Rapid detection method for citrus physalospora divaricata and colletotrichum gloeosporioides

Abstract

The invention discloses a rapid detection method of citrus physalospora piricola and colletotrichum gloeosporioides, and relates to the technical field of fungus detection, and the key points of the technical scheme are as follows: establishing a rapid molecular detection system for distinguishing the two pathogenic bacteria types: designing specific primers PS-F / Co-R and Cg-F / Co-R according to ITS sequence difference of citrus physalospora piricola and colletotrichum gloeosporioides, a direct PCR detection technology is adopted, a PCR reaction system and parameters are optimized, early-stage diseased tissues collected in a field are subjected to indoor moisturizing culture for 2 days, and after hyphae grow out, a small amount of hyphae are selected as templates for direct PCR detection. According to the method, by observing whether an amplification strip exists or not, which pathogen infects a sample or both the two pathogens which cannot be judged by naked eyes can be quickly judged, the whole judgment process does not need pathogen separation, cloning and sequencing, the detection time can be kept within 5 hours, and the two diseases can be quickly distinguished in the early stage of the diseases.

Description

Technical Field

[0001] The invention relates to the technical field of fungus detection, and more specifically, to a rapid detection method for citrus wheel spot pathogens and anthracnose pathogens. Background Art

[0002] Anthracnose is a major disease affecting citrus production. It can harm leaves, flowers, fruits and branches, causing spots on the fruit surface, dead branches, flower and fruit drop, and can also cause post-harvest rot. The leaves are damaged by acute and chronic types, branches are mostly damaged by the death of young and tender new shoots, and fruits are damaged by dry scars, tear marks and rot. Its pathogens belong to two species of Colletotrichum, namely C. gloeosporioides and C. acutatum, as well as C. truncatum. C. gloeosporioides is the dominant bacteria. In addition to cultural traits and morphology, specific primers CgInt / ITS4 and CaInt / ITS4 can be used to distinguish C. gloeosporioides from C. acutatum.

[0003] Citrus ring spot is a fungal disease of citrus caused by Pseudofabraea citricarpa. It was first reported in Chenggu, Shaanxi in 2004. The pathogen was identified as Cryptosporiopsis citricarpa Zhu, Hyde & Li (C. citricarpa), and the disease was called "target spot". Later, the fungus was re-identified as a new monotypic genus, Pseudofabraea Citricarpar. Citrus ring spot is a low-temperature disease, which is most serious in late winter and early spring, and generally does not occur in high temperature seasons. Symptoms begin to appear in mid-December and gradually worsen. The peak incidence is from late February to mid-March, and the diseased leaves basically fall off in mid-to-late March. In Wanzhou lemons, the disease also infects the fruit, causing the fruit to have dark brown sunken spots with a diameter of 0.2cm-2.2cm, and eventually the fruit falls and rots.

[0004] Citrus ring spot and anthracnose are the main diseases in citrus production in Shaanxi, Chongqing, and parts of Hubei. Because the early symptoms are very similar, field diagnosis is difficult. Indoor identification requires separation and culture, DNA extraction, and then separate testing for each disease, which is time-consuming and labor-intensive. The detection time is as long as more than 15 days, the detection efficiency is low, and it requires personnel with rich experience in fungal identification to operate. By the time the identification results are obtained, the best time for prevention and control is often missed. The lack of early rapid detection technology results in serious spots on the fruit surface and economic losses to fruit farmers.

[0005] Therefore, there is an urgent need to establish a rapid molecular detection system that can distinguish these two types of pathogens in order to quickly detect the types of citrus disease pathogens. Summary of the invention

[0006] The purpose of the present invention is to provide a detection method based on citrus anthracnose and wheel spot pathogens, which can detect citrus anthracnose and wheel spot pathogens sensitively, reliably and specifically, and has low price, simple operation and is not prone to false positives.

[0007] The above technical objectives of the present invention are achieved through the following technical solutions:

[0008] A rapid detection method for citrus wheel spot pathogens and anthracnose pathogens comprises the following steps:

[0009] S1. Sample collection: Collect early diseased tissues from the field, culture and keep moist for 2 days, and after a small amount of hyphae grows, pick the hyphae as a PCR template;

[0010] S2.PCR detection: optimize the PCR reaction system and parameters, and perform direct PCR amplification;

[0011] S3. Pathogen detection: The PCR amplification products are separated by gel electrophoresis, and the amplified bands are observed using a gel imaging system. Based on the presence or absence of the amplified bands, it is possible to quickly distinguish whether the sample contains wheel spot bacteria or anthrax bacteria.

[0012] The present invention also provides a citrus anthracnose pathogen-specific amplification primer, which is used in the rapid identification method of the citrus anthracnose pathogen and the wheel spot pathogen, and the nucleotide sequence thereof is: Cg-F:TACGCTCTAC AACCCTTTGT GA; Co-R:ACCAAGCAGA GCTTGAGGGT TG.

[0013] The invention also provides a citrus wheel spot pathogen-specific amplification primer, which is used in the rapid identification method of the citrus anthracnose pathogen and the wheel spot pathogen, and the nucleotide sequence thereof is: Ps-F: CATGCCCTTC GGGGTAGATC TC; Co-R: ACCAAGCAGA GCTTGAGGGT TG.

[0014] Preferably, the PCR reaction system is established including the following steps:

[0015] (1) PCR amplification system: consisting of 15ul of 2×Taq PCR Master Mix, 0.5μL of upstream primer, 0.5μL of downstream primer, 14μL of ddH2O and mycelium;

[0016] (2) PCR reaction conditions are as follows: step 1, keep at 95°C for 3 min; step 2, keep at 95°C for 10 s; step 3, keep at 55°C for 30 s; step 4, keep at 72°C for 20 s; step 5, repeat steps 2, 3, and 4 38 times; step 6, keep at 72°C for 5 min; step 7, maintain the product at 4°C.

[0017] Preferably, the PCR template in S1 includes only mycelia of Pseudomonas aeruginosa, only mycelia of Colletotrichum spp., and mixed mycelia of Pseudomonas aeruginosa and Colletotrichum spp.

[0018] In summary, the present invention has the following beneficial effects: compared with the prior art, the present invention can achieve a lower detection limit and higher sensitivity, can be applied to rapid detection, the entire judgment process does not require pathogen isolation, cloning and sequencing, the detection time can be kept within 5 hours, and the specificity in the detection process is stronger. This method can quickly distinguish between the two main diseases (wheel spot and anthracnose) currently in citrus production in the early stages of citrus disease, greatly shortening the detection and identification time, and can well solve the problem that the early symptoms of citrus ring spot and anthracnose are extremely similar and difficult to diagnose in the field, avoiding missing the best time for prevention and control, and has very good economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 is the amplification result using Ps-F+Co-R as primers in the embodiment of the present invention;

[0020] Figure 2 is the amplification result using Cg-F+Co-R as primers in the embodiment of the present invention;

[0021] Figure 3 This is the amplification result using the mixed hyphae of chrysogenum rotundifolia and anthrax as a template in the embodiment of the present invention. DETAILED DESCRIPTION

[0022] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments of the present invention and the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0023] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present invention can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0024] Example 1: A rapid identification method using only the hyphae of Pseudomonas citri citri as a template.

[0025] Design of primers for distinguishing anthrax from round spot pathogen

[0026] A rapid molecular detection system for distinguishing these two pathogenic fungi was established: based on the ITS sequence differences between citrus wheel spot and anthracnose, specific primers PS-F / Co-R and Cg-F / Co-R were designed, and direct PCR detection technology was used to optimize the PCR reaction system and parameters. Early diseased tissues collected from the field were cultured in a moisturizing manner for 2 days. After mycelium grew, a small amount of citrus wheel spot mycelium was picked as a template for direct PCR detection. The amplified length was 345bp, and the mycelium was distinguished by 2% agarose gel.

[0027] Specific primers for amplification of citrus ring spot pathogen:

[0028] Ps-F: CATGCCCTTC GGGGTAGATC TC;

[0029] Co-R:ACCAAGCAGAGCTTGAGGGTTG;

[0030] Citrus anthracnose pathogen-specific primers:

[0031] Cg-F:TACGCTCTAC AACCCTTTGT GA;

[0032] Co-R:ACCAAGCAGAGCTTGAGGGTTG;

[0033] The PCR amplification system is shown in Table 1:

[0034] Table 1 PCR amplification system

[0035]

[0036] The PCR reaction conditions are shown in Table 2:

[0037] Table 2 PCR amplification program

[0038]

[0039] like Figure 1 As shown, the PCR process took 2 hours, and after gel electrophoresis, the results were observed using a gel imaging system for 0.5 hours. The specific primers PS-F / Co-R could amplify the target band on the chrysopsis thaliana, but could not amplify the band on the anthrax bacteria.

[0040] Example 2: A rapid identification method using only the hyphae of citrus anthracnose pathogen as a template.

[0041] The method of this embodiment is the same as that of embodiment 1, except that the template is replaced with only citrus anthracnose mycelium, such as Figure 2As shown, the specific primers Cg-F / Co-R can amplify the target band on anthrax bacteria, but cannot amplify the band on wheel spot bacteria.

[0042] Example 3: A rapid identification method using mixed hyphae of citrus ring spot pathogen and anthracnose fungus as a template.

[0043] The method of this embodiment is the same as that of embodiment 1, except that the template is replaced with mixed hyphae of citrus ring spot fungus and anthracnose fungus, such as Figure 3 As shown, both the specific primers PS-F / Co-R and the specific primers Cg-F / Co-R can amplify bands on the mixed hyphae.

[0044] In summary, this method can quickly determine which pathogen is infecting a sample that cannot be determined by the naked eye or whether it contains both pathogens based on the presence or absence of amplified bands. The entire judgment process does not require pathogen isolation, cloning and sequencing. The detection time can be kept within 5 hours, and the two diseases can be quickly distinguished in the early stages of the disease.

[0045] This specific embodiment is merely an explanation of the present invention and is not a limitation of the present invention. After reading this specification, those skilled in the art may make non-creative modifications to the present embodiment as needed. However, as long as they are within the scope of the claims of the present invention, they are protected by the patent law.

Claims

1. A rapid detection method for citrus wheel spot pathogens and anthracnose pathogens, characterized by: The following steps are involved: S1. Sample collection: Collect early diseased tissues from the field, culture them indoors in a moisturizing environment for 2 days, and pick out hyphae as PCR templates after a small amount of hyphae grow; S2.PCR detection: optimize the PCR reaction system and parameters, and perform direct PCR amplification; S3. Pathogen detection: The PCR amplification products are separated by gel electrophoresis, and the amplified bands are observed using a gel imaging system. Based on the presence or absence of the amplified bands, it is possible to quickly distinguish whether the sample contains wheel spot bacteria or anthrax bacteria.

2. A citrus anthracnose-specific amplification primer, which is used in the rapid identification method of citrus anthracnose and citrus ring spot pathogens as claimed in claim 1, characterized in that: Its nucleotide sequence is: Cg-F:TACGCTCTAC AACCCTTTGTGA; Co-R:ACCAAGCAGA GCTTGAGGGT TG.

3. A citrus wheel spot pathogen-specific amplification primer, said primer being used in the rapid identification method of citrus anthracnose pathogen and wheel spot pathogen as claimed in claim 1, characterized in that: Its nucleotide sequence is: Ps-F: CATGCCCTTC GGGGTAGATCTC; Co-R: ACCAAGCAGA GCTTGAGGGT TG.

4. The rapid detection method for citrus ring spot pathogen and anthracnose pathogen according to claim 1, characterized in that: The PCR reaction system is established and comprises the following steps: (1) PCR amplification system: consisting of 15ul of 2×Taq PCR Master Mix, 0.5μL of upstream primer, 0.5μL of downstream primer, 14μL of ddH2O, and a small amount of mycelium; (2) PCR reaction conditions are as follows: step 1, keep at 95°C for 3 min; step 2, keep at 95°C for 10 s; step 3, keep at 55°C for 30 s; step 4, keep at 72°C for 20 s; step 5, repeat steps 2, 3, and 4 38 times; step 6, keep at 72°C for 5 min; step 7, store the product at 4°C.

5. The rapid detection method for citrus ring spot pathogen and anthracnose pathogen according to claim 1, characterized in that: The PCR templates in S1 include only mycelia of Psoralea corylifolia, only mycelia of Colletotrichum spp., and mixed mycelia of Psoralea corylifolia and Colletotrichum spp.

Images