Application of RNF13 in preparation of medicine for preventing or treating cerebral apoplexy

Abstract

The invention discloses an application of RNF13 in preparation of a medicine for preventing or treating cerebral apoplexy, the expressed RNF13 has the effects of reducing infarct volume, protecting neurological functions, inhibiting neuroinflammation, reducing the number of dead nerve cells and inhibiting cerebral apoplexy diseases, and the RNF13 is used for preparing the medicine for preventing, relieving and / or treating the cerebral apoplexy diseases.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and specifically to the application of RNF13 in preparing drugs for preventing or treating stroke. Background Art

[0002] Stroke, also known as cerebrovascular accident, is a local brain dysfunction caused by acute cerebrovascular disease. Its clinical symptoms last for more than 24 hours and are more common in people aged 50 and above. The clinical manifestations are symptoms and signs of transient or permanent brain dysfunction. Among them, ischemic stroke is the most common type of stroke. It is mainly due to cerebral blood circulation disorders, ischemia, and hypoxia, which cause ischemic necrosis or softening of localized brain tissue, and corresponding neurological deficits. The incidence and disability / mortality of ischemic stroke in my country continue to be higher than the global average and the level of developed countries such as the United Kingdom and the United States, which has brought a great burden to the social economy and people's health. It is a social problem and medical problem that needs to be solved urgently. At present, the treatment for ischemic stroke mainly includes intravenous thrombolysis, arterial thrombolysis or interventional thrombectomy, and early vascular recanalization is used to save the ischemic penumbra neurons. Although reperfusion therapy is the most effective treatment for ischemic stroke, some patients still cannot achieve the desired effect after treatment. Ischemia-reperfusion injury is a recognized important pathological mechanism for poor prognosis. 5 Therefore, it is extremely urgent to clarify the mechanism of neuronal death in cerebral ischemia reperfusion injury (CIRI) and to find new therapeutic targets for CIRI in order to develop new and effective therapeutic drugs.

[0003] Ring finger protein 13 (RNF13) was first identified by Tranque et al. in 1996 when they studied the changes in gene expression in chicken embryo brain after treatment with tenascin-C. Studies have shown that it is an E3 ubiquitin ligase, composed of an N-terminal protease-related domain, a transmembrane domain, and a C-terminal ring finger functional domain. It is mainly located in the membrane structure of organelles, such as late endosomes, lysosomes, and endoplasmic reticulum, and is highly expressed in the brain, cerebellum, spinal cord, and testis. RNF13 is widely involved in multiple biological processes such as endoplasmic reticulum stress, protein stability, cell proliferation and migration, post-translational modification, and signal transduction. It is significantly associated with the occurrence and development of diseases such as pancreatic cancer, colorectal cancer, non-alcoholic fatty liver disease, and myocardial hypertrophy. In terms of nervous system-related diseases, RNF13 has been found to promote the progression of Parkinson's disease, but there is no report on its regulatory function in stroke. Summary of the invention

[0004] The purpose of the present invention is to provide the use of RNF13 in the preparation of drugs for preventing or treating stroke, thereby providing a new option for the prevention, relief or treatment of stroke diseases.

[0005] In view of this, the scheme of the present invention is:

[0006] The first aspect of the present invention is to propose the use of RNF13 or a RNF13 expression promoter in the preparation of a drug for preventing or treating stroke.

[0007] The second aspect of the present invention is to propose the use of RNF13 or a promoter of RNF13 expression in the preparation of a drug for preventing or treating neuronal damage.

[0008] Furthermore, the drug described in the first aspect or the second aspect above includes at least one of the following uses:

[0009] a) inhibit neuroinflammation;

[0010] b) Reduce the number of dead nerve cells;

[0011] c) reduce infarct volume;

[0012] d) Protect nerve function.

[0013] Furthermore, the RNF13 expression promoter includes an RNF13 agonist, and any virus, plasmid, or small molecule compound that can promote RNF13 expression.

[0014] Preferably, the viral vector that promotes the expression of RNF13 includes an adeno-associated viral vector, a lentiviral vector, an adenoviral vector and a retroviral vector.

[0015] Preferably, the RNF13 expression promoter is an RNF13 overexpression adenovirus vector, and the construction process uses primers containing nucleotide sequences as shown in SEQ ID NO: 7-8.

[0016] Preferably, the adenovirus vector is pENTR-U6-CMV-ATG-flag-T2A-EGFP adenovirus.

[0017] Preferably, when the RNF13 expression promoter is a viral vector, it can be administered by injection.

[0018] Furthermore, the medicine also includes at least one of thrombolytic drugs, antiplatelet aggregation drugs, anticoagulant drugs, fiber-reducing drugs, and neuroprotective agents for combined use.

[0019] Furthermore, the medicine also includes pharmaceutically acceptable excipients.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The present invention proposes a new function of RNF13, which has the functions of reducing infarct volume, protecting nerve function, inhibiting neuroinflammation, and reducing the number of dead nerve cells. On the one hand, it can be used as a drug for preventing or treating neuronal damage; on the other hand, it has the function of inhibiting the occurrence of stroke and is used to prepare a drug for preventing, alleviating and / or treating stroke. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a graph showing the evaluation results of the severity of brain damage in wild-type mice and RNF13 knockout mice after sham surgery or transient occlusion of the middle cerebral artery in Example 1.

[0023] Figure 2 This is a graph showing the results of detecting the neuroinflammatory response of wild-type mice and RNF13 knockout mice after transient occlusion of the middle cerebral artery in Example 2.

[0024] Figure 3 This is a graph showing the results of apoptosis detection in wild-type mice and RNF13 knockout mice after transient middle cerebral artery embolization modeling in Example 2.

[0025] Figure 4 These are the results of cell damage detection of rat primary neurons infected with RNF13 knockdown adenovirus or control virus in Example 3 after oxygen-glucose deprivation / re-stimulation.

[0026] Figure 5 These are the test results of the inflammatory response of rat primary neurons infected with RNF13 knockdown adenovirus or control virus after oxygen-glucose deprivation / re-stimulation in Example 3.

[0027] Figure 6 These are the results of apoptosis detection of primary neurons of rats infected with RNF13 knockdown adenovirus or control virus after oxygen-glucose deprivation / re-stimulation in Example 3.

[0028] Figure 7 These are the results of cell damage detection of rat primary neurons infected with RNF13 overexpressing adenovirus or control virus in Example 4 after oxygen-glucose deprivation / re-stimulation.

[0029] Figure 8 These are the test results of the inflammatory response of rat primary neurons infected with RNF13 overexpressing adenovirus or control virus in Example 4 after oxygen-glucose deprivation / re-stimulation.

[0030] Fig. 9 This is the result of detecting apoptosis of primary neurons of rats infected with RNF13 overexpressing adenovirus or control virus after oxygen-glucose deprivation / re-stimulation in Example 4. DETAILED DESCRIPTION

[0031] The technical solution of the present invention will be clearly and completely described below in conjunction with the preferred embodiments. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] In order to make the experimental methods, technical solutions and advantages and disadvantages in the embodiments of the present invention clearer, the specific experimental steps in the embodiments of the present invention are described in detail and completely below. If the manufacturer of the reagent or instrument is not indicated in the embodiments, conventional products can be purchased from the market. If the specific conditions are not indicated, they can be carried out according to conventional conditions or conditions recommended by the manufacturer.

[0033] In one embodiment, a transient occlusion model of the middle cerebral artery (t / MCAO) was established using RNF13 knockout mice as experimental subjects. By studying the relationship between the RNF13 gene and stroke, the results showed that compared with wild-type mice (control group), the volume of cerebral infarction and edema in mice after RNF13 knockout was significantly increased, neurological function was significantly deteriorated, the inflammatory response of brain tissue was significantly enhanced, and the number of dead neurons increased. Furthermore, primary neurons of rats were infected with RNF13 knockdown or overexpression adenovirus, and then an in vitro cell model was established by oxygen-glucose deprivation / recovery (OGD / R) treatment. It was found that RNF13 deficiency can promote neuronal damage, inflammatory response and cell apoptosis caused by OGD / R stimulation; while RNF13 overexpression inhibits these processes.

[0034] These results show that in the stroke model caused by transient embolism of the middle cerebral artery, RNF13 has the effects of reducing infarct volume, protecting nerve function, inhibiting neuroinflammation, reducing the number of dead nerve cells, and inhibiting the occurrence of stroke. RNF13 has the function of protecting nerve function, especially the RNF13 gene can inhibit the occurrence of stroke. In view of the function of RNF13 in inhibiting the occurrence of stroke, RNF13 can be used in the preparation of drugs for preventing, alleviating and / or treating stroke, providing a theoretical basis and clinical foundation for studying new targets and new strategies for preventing, alleviating and / or treating stroke.

[0035] (1) Construction of RNF13 knockout mice

[0036] CRISPR-Cas9 technology was used to construct a systemic RNF13 knockout mouse (RNF13-KO). First, the guide sequence of mouse RNF13 was predicted using the online CRISPR design tool (http: / / crispr.mit.edu) and two single-stranded oligos were designed:

[0037] oligo1:TAGGGGATGCTCATGCTGTCCGCCACAC (SEQ ID NO: 1)

[0038] oligo2:AAACGTGTGGCGGACAGCATGAGCATCC (SEQ ID NO: 2)

[0039] The synthesized oligo1 and oligo2 were annealed to form double-stranded DNA, and the double-stranded DNA was connected to pUC57-sgRNA (Addgene, 51132) digested with BsaI to obtain the sgRNA expression vector.

[0040] Using the above-constructed expression vector as a template, the following primers were used to amplify the DNA fragment containing the T7 promoter and guide sequence by PCR:

[0041] Forward primer: GATCCCTAATACGACTCACTATAG (SEQ ID NO: 3)

[0042] Reverse primer: AAAAAAAGCACCGACTCGGT (SEQ ID NO: 4)

[0043] The amplified PCR product was used as a template for in vitro transcription using the MEGAshortscript Kit (Ambion, AM1354); the Cas9 expression plasmid (pST1374-Cas9, Addgene, 44758) was transcribed using the T7 Ultra kit (Ambion, Am1345). The transcribed Cas9 and sgRNA mRNAs were purified using the miRNeasy Micro Kit (Qiaen, 217084) and injected into the single-cell fertilized eggs of wild-type C57BL / 6j mice using the FemtoJet 5247 microinjection system. The fertilized eggs that survived the microinjection were selected and transplanted into the oviducts of healthy female mice. After 21 days of gestation, the mice obtained had genomic DNA extracted from the toe tissue of the mice 2 weeks after birth for RT-PCR identification. The identification primers were:

[0044] Forward primer: 5'-GAAAGGTCCGGTGATTTGAA-3' (SEQ ID NO: 5)

[0045] Reverse primer: 5'-GCATTAGGGGACGTTTTCAG-3' (SEQ ID NO: 6)

[0046] Mice with a deletion in the exon region of the RNF13 gene that is not a multiple of 3 were determined to be positive F0 generation mice. These mice were used to continue breeding with wild-type mice, and eventually homozygous mutant mice with a deletion in the exon region of the RNF13 gene that is not a multiple of 3 were obtained.

[0047] (2) Establishment of transient middle cerebral artery occlusion (t / MCAO) model in mice

[0048] Male RNF13-KO mice aged 10-12 weeks and weighing 26-28 g and their littermates (WT, C57BL / 6 background) were selected for the experiment. All mice were raised in the SPF Animal Experiment Center of Wuhan University. The breeding conditions were as follows: room temperature 22-24°C, humidity 40-70%, 12h light-dark alternation, free access to water and food.

[0049] Modeling process:

[0050] ① Use 2.0% isoflurane and oxygen / nitrous oxide mixed gas to anesthetize the mouse, disinfect with 75% medical alcohol, remove the hair on the neck and left top of the skull, make a longitudinal incision on the top of the skull to expose the skull, and peel off the connective tissue on the surface of the skull. Fix the fiber optic probe of the laser Doppler blood flowmeter with biological glue at a position 1.5mm behind the anterior fontanelle and 3-4mm away from the middle suture of the skull;

[0051] ②Fix the mouse in the supine position, pass the optical fiber through the groove of the mouse plate and connect it to the laser Doppler blood flow meter to record the initial cerebral blood perfusion volume, insert the rectal temperature probe and maintain the body temperature at 37±0.5℃.

[0052] ③ Make a midline incision in the neck to expose the right common carotid artery, internal carotid artery and external carotid artery. Use 8-0 silk thread to ligate the distal end of the external carotid artery, insert another 8-0 silk thread into the external carotid artery, and tie a slipknot near the bifurcation of the common carotid artery. Use an artery clamp to clamp the internal carotid artery and common carotid artery respectively. Cut a small opening 1mm below the ligature of the external carotid artery and insert a No. 602156 silicone thread plug into the small opening.

[0053] ④ Loosen the internal carotid artery clamp, cut the external carotid artery at the small opening, withdraw the suture, reverse it to enter the internal carotid artery, and insert it inward into the Willis circle-middle cerebral artery segment. The insertion depth of the suture is about 9±1mm from the bifurcation of the common carotid artery, and slightly tighten the slipknot. At this time, the blood flow detected by the laser Doppler blood flowmeter drops by more than 75%.

[0054] ⑤ After 45 minutes of ischemia, the suture was removed, the proximal end of the external artery was ligated, and the artery clamp was released. The cerebral blood flow reperfusion was observed, and it returned to a stable level after 10 minutes. The blood flow detected by the laser Doppler blood flowmeter recovered to more than 70%. The wound was sutured, and the rats were fed routinely for 24 hours before subsequent testing and sampling. The sham group did not undergo blood flow occlusion, and other operations were the same.

[0055] (3) Neurological function scores of mice

[0056] The neurological function of mice in each group was scored based on the modified Berderson scoring method (9-point system) 24 hours after reperfusion. The scoring criteria are as follows:

[0057] 0 points: no symptoms of nerve damage;

[0058] 1 point: when the tail is lifted, the contralateral forelimb is curled up, or the affected forelimb cannot be fully reached;

[0059] 2 points: The opposite shoulder is adducted when the tail is lifted;

[0060] 3 points: Horizontal push: resistance decreases when pushing to the opposite side;

[0061] 4 points: Can move spontaneously in all directions, but only turns to the opposite side when the tail is off;

[0062] 5 points: Spinning in circles or only turning in the opposite direction during spontaneous movement;

[0063] 6 points: no voluntary movement, movement only when stimulated;

[0064] 7 points: no voluntary movement, no movement even when stimulated;

[0065] 8 points: Death related to cerebral ischemia.

[0066] (4) TTC staining and statistics of infarct volume percentage and edema volume percentage

[0067] After neurological function scoring, mice were anesthetized with 3% sodium pentobarbital and killed. The heart was cut to bleed, the skin of the back neck was cut to expose the head and neck, the cervical cord was cut from the cervical vertebrae, the skull outside the brainstem and cerebellum was cut longitudinally with ophthalmic scissors, and the skull was peeled open with toothed forceps to separate the dura mater on the surface of the brain to avoid scratching the brain tissue with the dura mater. The removed brain tissue was placed in a -20℃ refrigerator for 30 minutes, and then cut into 1mm thick continuous slices (generally 7 slices, 4 slices in front of the anterior fontanelle, and 3 slices in the back), and the slices were immediately placed in 10ml 2% TTC solution and incubated at 37℃ for 10 minutes. The brain slices were turned over from time to time during the process to ensure uniform staining of the tissue. Normal brain tissue was bright red after staining, while the infarct area was pale. After staining, the brain tissue was fixed with 4% neutral paraformaldehyde, and then gross photos were taken.

[0068] Image-Pro Plus (version 6.0) software was used to calculate the infarct volume and edema volume. The specific calculation formula was: infarct volume percentage = 100*(contralateral brain volume - ipsilateral non-infarcted brain volume) / (contralateral brain volume*2), edema volume percentage = 100*(ipsilateral brain volume - contralateral brain volume) / contralateral brain volume.

[0069] (5) Pathological analysis

[0070] After neurological function scoring, mice were anesthetized with 3% sodium pentobarbital and perfused from the left ventricle with 4°C PBS buffer until clear perfusate flowed out of the right atrial appendage. Then, 4% paraformaldehyde solution was used for perfusion for 8 minutes to fix the vascular intima surface. After completion, the brain tissue was removed and fixed with 4% paraformaldehyde solution for 6-8 hours at room temperature. After that, the sample was placed on a shaker and rinsed 3 times with 4°C 0.01M PBS buffer for 5 minutes each time. The olfactory bulb and cerebellum were removed from the brain tissue, the cerebrum was retained, and then the tissue was cut into two halves along the coronal plane. It was placed in 40ml 20% (W / V) sucrose solution and refrigerated to precipitate completely, and then changed to 40ml 30% (W / V) sucrose solution and refrigerated to precipitate completely. The solution on the surface of the tissue was wiped dry and placed in an embedding frame with 2 drops of OCT added in advance. After ensuring that there were no bubbles, OCT was continued to be added until the tissue was completely immersed, and the position of the tissue was adjusted so that it was located in the center of the embedding frame. Move the embedding frame into dry ice and keep it as horizontal as possible. After OCT solidifies, store it in a -80℃ refrigerator.

[0071] Immunofluorescence staining of F4 / 80 and CD11B: OCT-embedded brain tissue was cut into 5 μM thick frozen sections using a cryostat and incubated with F4 / 80 antibody (Serotec, MCA497) or CD11B antibody (Boster, BM3925) at 4°C overnight. After washing with PBS, the sections were incubated with secondary antibodies (Alexa Fluor 555Conjugate Anti-rat IgG (H+L) (CST, 4417)) was incubated at room temperature for 1 hour. DAPI (Southern Biotech, 0100-20) was used to stain the cell nucleus. Images were observed and photographed under a fluorescence microscope (OLYMPUS, BX51), and the positive cell counts were analyzed using Image Pro Plus software.

[0072] TUNEL (Terminal deoxynucleotidyl transferase-mediated dUTP nickel end labeling) and NeuN immunofluorescence double staining: Frozen sections were incubated with NeuN antibody (Proteintech, 26975-1-AP) at 4°C overnight. After PBS washing, sections were incubated with secondary antibody (Alexa Fluor 568goat anti-Rabbit IgG (H+L) (Invitrogen, A11036)) was incubated at room temperature for 1 h. Then, the TUNEL staining kit (Roche, 11684817910) was used for staining according to the steps in the instruction manual. DAPI was used to stain the cell nucleus, and the images were observed and photographed under a fluorescence microscope (OLYMPUS, BX51), and the positive cell count was analyzed using Image Pro Plus software.

[0073] p-p65 immunohistochemical staining: Frozen sections were incubated with anti-p-p65 antibody (CST, 3033) at 4°C overnight. After washing with PBS, the sections were stained using the Rabbit Enhanced Polymer Detection System (ZSGB-BIO, PV-9001) according to the instructions. DAB (ZSBB-BIO, ZLI-9018) was used for color development, and hematoxylin (Servicebio, G1004) was used for staining cell nuclei. Images were observed and taken under a bright field microscope (Nikon, ECLIPSE 80i).

[0074] (6) Isolation and culture of primary neurons from neonatal rats

[0075] The cerebral cortex was collected from Sprague-Dawley rats 1-2 days after birth, cut into pieces, and placed in 2 ml of 0.125% trypsin (GIBCO, 27250018) and incubated in a 37°C water bath for 15 min to obtain cortical cells. The digestion reaction was then terminated with DMEM-F12 (BioLight, BLCK115) culture medium containing 10% fetal bovine serum (Newzeru, FBS-CS500) and DNase (Roche, 10104159001). A 40 μm cell sieve (Corning, 352340) was used to remove clumped cells or incompletely digested tissue blocks. The cells were collected by centrifugation at 1500 rpm for 5 min at 4°C, and then resuspended in DMEM-F12 culture medium containing 10% fetal bovine serum and 1% penicillin / streptomycin double antibody (Biosharp, BL505A). After counting, the cells were plated on poly-lysine (10 mg / ml, Sigma) coated plates and incubated at 37°C and 5% CO 2After 3 hours of culture, observe the cell state under a microscope. If the cells begin to grow synapses and take on a tadpole shape, the medium can be changed, the old medium can be discarded, and Neurobasal (GIBCO, 10888022) medium containing 1% L-Glutamine (Beyotine, ST083), 1% double antibody and 2% B27 (GIBCO, 17504044) can be added to continue culturing in the dark. The medium is changed every 48 hours, and subsequent experiments are performed after 7 days of cell culture.

[0076] (7) Construction and infection of RNF13 knockdown and overexpression adenovirus

[0077] ①Construct AdRNF13 adenovirus overexpression plasmid. Use AdGFP (adenovirus containing GFP (green fluorescent protein)) as control:

[0078] The CDS sequence of RNF13 was amplified using the rat RNF13 gene cDNA sequence as a template. The primers used were:

[0079]

[0080]

[0081] It was connected to the pENTR-U6-CMV-ATG-flag-T2A-EGFP adenovirus entry vector (donated by Li Hongliang's laboratory, Wuhan University) linearized with BamHI-HF (NEB, R3136V) and SpeI-HF (NEB, R3133V) using a recombinase (Vazyme, C112-02) to obtain the RNF13 overexpression entry plasmid.

[0082] ②Construct AdshRNF13 adenovirus knockdown plasmid, and AdshRNA (adenovirus containing shRNA (silencing RNA)) as a control:

[0083] Design and synthesize oligo annealing primers targeting rat RNF13 gene, the sequence is:

[0084]

[0085] After the Oligo primer was annealed, it was ligated into the pENTR-U6-CMV-ATG-flag-T2A-EGFP adenovirus entry vector linearized with AgeI-HF (NEB, R3552S) and EcoRI-HF (NEB, R3101V) under the action of ligase (TOYOBO, LGK-101) to obtain the RNF13 knockdown entry plasmid.

[0086] ③The above RNF13 overexpression and knockdown entry plasmids were respectively transferred into E. coli T1 competent cells (full gold, CD501-03) for amplification. The correctly sequenced overexpression entry plasmid and knockdown entry plasmid were recombined with adenovirus recombinant plasmid pAd / PL-DEST TM (ThermoFisher, V49420) was used for Gateway site-specific recombination (GateWay@LR Clonase TMIIEnzyme Mix, ThermoFisher, 2484478) to obtain pAd-CMV-RNF13-flag-T2A-EGFP (overexpression) and pAd-U6-RNF13shRNA-CMV-EGFP (knockdown) plasmids.

[0087] ④ The plasmid obtained above was linearized by PacI and then transfected into HEK293A cells using PEI transfection reagent (Polysciences, 24765-100). Adenovirus was obtained using Adeasy adenovirus packaging system (240009, Agilent Technologies). The titer of recombinant adenovirus was 10 10 pfu / ml.

[0088] ⑤ The cultured primary neuronal cells were infected with adenovirus at an infection multiplicity of 100 for 12 hours, and then the cells were collected for Western blot identification.

[0089] (8) Neuronal oxygen glucose deprivation / recovery (OGD / R) stimulation and cell viability detection

[0090] OGD / R stimulation: The original medium was replaced with DMEM-F12 medium without serum, glucose, or sodium pyruvate. 2 and 5% CO 2 The cells were cultured in an incubator containing 95% air and 5% CO for 3 h to perform hypoxia treatment. After completion, the normal culture medium was replaced and the cells were cultured in an incubator containing 95% air and 5% CO. 2 incubator for 6 h.

[0091] Cell viability detection: Neurons were inoculated in a 96-well plate (Thermo, 167008), and 3 blank wells were set up (no cells were inoculated, only the same volume of culture medium was added). After viral infection and OGD / R stimulation, CCK8 detection reagent was added using the CCK8 detection kit (Dojindo, 44786) according to the instructions and incubated at 37°C for 2h, and then the absorbance of each group was detected at 450nm.

[0092] (9) Molecular biology detection

[0093] Western blot detection: Brain tissue in the infarct area was added with an appropriate amount of RIPA lysis buffer containing protease inhibitors (Roche, 04693132001) and phosphatase inhibitors (Roche, 4906837001), ultrasonically broken, centrifuged, and the supernatant was taken to obtain total protein. Neurons were lysed with SDS lysis buffer (50mM Tris-HCl pH 6.8, 2% SDS, 10% glycerol) and incubated at 95°C for 15min, then centrifuged and the supernatant was taken to obtain total protein. The protein concentration was determined using the BCA protein detection kit (Thermo, 23225). The same mass of protein samples were added to the loading buffer and separated by 10% SDS-PAGE electrophoresis. After electrophoresis, the protein was transferred to a 0.45μm PVDF (Millipore, IPVH00010) membrane. After the transfer was completed, the PVDF membrane was blocked with 5% skim milk powder at room temperature for about 1h. The PVDF membrane was washed with TBST for 3 times, 5 min each time, and then the primary antibody was added and incubated at 4°C overnight. After washing with TBST, the secondary antibody of the corresponding species (Jackson ImmunoResearch) was added and incubated at room temperature for 1 h. The ECL luminescent substrate (Bio-Rad, 1705062) was used for color development, and the signal was collected by Bio-Rad Gel Imaging System (ChemiDoc XRS+).

[0094] The information of primary antibodies used is shown in the table below:

[0095]

[0096]

[0097] RT-PCR detection: Trizol (Sigma, T9424) was used to extract total RNA from tissues and cells. The obtained RNA was reverse transcribed using a reverse transcription kit (Vazyme, R323-01) to obtain cDNA. The target gene primers were designed, and RT-PCR was performed using ChamQ SYBR Master Mix (Vazyme, Q311-03) and LightCycler 480qPCR system (Roche Holding AG) with cDNA as the template. β-actin was used as the internal reference to analyze the relative expression of each gene mRNA.

[0098] The gene primer sequences used are shown in the table below:

[0099]

[0100]

[0101] Example 1 Effect of RNF13 knockout on stroke in mice

[0102] RNF13-KO mice and WT mice were divided into 4 groups: WT Sham group, KO Sham group, WT t / MCAO group, and KO t / MCAO group. The Sham group underwent sham surgery, and the t / MCAO group underwent t / MCAO surgery. Neurological function scores and TTC staining were performed 24 hours later.

[0103] Figure 1 A shows the Western blot results of RNF13 expression in brain tissues of WT and KO mice. No RNF13 expression was detected in the brain tissues of the KO group, indicating that RNF13 expression was absent in the KO group.

[0104] Figure 1 B is the result of the neurological function score of mice, which shows that compared with the WT t / MCAO group, the scores of mice in the KO t / MCAO group were significantly increased, indicating that the animals had more severe behavioral disorders and more severe neurological dysfunction.

[0105] Figure 1 CE are the TTC staining results of brain tissue of animals in each group and the statistical graphs of the infarct volume and edema volume ratio. C shows that there was no obvious brain tissue damage in the Sham group mice, while obvious pale areas were observed in the t / MCAO group, and the pale areas in the KO t / MCAO group were larger, indicating that the damage was more serious; D and E showed that compared with the WT t / MCAO group, the infarct and edema volumes of the KO t / MCAO group mice were significantly increased (** indicates p < 0.01 compared with the WT t / MCAO group), indicating that RNF13 knockout aggravated brain tissue necrosis caused by cerebral ischemia-reperfusion.

[0106] Example 2 Effects of RNF13 knockout on inflammatory response and neuronal apoptosis during stroke in mice

[0107] RNF13-KO mice and WT mice were divided into 2 groups: WT t / MCAO group and KO t / MCAO group. T / MCAO surgery was performed and the samples were harvested 24 hours later for pathological analysis and molecular biological detection.

[0108] Figure 2 A shows the results of immunofluorescence staining of F4 / 80 and CD11B in mouse brain tissue and the number of positive cells. Compared with the WTt / MCAO group, the number of F4 / 80 and CD11B positive cells in the KO t / MCAO group was greater, indicating that RNF13 deficiency can promote inflammatory cell infiltration during stroke. Figure 2 B is the result of p-p65 immunohistochemical staining of mouse brain tissue. Compared with the WT t / MCAO group, the p-p65 positive signal in the KOt / MCAO group was stronger; Figure 2C is the Western blot detection result of the expression of NF-κB signaling pathway related proteins (p-Ikkβ, Ikkβ, IkBα, p-p65, p65) in mouse brain tissue. The expression of p-Ikkβ and p-p65 in the KO t / MCAO group was significantly stronger than that in the WT t / MCAO group, while the expression of IkBα was weaker than that in the WT t / MCAO group. These results indicate that RNF13 deficiency can promote the activation of the NF-κB signaling pathway in the process of stroke. Figure 2 D is the RT-PCR test results of the expression of inflammatory factors Tnf, Il6, Il1b and chemokines Ccl2, Ccl5, and Cxcl10 in mouse brain tissue (** indicates p < 0.01 compared with the WT t / MCAO group). It can be seen that the expression of these cytokines in the KOt / MCAO group was significantly higher than that in the WT t / MCAO group. These results indicate that RNF13 deficiency significantly promotes the inflammatory response during stroke.

[0109] Figure 3 A is the results of NeuN and TUNEL immunofluorescence double staining and the number of positive cells in mouse brain tissue. Compared with the WT t / MCAO group, the number of NeuN and TUNEL double-positive cells in the KO t / MCAO group was greater, indicating that RNF13 deficiency can promote neuronal apoptosis during stroke; Figure 3 B and C are the results of Western blot and RT-PCR detection of apoptosis-related molecules in mouse brain tissue (** indicates p < 0.01 compared with the WT t / MCAO group). The expression of pro-apoptosis-related molecules Bad, Bax, C-Caspase3, and Fas in the KO t / MCAO group was significantly higher than that in the WT t / MCAO group, while the expression of anti-apoptosis molecules Bcl2 and Bcl-xl was significantly lower than that in the WT t / MCAO group. These results indicate that RNF13 deficiency significantly promotes cell apoptosis during stroke.

[0110] Example 3 Effects of RNF13 knockdown on OGD / R-stimulated primary neuronal injury, inflammatory response and apoptosis

[0111] Neurons infected with RNF13 knockdown adenovirus (AdshRNF3) and control adenovirus (AdshRNA) were stimulated with OGD / R, and then the cells were collected for cell viability, Western blot, and RT-PCR assays.

[0112] Figure 4 A is the Western blot test result of RNF13 protein expression. The expression of RNF13 in the AdshRNF3 group was significantly lower than that in the AdshRNA group, indicating that adenovirus infection was successful and the expression of RNF13 in the AdshRNF3 group was knocked down. Figure 4B is the result of cell viability detection. The cell viability of the AdshRNF3 OGD / R group was significantly lower than that of the AdshRNA OGD / R group (** indicates p < 0.01 compared with the AdshRNA OGD / R group), indicating that RNF13 knockdown significantly promoted cell damage caused by OGD / R stimulation.

[0113] Figure 5 A is the detection result of mRNA expression level of cytokines (Tnf, Il6, Il1b and Ccl2). The expression of these cytokines in AdshRNF3OGD / R group was significantly higher than that in AdshRNA OGD / R group; Figure 5 B is the expression detection and protein quantification results of NF-κB signaling pathway related proteins (** indicates p < 0.01 compared with AdshRNA OGD / R group). The activation of NF-κB signaling pathway in AdshRNF3 OGD / R group was significantly stronger than that in AdshRNA OGD / R group. These results indicate that RNF13 knockdown significantly promotes the neuronal inflammatory response caused by OGD / R stimulation.

[0114] Figure 6 The results of mRNA (A) and protein (B) expression levels of apoptosis-related molecules (** indicates p < 0.01 compared with AdshRNA OGD / R group). The expression of pro-apoptosis-related molecules in AdshRNF3 OGD / R group was significantly stronger than that in AdshRNA OGD / R group, while the expression of anti-apoptosis-related molecules was significantly lower than that in AdshRNA OGD / R group. This indicates that RNF13 knockdown significantly promotes neuronal apoptosis caused by OGD / R stimulation.

[0115] Example 4 Effects of RNF13 overexpression on primary neuronal injury, inflammatory response and apoptosis stimulated by OGD / R

[0116] Neurons infected with RNF13 overexpressing adenovirus (AdRNF3) and control adenovirus (AdGFP) were subjected to OGD / R stimulation, and then the cells were collected for cell viability, Western blot, and RT-PCR detection.

[0117] Figure 7 A is the Western blot test result of RNF13 protein expression. Obvious RNF13 overexpression signal was detected in the AdRNF3 group, indicating that adenovirus infection was successful and the expression of RNF13 in the AdRNF3 group was significantly enhanced. Figure 7 B is the result of cell viability detection (** indicates p < 0.01 compared with the AdGFP OGD / R group). The cell viability in the AdRNF3 OGD / R group was significantly higher than that in the AdGFP OGD / R group, indicating that RNF13 overexpression significantly inhibited the cell damage caused by OGD / R stimulation.

[0118] Figure 8A is the detection result of mRNA expression level of cytokines (Tnf, Il6, Il1b and Ccl2). The expression of these cytokines in AdRNF3 OGD / R group was significantly lower than that in AdGFP OGD / R group. Figure 8 B is the expression detection and protein quantification results of NF-κB signaling pathway related proteins (** indicates p < 0.01 compared with AdGFP OGD / R group). The activation of NF-κB signaling pathway in AdRNF3 OGD / R group was significantly weaker than that in AdGFP OGD / R group. These results indicate that RNF13 overexpression significantly inhibits the neuronal inflammatory response caused by OGD / R stimulation.

[0119] Fig. 9 9A is the mRNA expression level detection result of apoptosis-related molecules. Fig. 9 B is the result of apoptosis-related protein expression detection and protein quantification (** indicates p < 0.01 compared with AdGFP OGD / R group). The expression of pro-apoptosis-related molecules in AdRNF3 OGD / R group was significantly weaker than that in AdGFPOGD / R group, while the expression of anti-apoptosis-related molecules was significantly stronger than that in AdshRNA OGD / R group. This indicates that RNF13 overexpression significantly inhibits neuronal apoptosis caused by OGD / R stimulation.

[0120] The results showed that in stroke caused by middle cerebral artery embolism, the infarct volume of mice after RNF13 knockout increased significantly, neurological function deteriorated significantly, inflammatory response increased, and the number of apoptotic neurons increased significantly. RNF13 knockdown can promote neuronal damage, inflammatory response, and apoptosis caused by OGD / R stimulation; while RNF13 overexpression inhibits neuronal damage, inflammatory response, and apoptosis caused by OGD / R stimulation. This shows that RNF13 can protect neurological function and improve stroke; RNF13 has an important protective role in stroke disease models and has great potential for the preparation of drugs for the treatment of stroke.

[0121] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. Use of RNF13 or an RNF13 expression promoter in the preparation of drugs for preventing or treating stroke.

2. Use of RNF13 or RNF13 expression promoter in the preparation of drugs for preventing or treating neuronal damage.

3. The use according to claim 2, characterized in that: The neuronal damage is neuronal damage caused by OGD / R stimulation.

4. The use according to claim 1 or 2, characterized in that: The drug includes at least one of the following uses: a) inhibit neuroinflammation; b) Reduce the number of dead nerve cells; c) reduce infarct volume; d) Protect nerve function.

5. The use according to claim 1 or 2, characterized in that: The RNF13 expression promoter includes an RNF13 agonist, and any virus, plasmid, or small molecule compound that can promote the expression of RNF13.

6. The use according to claim 5, characterized in that: The viral vectors that promote the expression of RNF13 include adeno-associated viral vectors, lentiviral vectors, adenoviral vectors and retroviral vectors.

7. The use according to claim 5, characterized in that: The RNF13 expression promoter is an RNF13 overexpression adenovirus vector, and the construction process uses primers containing nucleotide sequences as shown in SEQ ID NO: 7-8.

8. The use according to claim 1 or 2, characterized in that: The drug administration method is injection.

9. The use according to claim 1 or 2, characterized in that: The medicine also includes at least one of thrombolytic drugs, antiplatelet aggregation drugs, anticoagulant drugs, fiber-reducing drugs, and neuroprotective agents.

10. The use according to claim 1 or 2, characterized in that: The drug also includes pharmaceutically acceptable excipients.

Images