Molecular marker related to sheep feed conversion rate and application thereof

Abstract

The invention belongs to the technical field of screening and preparation of sheep molecular markers, and relates to a molecular marker related to sheep feed conversion rate and application thereof. The molecular marker is characterized in that a primer is designed according to an FABP7 gene sequence, DNA is extracted from sheep blood, an A / G polymorphic site exists at the 255th site of an amplified fragment through PCR amplification, DNA sequencing and sequence analysis, an AQPTM primer is further used for detecting the polymorphic sites of 821 Hu sheep and establishing a least square model, and the FABP7 gene sequence is used for detecting the polymorphic sites of the 821 Hu sheep. The genotype and the feed conversion rate are subjected to correlation analysis, and finally it is determined that the amplified FABP7 gene segment can serve as the molecular marker related to the sheep feed conversion rate. The molecular marker disclosed by the invention can be used for breeding a new variety of grain-saving high-quality mutton sheep, provides a genetic engineering means for genetic improvement of the feed conversion rate of sheep, and has an important practical application value.

Description

Technical Field

[0001] The invention belongs to the technical field of screening and preparing sheep molecular markers, and specifically relates to FABP7 gene polymorphism as a molecular marker related to sheep feed conversion rate and application thereof. Background Art

[0002] Chinese invention patent (CN109554489B) A molecular marker related to sheep feed conversion rate and its application. The present invention provides a molecular marker related to sheep feed conversion rate, as well as a detection method and application of the molecular marker. The present invention performs PCR amplification and sequence analysis on the sheep ZEB2 gene, and finds that there is a T / C polymorphic site at the 645th position of the amplified fragment. The polymorphic sites of 137 Hu sheep are further detected using PCR-RLPF and a least squares model is established. The genotype and feed conversion rate are analyzed for association, and it is finally determined that the ZEB2 gene fragment amplified by the present invention can be used as a molecular marker related to the sheep feed conversion rate, and the C allele is a dominant allele. The molecular marker of the present invention can be used for the selection and breeding of grain-saving sheep and the cultivation of new grain-saving high-quality mutton sheep varieties, providing a genetic engineering means for the genetic improvement of sheep feed conversion rate, and has great practical application value. This patent uses the specificity of restriction endonucleases to complete the detection of alleles, and its accuracy is guaranteed to a certain extent, but its detection scale and efficiency are greatly limited. As the scale of the experiment expands, its experimental variables are difficult to unify, and the experimental accuracy will decrease accordingly.

[0003] The FABP7 gene is expressed in the brain, liver, mammary gland, kidney, subcutaneous fat, and muscle of mammals (Shan Liling. Study on the interaction between differential proteins in rabbit liver tissue and RHDV [D]. Beijing: Chinese Academy of Agricultural Sciences, 2014: 25-26.). The FABP7 gene is expressed in large quantities in neural stem cells and developing brain astrocytes. Polyunsaturated fatty acids (PUFAs) are key structural components of the brain and are essential for normal brain development. The cellular transport and physiological effects of PUFAs are closely related to the fatty acid binding proteins encoded by the intracellular lipid binding protein gene family. FABP7 is a strong binder of ω-3 PUFA, indicating that it plays a role in cell differentiation and proliferation by regulating lipid metabolism and signal transduction (Owada Y, Yoshimoto T, Kondo H. Spatio-temporally differential expression of genes for three members of fatty acid binding proteins in developing and mature rat brains [J]. J Chem Neuroanat, 1996, 2 (2): 113-122.). FABP7 is closely related to lipid metabolism, and its main function is to bind and transport PUFAs, which are essential for cell differentiation, synaptic activation and biosynthesis of photoreceptor membranes in the early growth stage. In the whole genome association analysis of Beijing oily chicken, MLM model and GLM model analysis found that the FABP7 gene existed near the SNP site where breast muscle weight and breast muscle rate reached the extremely significant level of the whole genome (Wu Dan. Whole genome association study of Beijing oily chicken weight and carcass traits [D]. Beijing: Chinese Academy of Agricultural Sciences, 2012: 38-39.), and thus FABP7 may be a candidate gene affecting body weight and carcass traits. However, there are relatively few studies on FABP7 in terms of feed efficiency traits, and the feed conversion rate of sheep is affected by micro-effect polygenes. The present invention explores the correlation between different genotypes and the feed conversion rate of sheep by sequencing and analyzing the FABP7 gene, aiming to provide a reference basis for the selection and breeding of sheep fine breeds and provide genetic engineering means for the cultivation of excellent sheep breeds in my country. Summary of the invention

[0004] The purpose of the present invention is to design and provide a molecular marker related to sheep feed conversion rate and a technical solution for its application.

[0005] The molecular marker of the present invention is amplified from the sheep FABP7 gene, and its specific nucleotide sequence is shown in SEQ ID NO: 1. By amplifying the DNA sequence of the sheep FABP7 gene and sequencing, the polymorphic sites of the FABP7 gene are screened, so that a detection method for the molecular marker related to the sheep feed conversion rate can be established, and the molecular marker can be applied to the breeding of new varieties of grain-saving high-quality mutton sheep.

[0006] The technical solution of the present invention is as follows:

[0007] In one aspect, the present invention provides a molecular marker related to sheep feed conversion rate, which is obtained by amplifying sheep FABP7 gene. Specifically, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, that is,

[0008] TCACTATTCGCTCAACCATTACTTTTTGAAAAATCAATTTGTTTGACTTCCATATCAGAAATCTGATCTGTACCTATTGCTATGTTCTGCATTTTGTTGGTGGTCTCAGTCTGTTGTTAGTCTGGATGGAGACAAACTTGTTCATGTACAGAAATGGGATGGCAAAGAAACAA ATTTTGTAAGAGAGATTAAGGATGGCAAAATGGTCATGGTAAGTAGAGCAATTCCCGATTCCTATTCCTGCTTCTTTCCTACCCCCCTCAAATTTCCCATTTCCTTCCTTGTCCCTCCTTCCCTCCTTTTCCCATCTTTCCTTTTCTAATAACATTAAGTCACTAGCAAGG

[0009] The R at position 255 represents A or G. Since the above sequence has an A / G mutation at the 255th base, it leads to the A / G polymorphism of the sheep FABP7 gene at this site.

[0010] In a second aspect, the present invention provides a primer pair for detecting the above-mentioned molecular marker. Any primer that can specifically amplify the molecular marker of the present invention or a fragment containing the above-mentioned polymorphic site is suitable for detecting the molecular marker. Preferably, the nucleotide sequence of the primer pair for detecting the molecular marker is:

[0011] Forward primer MF: TCACTATTCGCTCAACCATT (SEQ ID NO. 2);

[0012] Reverse primer MR: CCTTGCTAGTGACTTAATGT (SEQ ID NO. 3).

[0013] In addition, the primer pair of the present invention can be designed for the positive strand and the antisense strand of the molecular marker. TM SNP primer pair, its AQP TM The nucleotide sequences of the SNP primer pairs are:

[0014] Forward primer A1 for detection of AlleleA:

[0015] GAAGGTGACCAAGTTCATGCTGATTCCTATTCCTGCTTCTTCTCCTA (SEQ ID NO. 4);

[0016] Forward primer A2 for detection of AlleleG:

[0017] GAAGGTCGGAGTCAACGGATTGATTCCTATTCCTGCTTCTTCTCCTG (SEQ ID NO. 5);

[0018] Universal reverse primer C: GGACAAGGAAGGAAATGGGAAATT (SEQ ID NO. 6).

[0019] In a third aspect, the present invention provides a kit for detecting the above-mentioned molecular markers, wherein the kit comprises the primer pair of the second aspect of the present invention.

[0020] In a fourth aspect, the present invention provides a method for detecting a molecular marker related to sheep feed conversion rate, wherein the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the method comprises using the primer pair or the kit of the present invention to detect the sheep FABP7 gene, and the detection method of the present invention comprises the following steps:

[0021] a) amplifying sheep genomic DNA using the primer pair of the present invention or a kit comprising the primer pair;

[0022] b) identifying the polymorphic sites of the amplified product obtained in step a).

[0023] Wherein, in step b), the above-mentioned SNP typing methods include but are not limited to direct sequencing method, probe method, gene chip method, and high-resolution melting curve method.

[0024] When the molecular marker sequence and polymorphic site of the present invention are known, designing corresponding probes for the polymorphic site and detecting the molecular markers and polymorphic sites using the above-mentioned SNP typing method are both relatively common and mature technologies in the field. The probes designed for the polymorphic site may also be included in the kit of the third aspect of the present invention.

[0025] More specifically, the method for detecting molecular markers related to sheep feed conversion rate using the above primer pair in the present invention comprises the following steps:

[0026] a) extracting genomic DNA from sheep blood as a sample, and performing PCR amplification on the sheep FABP7 gene using primers shown in SEQ ID NO.2 and SEQ ID NO.3;

[0027] b) sequencing and sequence analysis of the PCR amplification products to determine the genotype based on the base type of the polymorphic site.

[0028] In addition, the present invention also relates to using AQP TM The method for detecting molecular markers related to sheep feed conversion rate by using primer pairs comprises the following steps:

[0029] a) extracting genomic DNA from sheep blood as a sample, and performing high-throughput water bath PCR amplification using the primer pairs shown in SEQ ID NO.4-6;

[0030] b) After amplification, use the C1000 TouchTM Thermal Cycler instrument to detect the fluorescent signal and view the typing results.

[0031] In a fifth aspect, the present invention provides an application of the detection method of the above-mentioned molecular marker, primer pair or kit in the detection of sheep feed conversion rate, by detecting the molecular marker of the present invention in the sheep to be tested and analyzing the type of polymorphic site.

[0032] In a sixth aspect, the present invention provides an application of the detection method of the above-mentioned molecular marker, primer pair or kit in sheep breeding. By using the primer pair or kit of the present invention to amplify and detect the FABP7 gene, the genotype of the sample to be tested is determined, and a preliminary association analysis is performed between its genotype and the feed conversion rate of the sheep, thereby providing a new molecular marker for molecular marker-assisted selection of sheep.

[0033] The association analysis between genotype and feed conversion rate showed that when consuming the same amount of feed, the weight gain of sheep with AA genotype was greater than that of sheep with AG genotype and GG genotype.

[0034] The beneficial effects of the present invention are as follows: a detection method for molecular markers related to the feed conversion rate of sheep and the polymorphic sites that cause the same is established, the genotype of the polymorphic sites of the sheep to be tested can be determined, and the genotype can be used to select AA homozygous sheep as breeding sheep for breeding, so as to cultivate grain-saving sheep and improve the quality of sheep, which is helpful to improve the economic benefits of the breeding industry.

[0035] This patent completes the detection of alleles by detecting the different fluorescence effects produced by the amplification of primers containing fluorescent probes. On the basis of ensuring a certain accuracy, the operation difficulty is lower, which greatly improves the experimental efficiency. As the scale of the experiment expands, the experimental cost will also decrease, and the experiment has high repeatability and strong verifiability. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 .Gel electrophoresis diagram of the sheep FABP7 gene fragment used as a molecular marker in the present invention, wherein lane M: DL 2000Plus Marker, lanes 1-12: FABP7 gene amplification results.

[0037] Figure 2 .The sequencing results of the mutation sites of the sheep FABP7 gene in the present invention.

[0038] Figure 3 . The sheep FABP7 gene g.15690488A>G mutation site AQP TM Typing results: The blue dot on the left represents the AA genotype, the green dot in the middle represents the AG genotype, and the orange dot on the right represents the GG genotype. DETAILED DESCRIPTION

[0039] The present invention is described in detail below with reference to examples. The scope of protection claimed by the present invention is not limited to the specific implementation methods. The specific examples provided by the present invention are only exemplary and do not constitute any limitation to the scope of the present invention. Those skilled in the art may modify the specific implementation methods of the present invention or make equivalent substitutions for some technical features with reference to the description in the specification. These improvements and substitutions that do not require creative labor should also fall within the scope of protection of the claims attached to the present invention.

[0040] Example 1 Amplification of FABP7 gene

[0041] (1) Primer design

[0042] Using sheep FABP7 gene DNA (GenBank accession number: NC_056061.1) as a template, a pair of primers MF and MR were designed using Oligo7.0 software. The primer sequences are as follows:

[0043] FABP7:

[0044] MF: 5′-TCACTATTCGCTCAACCATT-3′ (SEQ ID NO.2),

[0045] MR: 5'-CCTTGCTAGTGACTTAATGT-3' (SEQ ID NO.3)

[0046] (2) Amplification and sequencing of FABP7 gene

[0047] The total volume of the PCR reaction was 35 μL, including: 2×PCR Master Mix 17.5 μL, upstream primer RF 1.12 μL at a concentration of 10 μmol / L, downstream primer RR 1.12 μL at a concentration of 10 μmol / L, DNA template 1.4 μL, ddH2O 14 μL. The DNA template was genomic DNA extracted from sheep blood.

[0048] The PCR amplification program was as follows: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 60 s, 35 cycles, and a final extension at 72°C for 10 min.

[0049] The PCR reaction product was detected by 1.5% agarose gel electrophoresis, and the results showed that a 347 bp specific amplified fragment ( Figure 1 The amplified PCR fragment was sequenced, and the sequencing results showed that the specific nucleotide sequence of the amplified fragment was as shown in SEQ ID NO.1, wherein there was a polymorphic site in the 255 bp fragment, that is, the amplified FABP7 gene fragment had an A / G polymorphism at the 255 bp site ( Figure 2 ).

[0050] (3) DNA sequence homology search and identification:

[0051] The DNA sequence obtained after sequencing was compared with the known physiological function genes published in the GenBank database by BLAST (Basic Local Alignment Search Tool) software on the website of the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) to identify and obtain the functional information of the DNA sequence. The search results showed that the sequence was 99% identical to the partial sequence of the sheep FABP7 gene DNA (GenBank accession number: NC_056061.1).

[0052] Example 2 Establishment of genotyping detection method

[0053] (1) Primer sequence design

[0054] Design of AQP for the A / G polymorphic site of the amplified fragment in Example 1 TM Primer pair, thereby used for specific detection of the polymorphic site, the AQP TM The nucleotide sequences of the primer pairs are:

[0055] Forward primer A1 for detection of AlleleA:

[0056] GAAGGTGACCAAGTTCATGCTGATTCCTATTCCTGCTTCTTCTCCTA (SEQ ID NO. 4);

[0057] Forward primer A2 for detection of AlleleG:

[0058] GAAGGTCGGAGTCAACGGATTGATTCCTATTCCTGCTTCTTCTCCTG (SEQ ID NO. 5);

[0059] Universal reverse primer C: GGACAAGGAAGGAAATGGGAAATT (SEQ ID NO. 6).

[0060] The above primers were synthesized by Beijing Shenggong Biotechnology Co., Ltd. TM Each set of primers in the primer pair was diluted to 100 μmol / L and mixed at a volume ratio of 12:12:30:46 (primer A1: primer A2: primer C: sterile water) for use.

[0061] (2) Extracted genomic DNA and performed quality control

[0062] The genomic DNA can be extracted from sheep blood using a DNA extraction kit. The quality of the extracted genomic DNA is tested using 1% agarose electrophoresis and Nanodrop2100. The qualified DNA requires: (1) agarose electrophoresis shows a single DNA band without obvious diffusion. (2) Nanodrop2100 detects A260 / 280 between 1.8-2.0; A260 / 230 between 1.8-2.0; and no obvious light absorption at 270nm. According to the AQP of Beijing Jiacheng Biotechnology Co., Ltd. TM The detection technology and genome size are used to calculate the DNA dosage to be 2-50 ng / sample. The extracted genomic DNA is diluted to a concentration of 2-50 ng / μL and used as a DNA template.

[0063] (3) Genotyping

[0064] First, the above AQP TM Each primer in the primer pair (100 μmol / L) was mixed with sterile water in a volume ratio of 12:12:30:46 (primer A1: primer A2: primer C: sterile water) to prepare a primer mixture for use.

[0065] Then, use a pipette to add 0.07 μL of primer mixture, 0.5 μL of sterile water, 2.5 μL of HiGeno 2xProbe Mix, and 2 μL of diluted DNA template (2-50 ng / μL) to each well of the 384-well plate. After adding, seal the membrane, oscillate and centrifuge, and place on the C1000TouchTM Thermal Cycler instrument for PCR amplification.

[0066] The specific procedures are:

[0067] Pre-denaturation at 95°C for 10 minutes;

[0068] 95°C, 20 seconds (denaturation) - 61°C - 55°C, 40 seconds (renaturation & extension), amplification for 10 cycles, decreasing 0.6°C per cycle;

[0069] Amplification was continued for 34 cycles from 95°C, 20 seconds (denaturation) to 55°C, 40 seconds.

[0070] After amplification, the C1000 TouchTM Thermal Cycler instrument was used to detect the fluorescence signal at 37°C and check the typing. The specific results are as follows Figure 3 As shown. With HEX as the horizontal axis and FAM as the vertical axis, each figure in the figure represents a test material, where the blue square near the left side indicates that the site is a homozygous genotype "AA"; the green triangle near the middle indicates that the site is a heterozygous genotype "AG"; the orange dot near the right side indicates that the site is a homozygous genotype "GG".

[0071] (4) Application of the molecular marker of the present invention in association analysis of sheep feed conversion rate marker traits

[0072] A total of 821 Hu sheep were tested for polymorphism, their genotypes were determined, and the least squares model described below was established to conduct association analysis between genotype and feed conversion rate.

[0073] Y ijkl =μ+Genotype i +P j +F k +M l +ε ijkl

[0074] Among them, Yijkl is the observed value of the trait, μ is the overall mean, Genotype i is the genotype effect, P j is the batch effect, F k is the paternal effect, M l is the maternal effect, ε ijkl is a random error, assuming that ε ijlmk Independent of each other, subject to N(0,σ 2 )distributed.

[0075] The genotype test results showed that among the 821 individuals, there were 46 individuals with AA genotype, 429 individuals with AG genotype, and 346 individuals with GG genotype. The results of the genotype-trait association analysis are shown in Table 1.

[0076] Table 1 Association analysis between sheep FABP7 gene polymorphism and feed conversion rate

[0077]

[0078] Note: Data in the same row with different lowercase letters indicate significant differences (P<0.05), while data with the same lowercase letters indicate no significant differences (P>0.05).

[0079] The results showed that the FABP7 g.15690488A>G mutation site was significantly correlated with the feed conversion rate of sheep (P<0.05). The FCR120180 of AA genotype individuals was 6.746±1.124, which was significantly lower than that of AG (7.212±1.195) and GG (7.342±1.487) individuals (P<0.05). The amount of feed consumed by AA individuals per kg of weight gain was 0.466 and 0.596 kg less than that of AG and GG individuals.

[0080] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A molecular marker related to feed conversion efficiency of sheep, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1, wherein R at the 255th bp is A or G, and the mutation leads to the A / G polymorphism of the molecular marker.

2. A PCR primer pair for detecting the molecular marker according to claim 1, characterized in that: The nucleotide sequence of the forward primer of the primer pair is shown in SEQ ID NO:2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO:

3.

3. A method for detecting the AQP of the molecular marker described in claim 1 TM The SNP primer pair is characterized in that The AQP TM SNP primer pairs: The nucleotide sequence of the forward primer A1 for detecting AlleleA is shown in SEQ ID NO:4, the nucleotide sequence of the forward primer A2 for detecting AlleleG is shown in SEQ ID NO:5, and the nucleotide sequence of the universal reverse primer C is shown in SEQ ID NO:

6.

4. A kit for detecting the molecular marker according to claim 1, characterized in that: The kit comprises the AQP according to claim 2 or 3 TM Primer pairs.

5. A method for detecting the molecular marker according to claim 1, comprising the following steps: a) Using the AQP according to claim 2 or 3 TM Primer pairs, or using the kit according to claim 4, to amplify sheep genomic DNA; b) identifying the polymorphic sites of the amplified product obtained in step a).

6. The method according to claim 5, characterized in that The identification method in step b) is selected from sequencing method, fluorescent probe method, gene chip method, and high-resolution melting curve method.

7. The method according to claim 5, characterized in that Using the AQP according to claim 3 TM The primer pairs are used for PCR amplification, and after the amplification is completed, the typing results are determined by detecting the fluorescent signal.

8. The molecular marker according to claim 1, or the AQP according to claim 2 or 3 TM Use of a primer pair, or a kit according to claim 4, or a method according to any one of claims 5 to 7 in detection related to sheep feed conversion rate.

9. The use according to claim 8, characterized in that: The association analysis between genotype and feed conversion rate showed that when consuming the same amount of feed, the weight gain of sheep with AA genotype was greater than that of sheep with AG genotype and GG genotype.

Images