A methylotrophic methylophilic bacterium HN238 and its culture method and application

Abstract

The present invention discloses a methylotrophic methylotrophic bacterium HN238, which is classified and named as: methylotrophic methylotrophic bacterium ( Methylophilus methylotrophus ), deposited in the General Microbiology Center of China Microorganism Culture Collection Committee (CGMCC), the deposit time is: January 8, 2024, the deposit number is: CGMCC No.29546, the deposit address is: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing; and the cultivation method and application of the methylotrophic methylotrophic bacteria HN238. The methylotrophic methylotrophic bacteria HN238 of the present invention can survive under alkaline conditions, can be applied to the fermentation culture of high-yield protein, and has the advantages of simple fermentation process, low cost, and achieving the advantages of improving the yield and quality of bacteria while reducing the fermentation production cost.

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, and more specifically to a methylotrophic methylophilic bacterium HN238 and a culture method and application thereof. Background Art

[0002] The increase in human population determines higher protein requirements to sustain feed needs for animals and aquaculture. Single Cell Protein (SCP) consists of mixed proteins from pure and mixed cultures of bacteria, fungi, algae and yeasts, and is an environmentally friendly alternative to animal-derived proteins that are grown and harvested to meet human and animal food needs.

[0003] Methylotrophs are the dominant species producing SCP. Methylotrophs include a subgroup of bacteria that can metabolize single-carbon compounds (methanol, methylamine or other C1 carbon compounds) as the sole source of carbon and energy. They are an important group of bacteria that, in addition to actively participating in the carbon cycle in the soil, also absorb greenhouse gases, which can minimize global warming. However, existing methylotrophs, such as methanotrophs, Methanotrophic bacteria The protein content of the bacteria obtained by fermentation was only 42.1%, and the protein yield needs to be further improved. Summary of the invention

[0004] The purpose of the present invention is to provide a methylotrophic methylophilic bacterium HN238 and a culture method and application thereof, so as to at least solve the above-mentioned problems.

[0005] In order to achieve the purpose and other advantages of the present invention, a methylotrophic methylotrophic bacterium HN238 is provided, which is classified and named as: methylotrophic methylotrophic bacterium ( Methylophilus methylotrophus ), methylotrophic Methylophilus ( Methylophilus methylotrophus ) HN238 was deposited in the General Microbiology Center of China Microorganism Culture Collection (CGMCC) on January 8, 2024. The deposit number is CGMCC No.29546. The address of the depository is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing.

[0006] The present invention also provides a method for culturing the methylotrophic methylotrophic bacteria HN238, comprising adding the methylotrophic methylotrophic bacteria HN238 to a fermentation medium and culturing the culture medium at 10-38° C. and pH 5.0-8.0.

[0007] Preferably, the culture is carried out at 28-37°C and pH 7.0-8.0.

[0008] Preferably, the culture is carried out at 32°C and pH 7.5.

[0009] Preferably, the fermentation medium comprises: 1-40 g / L methanol, 0.1-6 g / L ammonium sulfate, 0.1-4 g / L dipotassium hydrogen phosphate, 0.1-3 g / L sodium dihydrogen phosphate, 0-0.2 g / L zinc sulfate heptahydrate, 0-2 g / L magnesium sulfate heptahydrate, 0-0.1 g / L ferrous sulfate heptahydrate, and 0-0.1 g / L calcium chloride dihydrate.

[0010] Preferably, the fermentation medium comprises: 5-30 g / L methanol, 0.8-4.8 g / L ammonium sulfate, 0.1-3 g / L dipotassium hydrogen phosphate, 0.1-2.5 g / L sodium dihydrogen phosphate, 0.02-0.1 g / L zinc sulfate heptahydrate, 0.1-0.9 g / L magnesium sulfate heptahydrate, 0.005-0.035 g / L ferrous sulfate heptahydrate, and 0.006-0.043 g / L calcium chloride dihydrate.

[0011] Preferably, the fermentation medium includes: the fermentation medium includes: 10 g / L methanol, 1.8 g / L ammonium sulfate, 2.2 g / L dipotassium hydrogen phosphate, 1.8 g / L sodium dihydrogen phosphate, 0.04 g / L zinc sulfate heptahydrate, 0.2 g / L magnesium sulfate heptahydrate, 0.005 g / L ferrous sulfate heptahydrate, and 0.013 g / L calcium chloride dihydrate.

[0012] The present invention also provides an application of the methylotrophic methylophilic bacteria HN238 in producing protein.

[0013] Preferably, the protein is a single cell protein.

[0014] The present invention also provides a bacterial agent for producing protein, which comprises the methylotrophic methylophilic bacteria HN238.

[0015] The present invention has at least the following beneficial effects:

[0016] First, the methylotrophic methylophilic bacteria HN238 screened by the present invention can survive under alkaline conditions of pH 8.0, which greatly reduces the risk of bacterial contamination during the fermentation process and can improve the quality and yield stability of the product.

[0017] Second, the methylotrophic methylotrophic bacteria HN238 screened by the present invention can be applied to the fermentation culture of high-yield protein, and has the advantages of simple fermentation process and low cost, which can reduce the fermentation production cost while improving the yield and quality of the bacteria, laying a foundation for the industrial development and application of microbial fermentation production of protein; when the methylotrophic methylotrophic bacteria HN238 is applied to the fermentation culture of single-cell protein, cheap and easily available methanol and ammonium sulfate can be used as the carbon source and nitrogen source of the culture medium, and after the fermentation is completed, the single-cell protein with high protein content and complete amino acid types can be obtained by simple separation, washing and drying. The final fermentation obtained single-cell protein bacteria has a biomass of 3.05 g / L, a protein content of 58.25%, and a protein yield of 1.78 g / L.

[0018] Other advantages, objectives and features of the present invention will be embodied in part through the following description, and in part will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 A phylogenetic tree constructed based on the 16S rDNA gene sequence of the methylotrophic Methylophilus HN238 of the present invention;

[0020] Figure 2 is a growth curve diagram of the methylotrophic methylophilic bacteria HN238 of the present invention;

[0021] Figure 3 This is the result of optimizing the methanol concentration in the fermentation medium of the present invention;

[0022] Figure 4 It is the result of optimizing the nitrogen source in the fermentation medium of the present invention;

[0023] Figure 5 This is the result of optimizing the concentration of ammonium sulfate in the fermentation medium of the present invention;

[0024] Figure 6 It is the fermentation pH optimization result of the fermentation conditions of the present invention;

[0025] Figure 7 It is the result of optimizing the fermentation temperature in the fermentation conditions of the present invention;

[0026] Figure 8 This is the result of optimizing the concentration of P element in the fermentation medium of the present invention;

[0027] Fig. 9 This is the result of optimizing the Mg element concentration in the fermentation medium of the present invention;

[0028] Fig.10 This is the result of optimizing the Zn element concentration in the fermentation medium of the present invention;

[0029] Fig.11 This is the result of optimizing the Ca element concentration in the fermentation medium of the present invention;

[0030] Fig.12 This is the result of optimizing the Fe element concentration in the fermentation medium according to the present invention.

[0031] Deposit of biological materials:

[0032] Methylotrophic Methylophilus HN238, its classification name is: Methylotrophic Methylophilus ( Methylophilus methylotrophus ), methylotrophic Methylophilus ( Methylophilus methylotrophus ) HN238 was deposited in the General Microbiology Center of China Microorganism Culture Collection (CGMCC) on January 8, 2024, with the deposit number: CGMCC No.29546, and the address of the deposit unit is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. DETAILED DESCRIPTION

[0033] The present invention is further described in detail below in conjunction with embodiments and drawings so that those skilled in the art can implement the invention with reference to the description.

[0034] It should be understood that the terms such as “having”, “including” and “comprising” used herein do not exclude the existence or addition of one or more other elements or combinations thereof.

[0035] It should be noted that the experimental methods described in the following embodiments are conventional methods unless otherwise specified, and the reagents and materials can be obtained from commercial channels unless otherwise specified.

[0036] Example 1: Screening and identification of methylotrophic Methylophilus HN238

[0037] Soil, branches, and chemical plant wastewater were used as bacterial sources, and methanol was used as the sole carbon source for screening. 1 g of the collected samples were weighed and added to the enrichment medium (K2HPO4 1.9 g / L, NaH2PO4 1.56 g / L, MgSO4·7H2O 0.2 g / L, (NH4)2SO4 1.8 g / L, CaCl2·2H2O 0.015 g / L, CH3OH 20 g / L), and cultured for 2 days at 28°C and 180 rpm / min. The samples were then spread on the enrichment medium solid plate. After 2 days of culture in a 28°C incubator, a single colony was picked and inoculated on the enrichment medium solid plate. The single colony plate was streaked and separated and purified several times until a single colony appeared. 35 strains were obtained through enrichment culture, separation and purification, and the growth rate of the 35 strains was observed through fermentation, and 5 strains with faster growth were obtained.

[0038] The five fast-growing strains were inoculated into the fermentation medium and cultured in a shaking incubator at 28°C and 180 rpm / min until the OD 600 =0.33~0.37, and then inoculated with 2% inoculation amount in a 250mL shake flask containing 50mL fermentation medium. After culturing in a shaking incubator at 28℃ and 180rpm / min for 48h, the biomass, protein content and methanol utilization were determined, and the strain with the highest protein yield and methanol utilization was screened out and named HN238. The strain HN238 was stored in glycerol at -80℃ for later use.

[0039] The composition of the fermentation medium is shown in the following table:

[0040]

[0041] Methanol utilization rate (%) = consumed methanol concentration (g / L) / initial methanol concentration in fermentation medium (g / L) × 100

[0042] Consumed methanol concentration (g / L) = initial methanol concentration in fermentation medium (g / L) - remaining methanol concentration in fermentation medium (g / L)

[0043] The methanol concentration was detected by gas chromatography.

[0044] Strain HN238 was spread on a solid plate and cultured at 28°C for 2 days, and its morphological characteristics and colony morphology were observed. The bacteria were slightly curved rods, generally 0.3-0.6μm×0.8-1.5μm, single or in pairs, white and round, with raised edges, translucent to opaque, and belonged to Gram-negative bacteria.

[0045] The DNA of strain HN238 was used as a template and bacterial universal primers were used to amplify the bacterial 16SrDNA sequence. The nucleotide sequence of the upstream primer 27F (5′-3′) is shown in SEQ ID NO: 1, and the nucleotide sequence of the downstream primer 1492R (5′-3′) is shown in SEQ ID NO: 2. The sequencing results were compared with BLAST homology on NCBI, and the phylogenetic tree was constructed using MEGA-X software, as shown in Figure 1 shown.

[0046] SEQ ID NO: 1:

[0047] AGAGTTTGATCCTGGCTCAG

[0048] SEQ ID NO:2:

[0049] GGTTACCTTGTTACGACTT

[0050] After morphological and molecular identification, strain HN238 was named as Methylotrophic Methylophilus ( Methylophilus methylotrophus ), methylotrophic Methylophilus ( Methylophilus methylotrophus ) HN238 was deposited in the General Microbiology Center of China Microorganism Culture Collection (CGMCC) on January 8, 2024, with the deposit number: CGMCC No.29546, and the deposit address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0051] Example 2: Optimization of fermentation conditions of Methylotrophic Methylophilus HN238

[0052] The effects of carbon source, nitrogen source, temperature, pH, inorganic salts and trace elements on the fermentation of Methylotrophic Methylophilus HN238 were studied at the shake flask level. Unless otherwise specified, the basic fermentation conditions were as follows: 250 mL shake flasks containing 50 mL fermentation medium were cultured at 28°C and 180 rpm / min. The seed solution was a single colony picked from a plate and placed on a shaker to culture until OD 600 =0.33~0.37, the inoculation amount is 2%, and the fermentation time is 48h.

[0053] 2.1 Determination of HN238 growth curve

[0054] In order to study the growth of HN238 strain, a growth curve was drawn up, and the absorbance of HN238 strain at a wavelength of 600nm was measured every 4 hours until the absorbance showed a downward trend. Figure 2 As shown, the HN238 strain was in the lag phase in the first 18 hours, and the OD value remained almost unchanged. After 18 hours, the OD value increased exponentially from 0.05 to 0.6, and was in the logarithmic growth phase. At around 30 hours, it entered the stable phase, and after 60 hours, the cells entered the death phase.

[0055] 2.2 Optimization of methanol concentration

[0056] In order to optimize the utilization ability of HN238 strain for different concentrations of methanol, five concentration gradients were selected in this experiment, namely 5 g / L, 10 g / L, 15 g / L, 20 g / L, 25 g / L, and 30 g / L, and the biomass, protein content, and protein yield of the bacteria obtained by fermentation with different nitrogen sources were measured. The results are shown in Figure 2. Figure 3 As shown in the figure, the HN238 strain reached the maximum biomass and protein content at a methanol concentration of 10 g / L. As the methanol concentration increased, the biomass gradually decreased, the protein content had no significant difference, and the protein yield gradually decreased. Therefore, the methanol concentration was preliminarily determined to be 10 g / L.

[0057] 2.3 Optimization of nitrogen source

[0058] Under the above optimized conditions, nitrogen source optimization was performed. This experiment selected four nitrogen sources: urea, ammonium sulfate, ammonium chloride, and sodium nitrate. According to the concentration of nitrogen in the fermentation medium, the nitrogen molar coefficient ratio was unified and added to study their different effects on the HN238 strain. The biomass, protein content, and protein yield of the bacteria obtained by fermentation with different nitrogen sources were measured. The results are as follows: Figure 4 As shown, the HN238 strain has obvious differences in its ability to utilize different species. From the perspective of biomass, when sodium nitrate is used as the nitrogen source, the biomass of the HN238 strain reaches the maximum value, followed by ammonium sulfate as the nitrogen source, and the growth is the worst when urea is used as the nitrogen source. From the perspective of protein content, when ammonium sulfate is used as the nitrogen source, the protein content is the highest, followed by ammonium chloride and sodium nitrate, and the protein content is the lowest when urea is used as the nitrogen source. Overall, according to the results of protein yield, sodium nitrate is the best nitrogen source, but due to economic considerations, this experiment chose ammonium sulfate as the nitrogen source. The concentration of ammonium sulfate was further optimized, and the concentration gradient was selected as 0.8g / L, 1.8g / L, 2.8g / L, 3.8g / L, and 4.8g / L. The biomass and protein content at different ammonium sulfate concentrations were measured. The results are shown in Figure 5 As shown in the figure, the biomass was the highest at a concentration of 1.8 g / L, and then gradually decreased with the continuous increase in concentration. It may be that the excessive concentration of nitrogen source will inhibit the growth of bacteria, but the protein content is proportional to the concentration of ammonium sulfate. In terms of comprehensive protein production, the concentration of 1.8 g / L is the optimal ammonium sulfate concentration.

[0059] 2.4 pH Optimization

[0060] Under the above optimized conditions, pH was optimized, and five gradients of pH 6.0, 6.5, 7.0, 7.5, and 8.0 were selected for optimization. The biomass and protein content under different pH conditions were measured respectively. The results are as follows: Figure 6 As shown in the figure, before the pH is less than 7.5, the biomass and protein content show opposite trends. The biomass increases with the increase of pH, while the protein content gradually decreases with the increase of pH. At pH 7.5, the biomass reaches the maximum value, indicating that HN238 is suitable for growth under alkaline conditions. At pH 8.0, the biomass is significantly lower than that at pH 7.5. Further experiments found that HN238 does not grow at pH 8.5. Considering the results of protein yield, pH 7.5 was selected as the optimal pH in this experiment.

[0061] 2.5 Temperature Optimization

[0062] Under the above optimized conditions, the temperature was optimized. In this experiment, 24℃, 28℃, 32℃, 37℃ and 40℃ were used for temperature optimization. Figure 6As shown in the figure, at 32℃, the biomass was the highest, and at 24℃, 37℃, and 40℃, the HN238 strain hardly grew, but the protein content gradually decreased with the increase of temperature. In summary, according to the protein yield results, the protein yield was the highest at 32℃, so the fermentation temperature was selected at 32℃.

[0063] 2.6 Optimization of inorganic salts

[0064] Inorganic salts directly affect the efficiency of the fermentation process and the quality of the product by regulating the growth environment and metabolic pathways of microorganisms. In this experiment, the concentrations of two inorganic salts containing Mg and P were optimized.

[0065] 2.6.1 Optimization of P element

[0066] The P element is a component of ATP and other nucleic acids, and is crucial to the energy metabolism of microorganisms. ATP is the main substance for intracellular energy transfer and storage. Fermenting microorganisms maintain cellular metabolic activities through ATP synthesis. During the fermentation process, the concentration of the P element is one of the keys to ensure the efficient fermentation process and stable product quality. Under the above optimized conditions, dipotassium hydrogen phosphate and sodium dihydrogen phosphate were used as phosphorus sources, the ratio of dipotassium hydrogen phosphate to sodium dihydrogen phosphate was 1.22:1, and five concentrations of 3g / L, 4g / L, 5g / L, 6g / L, and 7g / L were selected for optimization. The results are as follows Figure 8 As shown, when the concentration is 4g / L and 6g / L, the biomass is higher, at 7g / L the bacteria hardly grow, at 3g / L and 5g / L the biomass is lower, the protein content reaches the highest at 3g / L, and shows a downward trend with the increase of P element concentration. Considering the results of protein yield, the P element concentration was finally determined to be 4g / L.

[0067] 2.6.2 Optimization of Mg element

[0068] Magnesium ions help maintain the stability and integrity of cell membranes and are essential for cell growth and metabolic activity. During the fermentation process, a stable cell membrane helps protect the metabolic mechanism within the cell from the influence of the external environment. It can also affect the acid-base balance within the cell and regulate the pH value of the intracellular environment, thereby affecting the activity of many enzymes and the metabolic process of microorganisms. Different Mg concentrations in the culture medium will lead to different fermentation processes. Under the above optimized conditions, magnesium sulfate heptahydrate was used as the magnesium source, and the Mg concentrations of 0g / L, 0.1g / L, 0.2g / L, 0.3g / L, 0.5g / L, 0.7g / L, and 0.9g / L were selected for optimization. The results are as follows Fig. 9As shown in the figure, with the increase of Mg concentration, the biomass tends to increase, but the protein content gradually decreases. It can be seen that excessive Mg concentration will have a negative impact on bacterial protein. Considering the results of protein yield, the Mg concentration was finally determined to be 0.2g / L.

[0069] 2.7 Optimization of trace elements

[0070] 2.7.1 Optimization of Zn concentration

[0071] Zinc plays an important role in the growth and metabolism of bacteria. Under the above optimized conditions, zinc sulfate heptahydrate was used as the zinc source to optimize the Zn concentration. In this experiment, the Zn concentrations were 0.02 g / L, 0.04 g / L, 0.06 g / L, 0.08 g / L, and 0.1 g / L. The results are as follows: Fig.10 As shown, when the Zn concentration was 0.04 g / L, the biomass and protein content were the highest. On the whole, the Zn concentration of 0.04 g / L was selected in this experiment.

[0072] 2.7.2 Optimization of Ca concentration

[0073] Calcium helps maintain the stability of bacterial cell walls and cell membranes. It can strengthen the structure of the cell wall and help bacteria resist the pressure of the external environment. The right amount of calcium is necessary for the health and reproduction of bacteria, while excess or insufficient calcium will have a negative impact on bacterial growth. Under the above optimized conditions, calcium chloride dihydrate was used as the calcium source to optimize the Ca element concentration. This experiment took the Ca element concentration of 0.006g / L, 0.013g / L, 0.023g / L, 0.033g / L, and 0.043g / L for optimization. The results are as follows: Fig.11 As shown in the figure, when biomass is used as the evaluation index, the biomass gradually increases when the Ca concentration increases from 0.006g / L to 0.023g / L, and the biomass decreases significantly after 0.023g / L. The difference in protein content is not obvious, and the protein content is the highest when the Ca concentration is 0.013g / L. Finally, based on the results of protein yield, the Ca concentration was determined to be 0.013g / L.

[0074] 2.7.3 Optimization of Fe concentration

[0075] Iron is essential for bacterial growth. Iron deficiency will inhibit bacterial growth because many bacterial metabolic processes depend on iron. Excessive iron may induce oxidative stress and be toxic to bacteria. Under the above optimized conditions, ferrous sulfate heptahydrate was used as the iron source to optimize the Fe element concentration. In this experiment, the Fe element concentration was optimized at 0 g / L, 0.005 g / L, 0.015 g / L, 0.025 g / L, and 0.035 g / L. The results are shown in Figure 2. Fig.12As shown in the figure, when there is no Fe element, the biomass is the lowest, indicating that the Fe element has an important influence on the growth of methylotrophic methylophilic bacteria. When the Fe concentration is 0.005g / L, the biomass is the highest. The protein content gradually decreases with the increase of Fe concentration, indicating that the Fe element has a negative impact on the protein content. In terms of comprehensive protein yield, the Fe concentration is selected to be 0.005g / L.

[0076] In summary, the pH of the optimized fermentation medium is 7.5, and the formula is:

[0077]

[0078] The fermentation medium was used to culture at 32°C and 180 rpm / min on a shaking table for 48 hours. The biomass of the single-cell protein bacteria obtained by fermentation was 3.05 g / L, the protein content was 58.25%, and the protein yield reached 1.78 g / L.

[0079] The number of equipment and processing scales described here are used to simplify the description of the present invention. Applications, modifications and variations of the present invention's methylotrophic methylophilic bacteria HN238 and its culture method and use will be apparent to those skilled in the art.

[0080] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes, and they can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and the illustrations shown and described herein.

Claims

1. A methylotrophic methylophilic bacterium HN238, characterized in that The classification name of methylotrophic methylotrophic bacteria HN238 is: methylotrophic methylotrophic bacteria ( Methylophilus methylotrophus ), Methylotrophic Methylophilus ( Methylophilus methylotrophus ) HN238 was deposited in the General Microbiology Center of China Microorganism Culture Collection (CGMCC) on January 8, 2024. The deposit number is CGMCC No.29546. The address of the depository is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing.

2. The method for cultivating the methylotrophic methylophilic bacteria HN238 according to claim 1, characterized in that: The method comprises adding the methylotrophic methylophilus bacteria HN238 into a fermentation medium and culturing the culture medium at 10-38° C. and pH 5.0-8.

0.

3. The culture method according to claim 2, characterized in that The culture was carried out at 28~37℃ and pH 7.0~8.

0.

4. The culture method according to claim 3, characterized in that The culture was carried out at 32°C and pH 7.

5.

5. The culture method according to claim 2, characterized in that: The fermentation medium comprises: 1-40 g / L methanol, 0.1-6 g / L ammonium sulfate, 0.1-4 g / L dipotassium hydrogen phosphate, 0.1-3 g / L sodium dihydrogen phosphate, 0-0.2 g / L zinc sulfate heptahydrate, 0-2 g / L magnesium sulfate heptahydrate, 0-0.1 g / L ferrous sulfate heptahydrate, and 0-0.1 g / L calcium chloride dihydrate.

6. The culture method according to claim 5, characterized in that The fermentation medium comprises: 5-30 g / L methanol, 0.8-4.8 g / L ammonium sulfate, 0.1-3 g / L dipotassium hydrogen phosphate, 0.1-2.5 g / L sodium dihydrogen phosphate, 0.02-0.1 g / L zinc sulfate heptahydrate, 0.1-0.9 g / L magnesium sulfate heptahydrate, 0.005-0.035 g / L ferrous sulfate heptahydrate, and 0.006-0.043 g / L calcium chloride dihydrate.

7. The culture method according to claim 6, characterized in that The fermentation medium includes: 10 g / L methanol, 1.8 g / L ammonium sulfate, 2.2 g / L dipotassium hydrogen phosphate, 1.8 g / L sodium dihydrogen phosphate, 0.04 g / L zinc sulfate heptahydrate, 0.2 g / L magnesium sulfate heptahydrate, 0.005 g / L ferrous sulfate heptahydrate, and 0.013 g / L calcium chloride dihydrate.

8. Use of the methylotrophic Methylophilus HN238 described in claim 1 in producing single-cell protein.

9. A bacterial agent for producing protein, characterized in that: It includes the methylotrophic methylotrophic bacteria HN238 described in claim 1.

Images