Standard deviation) of VPS itself are high, indicating that the stability of this gene between different samples and repeated samples is poor, so it is not the choice of the optimal internal reference gene. Among the top five genes with higher correlation coefficients, ACTB has the lowest standard deviation and coefficient of variation, which are 0.33 and 0.91 respectively, and TUB has a lower standard deviation and coefficient of variation, which are 0.33 and 1.21 respectively. This shows that in the analysis of the Bestkeeper software, the most suitable internal reference gene is ACTB, followed by TUB.

[0074] Table 3 Results of Best Keeper software analysis of the expression stability of candidate reference genes in different growth periods

[0075]

[0076] 6.5 Summary of the screening of reference genes for Echinococcus sphaeroides at different growth stages

[0077] The analysis results of the above three software were comprehensively analyzed and ranked, as shown in Table 4. In different growth periods of duckweed spinytail insects, ACTB, TUB and PPP4C showed higher stability.

[0078] Table 4 Ranking Order (Better--Good--Average) analysis of candidate reference gene stability ranking

[0079]

[0080]

[0081] Many experimental studies in recent years have shown that no internal reference gene can be stably expressed under all experimental conditions. In different species, different tissue parts, different treatment conditions, and different culture environments, the most suitable internal reference genes are often different. In other words, internal reference genes are not universal. Before conducting each specific fluorescence quantitative PCR experiment, in order to ensure the accuracy of the experimental results analysis, internal reference genes should be screened. Since there are no genes with absolutely constant expression levels in organisms, the use of a single internal reference gene to calibrate the experimental results of the fluorescence quantitative PCR experiment may have a large error. In this study, the transcriptome database of Duckweed spinytail was first analyzed, and 9 candidate internal reference genes that were stably expressed in each growth period were screened, including ACTB, PPP4C, VPS, PKD, TBP, TUB, Hyp1, Hyp2, and Hyp3, and they were cloned and bioinformatics analyzed. Three software software, Genorm, Norm Finder, and Best Keeper, were used to compare the expression changes and stability of internal reference genes to perform qPCR experiments on spinytails at different stages. The stable reference genes expressed in different growth periods of Duckweed Spinytail were compared. The results showed that ACTB, TUB and PPP4C showed high stability in different growth periods of Duckweed Spinytail, and they were the most stable reference genes in different growth periods of Duckweed Spinytail. Therefore, in the study of gene function of Duckweed Spinytail, ACTB, TUB and PPP4C can be selected as the first choice of candidate reference genes when applying real-time fluorescence quantitative PCR technology.

Claims

1. An internal reference gene associated with changes in gene expression of acanthocephala, characterized in that The internal reference genes are ACTB, TUB and PPP4C; the nucleotide sequence of the internal reference gene ACTB is shown in SEQ ID NO.1; the nucleotide sequence of the internal reference gene TUB is shown in SEQ ID NO.2; and the nucleotide sequence of the internal reference gene PPP4C is shown in SEQ ID NO.

3.

2. The use of an internal reference gene related to gene expression changes in spiny tails as claimed in claim 1, characterized in that The internal reference gene is used for screening and cloning duckweed spinytail worms.

3. The use of an internal reference gene related to gene expression changes in spiny tails according to claim 2, characterized in that The internal reference gene is used for screening and cloning duckweed spinytails in different growth stages.

4. A primer for amplifying an internal reference gene of acanthocephalus by fluorescence quantitative PCR, characterized in that The dedicated primer for the fluorescence quantitative PCR of the internal reference gene ACTB is Actb-F: ATGTCAGATCAACAAACTT; Actb-R:TCAGATGCACTTTCTGTG; The dedicated primer for the fluorescent quantitative PCR of the internal reference gene TUB is Tub-F: ATGAAGGAAATAATAAATATTGGAATTGG; Tub-R: TCAATTACTTTCTGCTTCTACAAA; The dedicated primer for the fluorescent quantitative PCR of the internal reference gene PPP4C is PPP4C-F: ATGGCATCTGATGGAGAC; PPP4C-R:CTTCCGCAATTTTAGGT.

5. A kit comprising the primers according to claim 4.

Images