Application of MAVS as mitochondrial stabilizer in delaying senescence

Abstract

The invention discloses application of MAVS as a mitochondrial stabilizer in delaying senescence. Experiments prove that the deletion of the MAVS protein accelerates the aging of the human mesenchymal stem cells; the MAVS can interact with the OPA1 to maintain the mitochondrial function, so that the aging of the human mesenchymal stem cells is delayed. The invention discloses an important role of the MAVS-OPA1-mitochondrial axis in regulating and controlling the aging process of the human mesenchymal stem cells. The method has an important application value.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the application of MAVS as a mitochondrial stabilizer in delaying aging. Background Art

[0002] MAVS is a mitochondrial antiviral signaling protein located on the mitochondrial membrane and plays an important role in the anti-RNA virus signal response process. In the classical innate immune pathway, MAVS forms multimers after receiving upstream signals, and then recruits downstream TBK1 / IKKε and IκB complex components, promotes the phosphorylation of transcription factors IRF3 and NFκB, and further translocates into the nucleus, initiates the transcriptional expression of a series of antiviral factors, and initiates antiviral innate immune response. MAVS is widely present on the mitochondrial membrane. Previous reports have mainly focused on MAVS regulating innate immune responses, but whether MAVS interacts with other mitochondrial related proteins to jointly regulate mitochondrial function has lacked detailed research.

[0003] Aging is a process in which the body's functions gradually decline, and it is also a major risk factor for a series of diseases such as cardiovascular disease and Parkinson's syndrome. Stem cells have the ability to self-renew and differentiate, and play an important role in the repair and regeneration of tissues and organs. Mesenchymal stem cells (MSC) are a type of adult stem cells that are distributed throughout multiple tissues and organs throughout the body. They can self-renew and have the ability to differentiate into multiple lineages such as osteoblasts, chondrocytes and adipocytes, and have important clinical application value. The exhaustion of stem cells is a major feature of the aging process and is also an important cause of osteoporosis and progeria in adults.

[0004] Mitochondrial dysregulation is also one of the twelve major markers of aging and is closely related to stem cell exhaustion and cell aging. Currently, the key mitochondrial proteins that regulate stem cell aging have not been studied in detail. Summary of the invention

[0005] The purpose of the present invention is to delay aging.

[0006] The present invention firstly uses a substance that protects proteins or promotes protein activity and / or expression in the preparation of a product; the function of the product is at least one of B1), B2) and B3): B1) delaying aging; B2) improving mitochondrial function; B3) maintaining mitochondrial stability;

[0007] The protein is MAVS protein or MAVS interacting protein.

[0008] In the above application, the MAVS interacting protein may be OPA1 protein.

[0009] In the above application, the delaying of aging may be delaying cellular aging. The cells may be hMSCs.

[0010] In the above application, the delayed aging can be manifested as a decrease in the proportion of SA-β-gal positive cells, an increase in telomere length, an increase in the proportion of Ki67 positive cells, an increase in the proportion of S phase cells, an improvement in monoclonal formation ability, a decrease in the degree of DNA damage, a decrease in ROS generation and / or a decrease in cell nucleus size.

[0011] In the above application, the improvement of mitochondrial function can be manifested as a decrease in mitochondrial mass, a decrease in mtDNA copy number, an increase in mitochondrial membrane potential, a decrease in mtROS and / or an increase in oxidative respiration rate.

[0012] In the above application, the maintenance of mitochondrial stability can be manifested as a decrease in the number of mitochondria, an increase in the area of ​​mitochondria, an increase in the aspect ratio of mitochondria and / or a decrease in abnormal mitochondria.

[0013] The present invention also protects the use of substances that inhibit the activity and / or expression of MAVS protein or MAVS interacting protein in the preparation of products; the functions of the product are at least one of C1), C2) and C3): C1) promoting aging; C2) inhibiting mitochondrial function; C3) mitochondrial stability disorders.

[0014] In the above application, the promotion of aging can be manifested as an increase in the proportion of SA-β-gal positive cells, shortened telomere length, a decrease in the proportion of Ki67 positive cells, a decrease in the proportion of S phase cells, a weakening of monoclonal formation ability, an increase in the degree of DNA damage, an increase in ROS production and / or an enlargement of the cell nucleus.

[0015] In the above application, the inhibition of mitochondrial function can be manifested as an increase in mitochondrial mass, an increase in mtDNA copy number, a decrease in mitochondrial membrane potential, an increase in mtROS and / or a decrease in oxidative respiration rate.

[0016] In the above application, the mitochondrial stability disorder can be manifested as an increase in the number of mitochondria, a decrease in the area of ​​mitochondria, a decrease in the aspect ratio of mitochondria and / or an increase in abnormal mitochondria.

[0017] The present invention also protects the use of a substance that inhibits the activity and / or expression of MAVS protein or MAVS interacting protein in the preparation of a premature aging mouse model; the premature aging mouse model may have at least one of the following phenotypes A1) to A17): A1) an increased proportion of SA-β-gal positive cells; A2) shortened telomere length; A3) a decreased proportion of Ki67 positive cells; A4) a decreased proportion of cells in the S phase; A5) a weakened ability to form monoclonal clones; A6) an increased degree of DNA damage; A7) an increased production of ROS; A8) an enlarged nucleus; A9) an increase in mitochondrial mass; A10) an increase in the number of mtDNA copies; A11) a decrease in mitochondrial membrane potential; A12) an increase in mtROS; A13) a decrease in the oxidative respiration rate; A14) an increase in the number of mitochondria; A15) a decrease in the mitochondrial area; A16) a decrease in the mitochondrial aspect ratio; A17) an increase in abnormal mitochondria.

[0018] In any of the above applications, the MAVS interacting protein may be OPA1 protein.

[0019] In any of the above-mentioned applications, the substance that inhibits the activity and / or expression of MAVS protein or MAVS interacting protein may be gRNA; the nucleotide sequence of gRNA is 5'-ATTGCGGCAGATATACTTAT-3' or 5'-GCAGAAGTTCTTCCTGAAGT-3'. The gRNA with a nucleotide sequence of 5'-ATTGCGGCAGATATACTTAT-3' can inhibit the activity and / or expression of MAVS protein; the gRNA with a nucleotide sequence of 5'-GCAGAAGTTCTTCCTGAAGT-3' can inhibit the activity and / or expression of MAVS interacting protein. That is, the nucleotide sequence of the gRNA that inhibits the activity and / or expression of MAVS protein is as shown in SEQ ID NO:3; the nucleotide sequence of the gRNA that inhibits the activity and / or expression of MAVS interacting protein is as shown in SEQ ID NO:4.

[0020] Any of the above-mentioned substances that inhibit the activity and / or expression of MAVS protein or MAVS interacting protein also falls within the scope of protection of the present invention.

[0021] The present invention also protects a pluripotent stem cell model lacking MAVS protein, which may be hESC, hMSC or hNSC lacking MAVS protein; the pluripotent stem cell model is obtained by editing the MAVS gene using the CRISPR / Cas9 gene editing system; the nucleotide sequence of the gRNA in the CRISPR / Cas9 gene editing system is shown in SEQ ID NO:3.

[0022] The MAVS protein-deficient pluripotent stem cell model is useful for exploring the potential mechanism of MAVS in regulating the aging of human stem cells and provides a scientific reference for developing potential aging intervention methods in this process in the future.

[0023] The present invention first edited the MAVS gene in human embryonic stem cells (hESC) to obtain hESCs lacking MAVS protein, and further differentiated the hESCs lacking MAVS protein into human mesenchymal stem cells (hMSC) and human neural stem cells (hNSC) using stem cell directed differentiation technology, and used a series of genetics, cell biology, molecular biology, biochemistry and other detection methods, supplemented by liquid chromatography-tandem mass spectrometry (LC-MS / MS) and transcriptome sequencing (RNA-seq) and other omics detection methods, combined with bioinformatics analysis of the molecular mechanism of MAVS regulating human stem cell aging. Experiments have shown that the loss of MAVS protein accelerates the aging of human mesenchymal stem cells. At the same time, the present invention reveals that MAVS can interact with OPA1 to maintain mitochondrial function, thereby delaying the aging of human mesenchymal stem cells. The present invention describes the important role of the MAVS-OPA1-mitochondrial axis in regulating the aging process of human mesenchymal stem cells. The present invention has important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 To obtain and identify pluripotent stem cells lacking MAVS protein. A is a schematic diagram of obtaining hESC, hMSC and hNSC lacking MAVS protein; B is a schematic diagram of targeting MAVS gene editing using CRISPR / Cas9 system; C is a schematic diagram of identifying MAVS - / - Deletion of MAVS protein in hESCs; D is identification of MAVS - / - The fluorescence signal of MAVS protein in hESCs disappears; E is the detection of MAVS + / + and MAVS - / - Stemness markers are normally expressed in hESCs; F is flow cytometry analysis of MAVS + / + and MAVS - / - hMSCs normally express MSC positive surface markers but do not express MSC negative surface markers; G is for identification of MAVS - / - Loss of MAVS protein in hMSCs; H is identification of MAVS - / - The fluorescence signal of MAVS protein in hMSCs disappears; I is the detection of MAVS + / + and MAVS - / - Normal expression of stemness markers in hNSCs; J is the identification of MAVS - / - Loss of MAVS protein in hNSCs; K indicates identification of MAVS - / -The fluorescence signal of MAVS protein in hNSCs disappears; L is a heat map showing MAVS + / + and MAVS - / - RNA-seq data of hESCs, hMSCs, and hNSCs replicated well; M is for MAVS + / + and MAVS - / - Principal component analysis of RNA-seq data of hESCs, hMSCs, and hNSCs; N is the bar graph showing MAVS + / + and MAVS - / - The number of differentially expressed genes among hESCs, hMSCs and hNSCs.

[0025] Figure 2 MAVS protein deficiency accelerates hMSC aging. A: The proportion of SA-β-gal positive cells in hMSCs deficient in MAVS protein increases; B: The telomere length of hMSCs deficient in MAVS protein shortens; C: The proportion of Ki67 positive cells in hMSCs deficient in MAVS protein decreases; D: The proportion of S phase cells in hMSCs deficient in MAVS protein decreases; E: The monoclonal formation ability of hMSCs deficient in MAVS protein is weakened; F: + / + and MAVS - / - Growth curve of hMSCs; G is Western blot detection of MAVS + / + and MAVS - / - The expression levels of aging markers of hMSCs; H is the increased DNA damage in hMSCs after MAVS protein deficiency; I is the flow cytometry analysis showing an increase in the total ROS level in hMSCs after MAVS protein deficiency; J is the decreased level of heterochromatin marker H3K9me3 in hMSCs after MAVS protein deficiency; K is the enlargement of the nucleus of hMSCs after MAVS protein deficiency; L is the weakened retention ability of hMSCs in mice after MAVS protein deficiency; M is the GO term analysis of up- and down-regulated genes in hMSCs after MAVS protein deficiency.

[0026] Figure 3 The loss of MAVS protein impaired mitochondrial dynamics homeostasis. A shows the increase of mitochondrial mass in hMSCs after MAVS protein loss by flow cytometry; B shows the increase of mitochondrial number, decrease of mitochondrial area and decrease of mitochondrial aspect ratio in hMSCs after MAVS protein loss by electron microscopy; C shows the increase of abnormal mitochondria in hMSCs after MAVS protein loss; D shows the increase of mtDNA copy number in hMSCs after MAVS protein loss; E shows the decrease of mitochondrial membrane potential in hMSCs after MAVS protein loss; F shows the increase of mtROS in hMSCs after MAVS protein loss; G shows the decrease of mitochondrial oxidative respiration rate in hMSCs after MAVS protein loss.

[0027] Figure 4 MAVS and OPA1 interact in mitochondria in hMSCs. A is a flow chart of liquid chromatography-tandem mass spectrometry for identifying MAVS-interacting proteins; B is a GO CC term analysis of the identified interacting proteins; C is the peptide sequence of the protein that interacts with MAVS; D is the interaction between OPA1 and MAVS identified by endogenous CO-IP; E is the interaction between OPA1 and MAVS identified by exogenous CO-IP; F is the co-localization of fluorescence signals of OPA1 and MAVS; G is the downregulation of OPA1 protein level in hMSCs after MAVS protein deficiency; H is the decrease in MAVS protein level in replicatively aged hMSCs; I is the decrease in OPA1 protein level in replicatively aged hMSCs.

[0028] Figure 5 The knockdown of OPA1 protein leads to mitochondrial functional homeostasis defects and cell senescence. A is a schematic diagram of lentivirus-mediated knockdown of OPA1; B is lentivirus-mediated knockdown of OPA1 protein; C is the increase in mitochondrial mass of hMSC after OPA1 knockdown; D is the increase in the number of mitochondria, the decrease in area, and the decrease in mitochondrial aspect ratio of hMSC after OPA1 knockdown; E is the increase in abnormal mitochondria of hMSC after OPA1 knockdown; F is the decrease in mitochondrial membrane potential of hMSC after OPA1 knockdown; G is the increase in mtROS of hMSC after OPA1 knockdown; H is the increase in the proportion of SA-β-gal-positive cells of hMSC after OPA1 knockdown; I is the decrease in the proportion of Ki67-positive cells of hMSC after OPA1 knockdown; J is the weakening of the monoclonal formation ability of hMSC after OPA1 knockdown; K is the expression level of aging markers of hMSC after OPA1 knockdown; L is the enlargement of the nucleus of hMSC after OPA1 knockdown.

[0029] Figure 6 For MAVS - / - The replenishment of MAVS in hMSCs can improve mitochondrial dysfunction and delay cell senescence. A is a schematic diagram of the replenishment of MAVS mediated by lentivirus; B is a schematic diagram of MAVS after replenishment - / - OPA1 protein level was upregulated in hMSCs; C is MAVS after MAVS replenishment - / - Mitochondrial mass is reduced in hMSCs; D is MAVS after MAVS replenishment - / - The number of mitochondria in hMSCs decreased and the mitochondrial aspect ratio increased; E is MAVS after MAVS replenishment - / - Abnormal mitochondria in hMSCs are reduced; F is MAVS after MAVS replenishment - / - Mitochondrial membrane potential increased in hMSCs; G is MAVS after MAVS replenishment - / -mtROS decreased in hMSCs; H is MAVS after MAVS replenishment - / - The proportion of SA-β-gal positive cells in hMSCs decreased; I is MAVS after MAVS replenishment - / - The proportion of Ki67-positive cells in hMSCs increased; J is MAVS after MAVS replenishment - / - The monoclonal formation ability of hMSCs increased; K is MAVS after MAVS replenishment - / - Expression levels of senescence markers in hMSCs; L is MAVS after MAVS replenishment - / - Increased protein levels of the heterochromatin marker H3K9me3 in hMSCs; M is MAVS after MAVS complementation - / - The expression of up- and down-regulated genes in hMSCs was restored.

[0030] Figure 7 For MAVS - / - Overexpression of OPA1 in hMSCs can improve mitochondrial dysfunction and delay cell senescence. A is a schematic diagram of lentivirus-mediated overexpression of OPA1; B is a schematic diagram of MAVS after OPA1 overexpression - / - OPA1 protein levels increased in hMSCs; C is MAVS after OPA1 overexpression - / - Mitochondrial mass is reduced in hMSCs; D is MAVS after OPA1 overexpression - / - The mtDNA copy number in hMSCs is reduced; E is MAVS after OPA1 overexpression - / - Mitochondrial membrane potential increased in hMSCs; F is MAVS after OPA1 overexpression - / - The proportion of SA-β-gal positive cells in hMSCs decreased; G is MAVS after OPA1 overexpression - / - The proportion of Ki67-positive cells in hMSCs increased; H is MAVS after OPA1 overexpression - / - Expression levels of senescence markers in hMSCs; I is MAVS after OPA1 overexpression - / - The expression level of LAP2 in hMSCs increased; J is MAVS after OPA1 overexpression - / - The cell nuclei in hMSCs become smaller; K is a schematic diagram of the MAVS-OPA1 axis regulating hMSC aging. DETAILED DESCRIPTION

[0031] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0032] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0033] The Gene ID of MAVS protein is 57506, and the Gene ID of OPA1 protein is 4976.

[0034] Example

[0035] 1. Experimental Methods

[0036] 1. Animal experiments (specifically in vivo hMSC transplantation experiments)

[0037] All animal experiments were authorized by the Animal Experiment Committee of the Chinese Academy of Sciences. Nude mice were purchased from SiPeiFu (Beijing) Biotechnology Co., Ltd. and maintained with standard laboratory chow at 25°C and a 12-h light-dark cycle.

[0038] About 1×10 6 hMSCs (MAVS + / + hESCs or MAVS - / - hESCs) were injected into the tibialis anterior muscle of male nude mice (6-8 weeks old). After 0, 3, and 5 days of conventional feeding, the mice were anesthetized with isoflurane, and then the luciferin activity was analyzed using an in vivo imaging system.

[0039] 2. Cell culture

[0040] MAVS + / + hESCs (wild-type hESCs from WiCell Institute) or MAVS - / -hESCs were maintained on mitomycin C-inactivated mouse embryonic fibroblast (MEF) feeder layers using hESC medium containing DMEM / F12 (Thermo Fisher Scientific, Catalog No.: 11330057), 20% Knockout Serum Replacement (Thermo Fisher Scientific, Catalog No.: 10828028), 1% GlutaMAX (Thermo Fisher Scientific, Catalog No.: 35050079), 1% non-essential amino acids (NEAA, Thermo Fisher Scientific, Catalog No.: 11140076), 1% penicillin-streptomycin (PS, ThermoFisher Scientific, Catalog No.: 15140-163), 55 μM β-mercaptoethanol (Thermo Fisher Scientific, Catalog No.: 21985-023) and 10 ng / ml bFGF (Joint Protein Central, Catalog No.: BBI-EXP-002) or cultured in mTeSR medium on Matrigel-coated plates.

[0041] hMSCs were cultured on gelatin-coated plates using hMPC medium containing MEMα basal medium (Thermo Fisher Scientific, Cat. No.: 32571-101), 10% fetal bovine serum (Gibco, 42Q7980K), 1% PS, 1% NEAA, and 1 ng / ml bFGF. When the cell density reached about 95%, 1×10 cells were plated per well. 5 The cells were passaged in 6-well plates at different densities.

[0042] hNSCs were cultured on collagen pre-coated plates using NSMM medium containing 50% modified DMEM / F12 (Gibco, Catalog No.: 12634028), 50% Neurobasal (Gibco, Catalog No.: 12348017), 2 mM GlutaMAX, 1% non-essential amino acids, 1% penicillin-streptomycin, 1×B27 (Gibco, Catalog No.: 12587010), 1×N2 (Gibco, Catalog No.: 17502048), 10 ng / mL hLIF (Millipore, Catalog No.: LIF1050), 2 μM SB431542 (Selleck, Catalog No.: S1067) and 3 μM CHIR99021 (Selleck, Catalog No.: S1263).

[0043] HEK293T cells were cultured in high glucose DMEM (Thermo Fisher Scientific, Catalog No.: SH30243.01) containing 10% fetal bovine serum (Gemini, Catalog No.: 900-108) and 1% PS, 1% NEAA and 1% GlutaMAX.

[0044] 3. MAVS - / - Generation of hESCs

[0045] Gene knockout of MAVS using CRISPR / Cas9 system - / - hESCs. The specific steps are as follows:

[0046] (1) The sgRNA targeting the second exon of the MAVS gene was cloned into the pCAG-mCherry-gRNA vector (Addgene, #87110) to obtain the sgRNA vector.

[0047] The nucleotide sequence of sgRNA is 5′-ATTGCGGCAGATATACTTAT-3′ (SEQ ID NO: 3).

[0048] (2) Cultivating MAVS in mTeSR medium on Matrigel-coated plates + / + hESCs, and the ROCK inhibitor Y-27632 (Selleck) was added at least 8 hours before targeting.

[0049] (3) After completing step (2), the sgRNA vector and pCAG-1BPNLS-Cas9-1BPNLS-2AGFP vector (Addgene, #87109) were co-transfected into MAVS using a 4D Nucleofector (Lonza) at a mass ratio of 1:2. + / + The cells were then cultured on Matrigel-coated plates for 48 hours, and GFP / mCherry double-positive cells were sorted using a cell sorting (FACS) system (BD FACSAria) and cultured on a MEF feeder layer with hESC medium.

[0050] (4) After completing step (3), genomic DNA is extracted and sequenced from the grown ESC clones to identify whether the MAVS gene has been edited. The clones in which the MAVS gene has been edited and can lead to the loss of MAVS protein are MAVS - / - hESCs.

[0051] 4. MAVS + / + hMSCs and MAVS - / - Generation and characterization of hMSCs

[0052] MAVS + / + hMSCs were isolated from MAVS + / + hESCs differentiation. The specific steps are as follows: MAVS + / + After about 3 days of culture on the MEF feeder layer, hESCs were digested with Dispase; the cells were then seeded onto low-adhesion six-well plates and cultured for 72 hours to obtain embryoid bodies; the embryoid bodies were transferred to six-well plates pre-coated with Matrigel and differentiated using hMSC culture medium; fibroblast-like cells appeared and continued to be cultured using hMSC culture medium in new 6-well plates pre-coated with gelatin (SigmaAldrich) after about 10 days; after the cells reached a density of about 90%, they were collected and purified using a FACS system by selecting hMSC-specific markers such as CD105, CD73 and CD90; the purity of hMSCs was confirmed by analyzing negative hMSC markers such as CD14, CD19 and CD34.

[0053] MAVS - / - hMSCs were isolated from MAVS - / - hESCs were differentiated. + / + hESCs replaced by MAVS - / - hESCs, and all other steps remained unchanged.

[0054] 5. MAVS + / + hNSCs and MAVS - / - Generation and characterization of hNSCs

[0055] MAVS + / + hNSCs were isolated from MAVS + / + hESCs were differentiated. The specific steps are as follows: MAVS + / + After being cultured in hESC medium for about 2 days, hESCs were seeded onto six-well plates pre-seeded with MEF feeder cells, which were then replaced with hNSC differentiation medium; the cells were then digested with Accumax (Millipore), transplanted onto plates pre-coated with Matrigel, and maintained in hNSC medium.

[0056] MAVS - / - hNSCs were isolated from MAVS - / - hESCs were differentiated. + / + hESCs replaced by MAVS - / - hESCs, and all other steps remained unchanged.

[0057] 6. MAVS - / - Genotyping of hESCs

[0058] MAVS was extracted using a DNA extraction kit (TIANGEN). - / - hESCs genomic DNA; then MAVS - / - The genomic DNA of hESCs was used as a template, and primers were used to amplify the DNA fragment containing the sgRNA target site; finally, a cloning kit (TransGen) was used to clone the DNA fragment containing the sgRNA target site into the pEASY vector and sequenced.

[0059] 7. RNA extraction, real-time quantitative PCR (qPCR), and RNA-seq

[0060] The TRIzol method was used to extract RNA from cells, and then THUNDERBIRD qPCR analysis was performed using CFX384 Real-Time PCR Detection System (Bio-Rad) using TOYOBO Green qPCR Mix (TOYOBO).

[0061] When performing qPCR, the primers used to detect telomere length are F1: 5'

[0062] -GGTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT-3' and R1:5'

[0063] -TCCCGACTATCCCTATCCCTATCCCTATCCCTATCCCTATCCCTA-3', the primers used to detect the internal reference were F2: 5'-CAGCAAGTGGGAAGGTGTAATCC-3' and R2: 5'

[0064] -CCCATTCTATCATCAACGGGTACAA-3'.

[0065] When performing qPCR, the primers used to detect the mtDNA copy number were F3: 5'-CACCCAAGAACAGGGTTTGT-3' and R3: 5'-TGGCCATGGGTATGTTGTTA-3', and the primers used to detect the internal control were F4: 5'-TGCTGTCTCCATGTTTGATGTATCT-3' and R4: 5'

[0066] -TCTCTGCTCCCCACCTCTAAGT-3'.

[0067] For RNA-seq, use the VAHTS Universal V6 RNA-seq Library Prep Kit for

[0068] Sequencing libraries were constructed using the NR604-01 / 02 kit and index codes were added to capture the sequence of each sample as recommended by the manufacturer. Paired-end sequencing was performed using the Illumina NovaSeq 6000 platform with a read length of 150 bp.

[0069] 8. Plasmid construction

[0070] To obtain the MAVS overexpression plasmid and OPA1 overexpression plasmid, the cDNA of human cell lines was used as a template, and the coding sequence of each gene (MAVS: NM_020746.5; OPA1: NM_015560.3) was amplified using the PrimeSTAR DNA polymerase kit, and cloned into the pLE4 vector through the XbaI-SalI site (MAVS) or BamHI-SalI site (OPA1). To obtain the MAVS or OPA1 overexpression HA or FLAG-tagged plasmid, the coding sequence of HA or Flag (HA: TACCCATACGACGTTCCAGATTACGCT; Flag: GACTACAAGGACGACGATGACAAG) was directly designed in the reverse primer of MAVS or OPA1; and the amplification was carried out according to the above steps to construct the vector.

[0071] For CRISPR / Cas9-mediated knockout of the OPA1 gene, OPA1-specific sgRNA (nucleotide sequence 5′-GCAGAAGTTCTTCCTGAAGT-3′ (SEQ ID NO: 4)) was cloned into lenti-CRISPRv2 (Addgene, #52961) via the Esp3I site.

[0072] 9. Lentivirus packaging and cell transfection

[0073] HEK293T cells were co-transfected with polyethylenimine (PEI, Polysciences) using overexpression or knockout plasmids and lentiviral packaging vectors (including psPAX2 (Addgene, #12260) and pMD2.G (Addgene, #12259)). After that, the culture supernatant was collected on the second and third days, and then ultracentrifuged at 4°C and 19400 rpm for 2.25 hours to purify the lentiviral particles. Next, cells, wild-type (WT) hMSCs or MAVS were infected with lentivirus. - / -After hMSCs were subcultured and adhered to the wall, lentivirus was added to the cells and polybrene (Sigma-Aldrich) was added at the same time. To enrich the lentiviral transfected OPA1 knockout cells, puromycin (0.5 μg / mL, Gibco) was added to the cells after 48 hours. After multiple passages, further analysis was performed, including immunofluorescence staining, clonal expansion experiments, SA-β-gal staining, and protein extraction.

[0074] 10. RNA-seq data processing

[0075] To process the RNA-seq raw data, Trim Galore (version 0.4.5) was used to eliminate low-quality reads and sequences containing adapters; the trimmed data were then aligned to the human hg19 reference genome using STAR (version 2.7.1a) software, and the gene expression levels were determined by calculating the number of reads assigned to each gene using featureCounts (version 2.0.1). Differentially expressed genes (DEGs) were obtained using the R package DESeq2 (version 1.30.1) with an absolute log2 (fold change) greater than 0.5 and a Benjamini-Hochberg adjusted P value less than 0.05. Enriched gene ontology (GO) terms and pathways were identified using Metascape. Public gene sets were obtained from the MSigDB database and Regeneration Roadmap. Gene set enrichment analysis was performed using GSEA (version 4.1.0) with default parameters.

[0076] 11. Protein co-immunoprecipitation analysis

[0077] HEK293T cells were transfected with plasmids expressing Flag-Luciferase or Flag-MAVS (the nucleotide sequence of Luciferase is shown in SEQ ID NO: 1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO: 2), and MAVS interacting proteins were identified by Co-IP. After 48 hours of cell growth, the cells were lysed using CHAPS buffer containing 0.3% CHAPS, 40mM HEPES, 1mM EDTA (pH 7.5), and 120mM NaCl, followed by the addition of 1× complete protease and phosphatase inhibitor cocktail (Roche) and 1× PMSF (Dingguochangsheng Biotech). After rotating on a rotator at 4°C for 2 hours, the cell lysate was centrifuged at 12000 rpm at 4°C for 30 minutes, the supernatant was collected, and quantified using a BCA kit (Dingguochangsheng Biotech). The protein amount was adjusted to equal and mixed with beads with anti-Flag antibodies (ANTI- M2Affinity Gel, Sigma) was rotated on a rotator at 4°C for more than 8 hours. Further, the immunoprecipitate was centrifuged and then washed 5 times at intervals of 5 minutes. For competitive elution, the precipitate was rotated on a rotator at 4°C for 3 hours with Flag peptide (Sigma). Finally, the supernatant was collected, dissolved in 2× SDS buffer (Dingguochangsheng Biotech), boiled at 95°C for 10 minutes, and then stored at -80°C for subsequent analysis.

[0078] To verify the interaction, endogenous Co-IP experiments were performed in WT hMSCs using lysis buffer (50 mM Tris-HCl buffer at pH 8.0 containing 0.5% NP-40 and 120 mM NaCl) supplemented with 1× complete protease and phosphatase inhibitor cocktail. The supernatant (1 mg protein) was then mixed with the indicated antibodies, rotated overnight at 4°C, and subsequently incubated with ProteinA / G PLUS Agarose beads (Santa Cruz) at 4°C for 2 hours, and the immune complexes were eluted by boiling. For exogenous Co-IP experiments, co-transfection was performed in HEK293T cells using the corresponding plasmids, which were collected 48 hours after transfection and lysed using lysis buffer.

[0079] 12. Liquid chromatography-tandem mass spectrometry (LC-MS / MS analysis)

[0080] The eluate obtained from Co-IP was subjected to 10% SDS-PAGE protein separation, and then the gel was stained with Coomassie Brilliant Blue for 1 hour and washed several times with a destaining solution (methanol: glacial acetic acid: deionized water = 5:1:4) for destaining.

[0081] After determining the molecular weight, the target bands were extracted from the gel and analyzed using LC-MS / MS. MS data spanning the mass range of 300-1600 m / z were acquired at a high resolution of 70000 (m / z 200) using a QExactive mass spectrometer (Thermo Scientific). Protein identification was then performed from the raw data using the Sequest HT search engine's Proteome Discovery (version 2.2.0.388). Peptide data were searched using the UniProt human protein database. High-confidence peptide filtering was performed on protein identification to ensure accuracy, and the false discovery rate (FDR) analysis threshold was set to 1% in Percolator.

[0082] Metascape was used to perform GO CC and GO BP enrichment analysis on MAVS-interacting proteins.

[0083] 13. Western Blot Analysis

[0084] Cells were lysed with 1×SDS lysis buffer containing 62.5 mM Tris-HCl (pH 6.8) and 2% SDS, and then boiled at 95°C for 10 minutes. Protein concentration was determined using a BCA kit. SDS-PAGE was then performed, and chemiluminescent imaging was performed on a ChemiDoc XRS+ system (Bio-Rad Laboratories, Inc.) using ImageLab software. Protein band intensities were quantified using ImageJ.

[0085] 14. Immunofluorescence staining

[0086] Cells were seeded on coverslips (Thermo Fisher Scientific) to a density of about 80%, washed twice with PBS, and then fixed with 4% paraformaldehyde (PFA) for 15 minutes, permeabilized with Triton X-100 (0.2%, Sigma) for 10 minutes, and blocked with donkey serum (10%, Jackson ImmunoResearch) for 1 hour at room temperature. After that, after incubation with the primary antibody overnight, the coverslips were incubated with the secondary antibody for 1 hour at room temperature. Finally, Hoechst 33342 (Thermo Fisher Scientific) was used to label the nuclei. Zeiss Confocal System LSM900 and Leica SP5 Confocal System were used for image capture.

[0087] In the present application, the primary antibodies detected were anti-MAVS (Santa Cruz, sc-166583, 1:1000), anti-OPA1 (BD, 612606, 1:1000), anti-p21Cip1 (CST, 2947S, 1:1000), anti-Lamin B1 (Abcam, ab16048, 1:1000), anti-LAP2 (BD, 611000, 1:1000), anti-Flag (Sigma, F1804, 1:2000), anti-HA (CST, 3724S, 1:1000), anti-GAPDH (Santa Cruz, sc-365062, 1:3000), anti-OPA1 (CST, 67589S, 1:200), anti-TOM20 (Santa Cruz, sc-11415, 1:200), anti-NANOG (Abcam, ab21624, 1:100), anti-SOX2 (Santa Cruz, sc-17320, 1:200), anti-OCT3 / 4 (Santa Cruz, sc-5279, 1:200), anti-FOXA2 (CST, 8186S, 1:200), anti-SMA (ZSGB-BIO, ZM-0003, 1:200), anti-TuJ1 (Sigma, T2200,1:200), anti-PAX6 (BioLegend, 901301, 1:200), anti-Nestin (BD, 560422, 1:200), anti-Ki67 (ZSGB-BIO, ZM 0166, 1:1000), anti-LAP2 (BD, 611000, 1:250), anti-H3K9me3 (Abcam, ab8898, 1:500), anti-LaminA / C (Santa Cruz, sc-376248, 1:500), anti-53BP1 (Bethyl Laboratories, A300-273A, 1:200), anti-γH2AX (Millipore, 05-636, 1:200), anti-CD73-PE (BD Biosciences, 550257, 1:200), anti-CD90-FITC (BD Biosciences, 555595, 1:200), anti-CD105-APC (BD Biosciences, 17-1057-42, 1:200), anti-CD14-PE (BD Biosciences, 555398, 1:200), anti-CD19-APC (BD Biosciences, 555415, 1:200), and anti-CD34-FITC (BD Biosciences, 555821, 1:200). ,

[0088] The secondary antibodies used for western blotting were HRP-conjugated GoatAnti-Mouse IgG(H+L)(ZSGB-Bio, ZB-2305) and HRP-conjugated GoatAnti-Rabbit IgG(H+L)(ZSGB-Bio, ZB-2301); the secondary antibodies used for immunofluorescence were Alexa 488DonkeyAnti-Mouse IgG(H+L)(Invitrogen, A21202), Alexa 568DonkeyAnti-Rabbit IgG (H+L) (Invitrogen, A10042) and Alexa 647DonkeyAnti-Goat IgG (H+L) (Invitrogen, A21447).

[0089] 15. Transmission electron microscopy imaging

[0090] TEM was used to observe the fine structure of mitochondria. Approximately 5×10 6 Cells were trypsinized, washed with PBS and centrifuged at 1000 rpm for 5 minutes. Subsequently, the cell pellet was fixed with 2.5% glutaraldehyde for about 20 minutes at room temperature and overnight at 4°C. After that, conventional heavy metal staining procedures were performed with uranyl acetate and lead citrate staining, and images were captured using a transmission electron microscope (FEI Tecnai Spirit 120 kV).

[0091] Mitochondria were counted in intact cells, and data for each sample were obtained from 30-40 cells. For each sample, the area and aspect ratio of more than 100 mitochondria were counted. Abnormal mitochondria were described as obvious changes in mitochondrial matrix density, formation of membrane vesicles, and disruption of mitochondrial matrix structure. Mitochondrial number, area, and aspect ratio were determined using ImageJ.

[0092] 16. Senescence-associated β-galactosidase (SA-β-gal) staining

[0093] Cells were fixed for 5 minutes using a fixation buffer containing 0.2% glutaraldehyde and 2% formaldehyde, and fresh SA-β-gal staining solution (containing 150 mM NaCl, 2 mM MgCl2, 5 mM K4[Fe(CN)6], 5 mM K3[Fe(CN)6], 40 mM citric acid / sodium phosphate buffer and 1 mg / ml X-gal (AMRESCO) in water) was prepared and stained at 37°C in the dark for more than 8 hours. Images were captured using an optical microscope. The percentage of SA-β-gal staining-positive cells was quantified using ImageJ.

[0094] 17. Clonal expansion test

[0095] The cells were seeded on gelatin-coated culture plates at a density of 2,000 cells per well. After about two weeks, when the cells were confluent, the cells were washed with PBS, fixed with 4% paraformaldehyde for half an hour, and stained with crystal violet solution at room temperature for 30 minutes. The excess stain was gently rinsed off with tap water, and images were taken with Epson Perfection V370 Photo, and the relative cell density was quantified with ImageJ.

[0096] 18. Cell cycle experiment

[0097] The cells were digested with TrypLE and washed with PBS, then fixed in precooled 70% ethanol overnight. The next day, after centrifugation at 2500rpm at 4°C, the supernatant was discarded from each tube, the cell pellet was resuspended and incubated at 37°C for 30 minutes with a PBS solution containing RNase A (0.2mg / mL, TIANGEN, for RNA degradation), propidium iodide (0.02mg / mL, PI, Invitrogen) and Triton X-100 (0.1%). Cell cycle measurements were performed using a flow cytometer (BD FACSCalibur).

[0098] 19. Measurement of total cellular ROS

[0099] hMSCs were mixed with the ROS indicator H2DCFDA (Invitrogen, #C6827) to measure total intracellular ROS. The measurements were performed using an LSRFortessa cell analyzer (BD) and the data were analyzed using FlowJo software (TreeStar, Ashland, OR).

[0100] 20. Telomere length analysis

[0101] Telomere length analysis was performed by qPCR.

[0102] 21. Analysis of mtDNA copy number

[0103] By qPCR analysis, mitochondrial genes (tRNA Leu(UUR) The mtDNA content was defined by the relative ratio between the copy number of the nuclear gene (β-2-microglobulin, β2M) and the copy number of the nuclear gene (β-2-microglobulin, β2M). Before measuring the mtDNA copy number, the template was treated with RNaseA to remove RNA contamination.

[0104] 22. Analysis of mitochondrial ROS, mass and membrane potential

[0105] Mitochondrial ROS levels were assessed using MitoSOXRed (2.5 μM, Invitrogen, #M36008) at 37 ° C for 20 minutes. Mitochondrial mass was measured using NAO (10 μM, Invitrogen, #A1372) at 37 ° C for 20 minutes. In addition, MMP was determined using JC-10AssayKit (AATBioquest, #22801) according to the manufacturer's instructions. That is, living cells were incubated with 1×JC-10 working solution at 37 ° C for 20 minutes. MMP levels are defined by the ratio of JC-10 aggregate emission to monomer emission. All of the above measurements were performed using a flow cytometer (BD LSRFortessa).

[0106] 23. Cell mitochondrial stress measurement

[0107] Mitochondrial respiration was assessed by adding different regulators and analyzing oxygen consumption rate (OCR). 4 Cells were seeded at a density of 100 μM per well of a gelatin-coated Seahorse culture microplate. The Seahorse analyzer was preheated 1 day in advance. The assay medium was then prepared with basal medium supplemented with 2 mM glutamine, 10 mM glucose, and 1 mM sodium pyruvate. The cell culture microplate was incubated in a CO2-free incubator for 1 hour and washed twice with assay medium before incubation. The Seahorse XF assay plate was precalibrated and then the mitochondrial respiration regulators rotenone / antimycin A (0.5 μM), oligomycin (1 μM), and FCCP (2 μM) were added. The experiments were performed and analyzed using the “Wave” software. Finally, the OCR values ​​were normalized by the number of cells per well.

[0108] 2. Experimental Results

[0109] 1. Gene editing at the second exon of the MAVS gene was performed using the CRISPR / Cas9 system to obtain a human embryonic stem cell line lacking the MAVS protein (see Figure 1 A and B); the absence of MAVS protein was further confirmed by Western blot and immunofluorescence staining ( Figure 1 C and D); at the same time, the cell morphology of hESC was normal after MAVS protein loss, and the fluorescent staining of human embryonic stem cell stemness markers showed that MAVS protein loss did not affect the stemness of hESC, and the karyotype was normal ( Figure 1 D and E); further, using stem cell directed differentiation technology, the inventors obtained and identified hMSCs and hNSCs lacking MAVS protein ( Figure 1 FK); Transcriptome sequencing analysis found that compared with hESCs and hNSCs, MAVS + / + and MAVS - / - There are more differentially expressed genes between hMSCs ( Figure 1 , LN), and Ki67 staining showed that the loss of MAVS protein did not affect the proliferation capacity of hESCs and hNSCs. Therefore, the inventors focused on MAVS + / + and MAVS - / - hMSCs were used for research.

[0110] 2. Inventors in MAVS + / + and MAVS - / - A series of senescent phenotypes were detected in hMSCs. SA-β-gal staining experiments revealed that MAVS- / - The proportion of SA-β-gal positive cells in hMSCs increased, and the telomere length was shortened ( Figure 2 A and B); and MAVS - / - The proportion of Ki67-positive cells and cells in the S phase of hMSCs decreased, and the ability to form monoclonal cells was weakened. By drawing the growth curve of continuous passage, it was found that the growth of hMSCs lacking MAVS protein was prematurely arrested ( Figure 2 CF); furthermore, it was found that the senescence marker p21 in hMSCs lacking MAVS protein Cip1 The expression of Lamin B1 and LAP2 was decreased ( Figure 2 G); at the same time, MAVS - / - The degree of DNA damage in hMSCs increased, and more ROS were produced in the cells ( Figure 2 H and I); H3K9me3, a marker of heterochromatin, has a fluorescence signal in MAVS - / - hMSCs significantly decreased ( Figure 2 In addition, MAVS - / - The nuclei of hMSCs also became significantly larger ( Figure 2 Middle K); In vivo retention experiments showed that MAVS - / - hMSCs decay faster in mice ( Figure 2 RNA-seq sequencing analysis showed that MAVS - / - The genes upregulated in hMSCs were enriched in cell senescence-related pathways, while the genes related to telomere length maintenance and DNA repair were downregulated ( Figure 2 Middle M).

[0111] 3. The inventors also tested several indicators related to mitochondrial structure and function. Flow cytometry analysis found that MAVS - / - The mitochondrial mass of hMSCs increased ( Figure 3 Electron microscopy results further showed that MAVS - / - The dysregulated mitochondrial dynamics homeostasis of hMSCs was manifested by an increase in mitochondrial number, a decrease in area, a decrease in aspect ratio, and an increase in abnormal mitochondria ( Figure 3 B and C); and MAVS - / - The mtDNA copy number of hMSCs increased ( Figure 3 Middle D); Flow cytometry analysis showed MAVS - / - The decreased mitochondrial membrane potential, increased mtROS, and mitochondrial stress test of hMSCs indicated that MAVS - / - The oxidative respiration rate of hMSCs decreased ( Figure 3 (EG).

[0112] The above results show that MAVS- / - The mitochondrial structural and functional homeostasis of hMSCs was impaired.

[0113] 4. To explore the molecular mechanism of MAVS-mediated hMSC aging, the inventors conducted mass spectrometry analysis to identify MAVS interacting proteins. Through liquid chromatography-tandem mass spectrometry analysis, the inventors identified a large number of MAVS interacting proteins, and GOterm analysis revealed that a large number of mitochondrial membrane proteins interacted with MAVS ( Figure 4 A and B); Three mitochondrial fusion-related proteins were found to be MAVS interacting proteins, among which OPA1 is a new mitochondrial interacting protein of MAVS identified in this application ( Figure 4 C); The inventors further confirmed the interaction between MAVS and OPA1 by exogenous and exogenous CO-IP, and detected the co-localization of the two by immunofluorescence staining ( Figure 4 DF); at the same time, Western blot results showed that after the loss of MAVS protein, the protein level of OPA1 was also downregulated, and MAVS and OPA1 proteins were also downregulated in replicative senescent hMSCs ( Figure 4 Medium GI).

[0114] Therefore, the inventors began to conduct cell function experiments and used genetic means to intervene in OPA1 to verify its role in stem cell aging and to detect whether it is a downstream target protein of MAVS and is involved in regulating hMSC aging.

[0115] 5. The inventors used lentivirus-mediated gene intervention to knock down OPA1 ( Figure 5 A and B); A series of results showed that after OPA1 knockdown, mitochondrial mass increased, mitochondrial number increased, mitochondrial area decreased, mitochondrial aspect ratio decreased, abnormal mitochondria increased, mitochondrial membrane potential decreased, and mtROS increased ( Figure 5 On the other hand, after OPA1 knockdown, the proportion of SA-β-gal positive cells increased, the proportion of Ki67 positive cells decreased, the monoclonal formation ability weakened, and the expression of LaminB1 and LAP2 proteins decreased, and the cell nucleus became larger ( Figure 5 (HL).

[0116] The above results echo the cell phenotypes after MAVS knockout.

[0117] 6. In order to obtain more definitive results, we then performed reverse complementation of MAVS or OPA1 protein, and obtained results opposite to those of knockout, further confirming the role of MAVS and OPA1 in the aging process of hMSCs.

[0118] (1) The inventors are in MAVS- / - MAVS protein was replenished in hMSCs, and the increase of OPA1 protein content was detected ( Figure 6 A and B); and after MAVS replenishment, mitochondrial mass decreased, mitochondrial number decreased, mitochondrial area increased, mitochondrial aspect ratio increased, and the number of abnormal mitochondria also decreased. In addition, mitochondrial membrane potential was restored and mtROS was reduced ( Figure 6 On the other hand, MAVS protein after replenishment - / - The proportion of SA-β-gal positive cells in hMSCs decreased, the proportion of Ki67 positive cells increased, the monoclonal formation ability increased, and the expression levels of Lamin B1 and LAP2 also showed upregulation ( Figure 6 The fluorescence signal intensity of the heterochromatin marker H3K9me3 also increased after MAVS replenishment ( Figure 6 Meanwhile, joint analysis of RNA-seq showed that the replenishment of MAVS restored the expression of MAVS - / - Gene expression in hMSCs ( Figure 6 Middle M).

[0119] (2) The inventors are in MAVS - / - OPA1 protein was overexpressed in hMSCs, and upregulation of OPA1 protein itself was detected ( Figure 7 A and B); accordingly, the inventors detected a series of mitochondrial and aging-related indicators and found that after OPA1 overexpression, MAVS - / - The mitochondrial function of hMSCs was improved, as shown by decreased mitochondrial mass, reduced mtDNA copy number, and increased mitochondrial membrane potential ( Figure 7 CE); and after OPA1 overexpression, MAVS - / - The senescent phenotype of hMSCs was also alleviated, as shown by a decrease in the proportion of SA-β-gal-positive cells, an increase in the proportion of Ki67-positive cells, and an increase in the expression levels of Lamin B1 and LAP2 proteins ( Figure 7 Meanwhile, MAVS after OPA1 overexpression - / - The nuclei of hMSCs were significantly reduced ( Figure 7 In MAVS - / - The results of overexpression of OPA1 in hMSCs were consistent with those of replenishing MAVS.

[0120] The above results indicate that MAVS can interact with OPA1 to maintain the stability of OPA1 protein, jointly promote the maintenance of mitochondrial structural and functional homeostasis, and thus regulate the aging of hMSCs ( Figure 7 Middle K).

[0121] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Use of a protein or a substance that promotes protein activity and / or expression in the preparation of a product; the product has at least one of the following functions: B1) delaying aging; B2) improving mitochondrial function; B3) maintaining mitochondrial stability; The protein is MAVS protein or MAVS interacting protein.

2. The use according to claim 1, characterized in that: The MAVS interacting protein is OPA1 protein.

3. The use according to claim 1, characterized in that: The delayed aging is manifested in a decrease in the proportion of SA-β-gal positive cells, an increase in telomere length, an increase in the proportion of Ki67 positive cells, an increase in the proportion of cells in the S phase, an improvement in the ability to form monoclonal clones, a decrease in the degree of DNA damage, a decrease in the generation of ROS and / or a decrease in the size of the cell nucleus; The improvement of mitochondrial function is manifested in decreased mitochondrial mass, decreased mtDNA copy number, increased mitochondrial membrane potential, decreased mtROS and / or increased oxidative respiration rate; The maintenance of mitochondrial stability is manifested in a decrease in the number of mitochondria, an increase in the area of ​​mitochondria, an increase in the aspect ratio of mitochondria and / or a decrease in abnormal mitochondria.

4. Use of a substance that inhibits the activity and / or expression of MAVS protein or MAVS interacting protein in the preparation of a product; the function of the product is at least one of C1), C2) and C3): C1) promoting aging; C2) inhibiting mitochondrial function; C3) disturbing mitochondrial stability.

5. The use according to claim 4, characterized in that: The promotion of aging is manifested by an increase in the proportion of SA-β-gal positive cells, shortened telomere length, a decrease in the proportion of Ki67 positive cells, a decrease in the proportion of cells in the S phase, a weakening of the monoclonal formation ability, an increase in the degree of DNA damage, an increase in the generation of ROS and / or an enlargement of the cell nucleus; The inhibition of mitochondrial function is manifested in increased mitochondrial mass, increased mtDNA copy number, decreased mitochondrial membrane potential, increased mtROS and / or decreased oxidative respiration rate; The mitochondrial stability disorder is manifested by an increase in the number of mitochondria, a decrease in the area of ​​mitochondria, a decrease in the aspect ratio of mitochondria and / or an increase in abnormal mitochondria.

6. Use of a substance that inhibits the activity and / or expression of MAVS protein or MAVS interacting protein in the preparation of a premature aging mouse model; the premature aging mouse model has at least one of the following phenotypes A1) to A17): A1) increased proportion of SA-β-gal positive cells; A2) shortened telomere length; A3) decreased proportion of Ki67 positive cells; A4) decreased proportion of cells in S phase; A5) weakened monoclonal formation ability; A6) increased degree of DNA damage; A7) increased ROS production; A8) enlarged cell nucleus; A9) increased mitochondrial mass; A10) increased mtDNA copy number; A11) decreased mitochondrial membrane potential; A12) increased mtROS; A13) decreased oxidative respiration rate; A14) increased number of mitochondria; A15) decreased mitochondrial area; A16) decreased mitochondrial aspect ratio; A17) increased abnormal mitochondria.

7. The use according to any one of claims 4 to 6, characterized in that: The MAVS interacting protein is OPA1 protein.

8. The use according to any one of claims 4 to 6, characterized in that: The substance that inhibits the activity and / or expression of MAVS protein or MAVS interacting protein is gRNA; the nucleotide sequence of the gRNA that inhibits the activity and / or expression of MAVS protein is shown in SEQ ID NO: 3; the nucleotide sequence of the gRNA that inhibits the activity and / or expression of MAVS interacting protein is shown in SEQ ID NO:

4.

9. A substance that inhibits the activity and / or expression of MAVS protein or MAVS interacting protein according to any one of claims 6 to 8.

10. A pluripotent stem cell model lacking MAVS protein, which is hESC, hMSC or hNSC lacking MAVS protein; The pluripotent stem cell model is obtained by editing the MAVS gene using the CRISPR / Cas9 gene editing system; the nucleotide sequence of the gRNA in the CRISPR / Cas9 gene editing system is shown in SEQ ID NO:3.

Images