Protein inhibitor aiming at clostridium difficile exotoxin B, composition containing protein inhibitor and application of protein inhibitor

Abstract

The invention provides a protein inhibitor aiming at clostridium difficile exotoxin B, a composition containing the protein inhibitor and application of the protein inhibitor. The protein inhibitor 43829 (SEQ ID No.: 1) or H3 (SEQ ID No.: 2) provided by the invention can be combined with a TcdB RBI-1 site in a broad spectrum manner; and 5N2 (SEQ ID No.: 3) can be combined with a TcdB RBI-2 site in a broad spectrum manner. The invention also provides an Fc homodimer and an Fc heterodimer fused with the protein inhibitor provided by the invention. The protein inhibitor and the composition thereof successfully neutralize the main subtype of TcdB in vitro and in vivo, and an important basis is provided for developing a new strategy for treating CDI and other echinoderm infectious diseases through de novo design.

Description

Technical Field

[0001] This application is a divisional application of the invention patent application with application number 2024103954496, application date April 2, 2024, and invention name "A protein inhibitor against Clostridium difficile exotoxin B, a composition containing the same and its application". Background Art

[0002] Clostridium difficile (also known as Clostridium difficile) is an opportunistic diarrheal pathogen that mainly colonizes the human colon. When the intestinal flora is disturbed, Clostridium difficile proliferates and causes damage to the colonic epithelial barrier. This damage in turn causes diarrhea and colitis, and in severe cases may even lead to gastroenteritis-related deaths. In the United States, there are approximately 500,000 cases of Clostridium difficile infection (CDI) each year (mainly hospital- and community-acquired), resulting in approximately 15,000 deaths. The detection rate of Clostridium difficile in patients with inflammatory bowel disease in my country is close to that in Europe and North America. Pathogenic Clostridium difficile secretes three exotoxins, including toxin A (TcdA), toxin B (TcdB), and Clostridium difficile transferase (CDT), which cause intestinal damage. Among these three toxins, TcdB is a high virulence factor required for pathogenic strains in animal models, and TcdB alone is sufficient to cause a variety of diseases in humans.

[0003] TcdB is composed of multiple domains with a molecular weight of approximately 270 kDa. It includes an N-terminal glucosyltransferase domain (GTD), a cysteine ​​protease domain (CPD), a transmission and receptor binding domain (DRBD), and a large C-terminal combined repeat oligopeptide domain (CROPs) (see Figure 1 A). TcdB utilizes GTD to glucosylate small guanosine triphosphatase (GTPase) proteins, thereby disrupting the cytoskeleton and eventually leading to cell death.

[0004] TcdB has natural variations in clinical practice, and the frequency of variation is high. According to recent studies, TcdB can be divided into at least 8 subtypes, of which 4 subtypes (called TcdB1-4) are closely related to human diseases (see Figure 1B). These TcdB variants interact with different host receptors through two separate interfaces. The first receptor binding interface (RBI) is located at the flange of the DRBD domain, and TcdB1 and TcdB3 bind to frizzled proteins (FZDs), while TcdB2 and TcdB4 are only expressed by highly virulent C. difficile strains and interact with tissue factor pathway inhibitor (TFPI) as a host receptor. The second RBI is a complex binding site composed of the CPD, DRBD and CROP domains, which interacts with chondroitin sulfate proteoglycan 4 (CSPG4) (see Figure 1 C).

[0005] The development of neutralizing protein therapeutics as a strategy to block toxin entry into host cells is considered promising for the treatment of CDI. For example, in 2016, the monoclonal antibody bezlotoxumab (ZINPLAVA) was approved by the US Food and Drug Administration (FDA) for the treatment of recurrent CDI. Bezlotoxumab binds to the N-terminus of the CROPs domain of TcdB, which may induce conformational changes in the second RBI and prevent the binding of CSPG4 (see Figure 1 C). Complete neutralization of TcdB requires simultaneous blocking of both RBIs. Researchers have developed nanobodies and designed ankyrin repeats (DARPins) to neutralize TcdB by interfering with the first RBI. However, due to differences in residues at the DRBD site between different TcdB isoforms, these protein binders are specific for certain TcdB toxin isoforms and have a narrow binding spectrum.

[0006] Therefore, a broad-spectrum TcdB neutralizer is urgently needed to universally combat various clinical TcdB variants.

[0007] Miniprotein binders are small globular proteins consisting of 37-65 amino acids. They are specifically designed to form shape- and chemically-complementary interactions with structural epitopes on target molecules. Miniprotein scaffolds have extremely high thermal stability and very low immunogenicity. Therefore, there is a need to develop a miniprotein inhibitor against Clostridium difficile exotoxin. Summary of the invention

[0008] A technical objective of the present invention is to provide a protein inhibitor against Clostridium difficile exotoxin B (TcdB) and a pharmaceutical composition containing the same.

[0009] Another technical objective of the present invention is to provide the use of the above protein inhibitor or a pharmaceutical composition comprising the same in the preparation of a drug for treating Clostridium difficile exotoxin B-mediated related diseases.

[0010] In one aspect, the present invention provides a protein comprising (1) an amino acid sequence selected from SEQ ID No.: 1 and SEQ ID No.: 3; or (2) an amino acid sequence derived from (1) which has the activity of (1) and has substituted, deleted or added 1-10, such as 1-8, 1-6, 1-5, 1-4, 1-3 or 1-2 amino acids in the amino acid sequence defined in (1). The protein according to the present invention can be used as a protein inhibitor against Clostridium difficile exotoxin B, which can prevent the toxin from entering host cells.

[0011] In some embodiments, the protein comprises the amino acid sequence of SEQ ID No.: 1 or an amino acid sequence derived from SEQ ID No.: 1 which has the activity of SEQ ID No.: 1 after substitution, deletion or addition of 1-10, for example, 1-8, 1-6, 1-5, 1-4, 1-3 or 1-2 amino acids in the amino acid sequence defined in SEQ ID No.: 1, and in particular consists of the amino acid sequence of SEQ ID No.: 1 or an amino acid sequence derived from SEQ ID No.: 1, and is a protein inhibitor against the DRBD domain of Clostridium difficile exotoxin B.

[0012] In some embodiments, the amino acid sequence derived from SEQ ID No.: 1 is shown as SEQ ID No.: 2.

[0013] During use, other functional sequences can be added to the amino acid sequence of SEQ ID No.: 1 or its mutants as needed. For example, in order to facilitate the subsequent extraction of the protein using His-tag, a His-tag and a TEV restriction site can be added before the coding sequence of SEQ ID No.: 1 or its derived amino acid sequence, but the present invention is not limited thereto. Therefore, in some embodiments, the protein comprises: (1) the amino acid sequence of SEQ ID No.: 1 or an amino acid sequence derived from SEQ ID No.: 1 that has been replaced, deleted or added with 1-10, such as 1-8, 1-6, 1-5, 1-4, 1-3 or 1-2 amino acids in the amino acid sequence defined in SEQ ID No.: 1 and has the activity of SEQ ID No.: 1; and (2) one or more selected from the His-tag tag and the TEV restriction site. In some embodiments, the protein consists of the above (1) and (2). In some embodiments, the amino acid sequences of the His-tag tag and the TEV restriction site are as shown in SEQ ID No.: 4.

[0014] In some embodiments, the protein comprises the amino acid sequence of SEQ ID No.:3 or an amino acid sequence derived from SEQ ID No.:3 that has substituted, deleted or added 1-10, for example, 1-8, 1-6, 1-5, 1-4, 1-3 or 1-2 amino acids in the amino acid sequence defined in SEQ ID No.:3 and has the activity of SEQ ID No.:3, which can better bind to the second RBI of TcdB, can block CSPG4-mediated TcdB entry into cells, and can thus be used as a protein inhibitor of Clostridium difficile exotoxin B.

[0015] During use, other functional sequences may be added to SEQ ID No.: 3 or its derived amino acid sequence as needed. For example, to facilitate the subsequent extraction of the protein using His-tag, an H1 signal peptide and an Fc tag may be added before the coding sequence of SEQ ID No.: 3 or its derived amino acid sequence, and a His-tag or a Flag-tag may be added after the coding sequence, but the present invention is not limited thereto. Therefore, in some embodiments, the protein comprises: (1) an amino acid sequence of SEQ ID No.: 3 or an amino acid sequence derived from SEQ ID No.: 3 which has the activity of SEQ ID No.: 3 after substitution, deletion or addition of 1-10, such as 1-8, 1-6, 1-5, 1-4, 1-3 or 1-2 amino acids in the amino acid sequence defined in SEQ ID No.: 3; and (2) one or more selected from the group consisting of an H1 signal peptide, an Fc tag, a His-tag tag and a Flag-tag tag. In some embodiments, the protein consists of the above (1) and (2). In some embodiments, the amino acid sequence of the H1 signal peptide and the Fc tag is shown in SEQ ID No.: 7; the amino acid sequence of the His-tag tag is shown in SEQ ID No.: 24.

[0016] In a specific embodiment, the amino acid sequence of the protein is selected from SEQ ID No.:1, SEQ ID No.:2 and SEQ ID No.:3.

[0017] In yet another aspect, the present invention provides a polynucleotide encoding the above protein.

[0018] In some embodiments, the nucleotide sequence of the polynucleotide is as shown in SEQ ID No.: 20 or 21.

[0019] In some embodiments, the nucleotide sequence of the polynucleotide is as shown in SEQ ID No.:22.

[0020] In some embodiments, the polynucleotide comprises (1) the nucleotide sequence shown in SEQ ID No.: 20 or 21; or (2) the nucleotide sequence shown in SEQ ID No.: 22.

[0021] In yet another aspect, the present invention provides a recombinant vector comprising the above-mentioned polynucleotide.

[0022] In some embodiments, the recombinant vector is pET28b or pC3.4.

[0023] In yet another aspect, the present invention provides a host cell comprising the above-mentioned recombinant vector.

[0024] In some embodiments, the host cell is a Lemo (DE3) or HEK293F cell.

[0025] In yet another aspect, the present invention provides an IgG1_Fc homodimer composed of two IgG1_Fc monomers, wherein the C-terminus of each of the IgG1_Fc monomers is coupled to the above-mentioned protein according to the present invention.

[0026] In another aspect, the present invention provides a knob-into-hole type IgG1_Fc heterodimer, which is composed of IgG1_Fc knob Components and IgG1_Fc hole The components are composed, and wherein the IgG1_Fc knob The C-terminus of the component is coupled with a protein having an amino acid sequence of SEQ ID No.: 3 or a mutant thereof in which 1-10, such as 1-8, 1-6, 1-5, 1-4, 1-3 or 1-2 amino acids are substituted, deleted or added; in IgG1_Fc hole The C-terminus of the component is coupled with a protein having an amino acid sequence of SEQ ID No.: 1 or a mutant thereof having 1-10, such as 1-8, 1-6, 1-5, 1-4, 1-3 or 1-2 amino acids substituted, deleted or added.

[0027] In a specific embodiment, in the knob-into-hole type IgG1_Fc heterodimer, in the IgG1_Fc knob The C-terminus of the component is coupled with a protein having an amino acid sequence of SEQ ID No.: 3; hole The C-terminus of the component is coupled with a protein having an amino acid sequence of SEQ ID No.: 2.

[0028] In another aspect, the present invention provides a pharmaceutical composition comprising:

[0029] A therapeutically effective amount of the above protein or the above IgG1_Fc homodimer or the above IgG1_Fc heterodimer; and

[0030] Optionally, a pharmaceutically acceptable carrier.

[0031] In view of the fact that Clostridium difficile mainly colonizes in the human colon, in a specific embodiment, the dosage form of the pharmaceutical composition is preferably a colon-release dosage form, such as an injection. The injection may be in the form of a polysaccharide-modified nanoparticle carrier known in the art, or the protein described herein may be encapsulated in a natural organic microsphere carrier to promote its release in the colon.

[0032] On the other hand, experiments have confirmed that the above-mentioned protein or the above-mentioned IgG1_Fc homodimer or the above-mentioned IgG1_Fc heterodimer of the present invention is a potent neutralizer of TcdB toxin (such as TcdB1, TcdB2, TcdB3, TcdB4), which can alleviate or prevent intestinal damage caused by TcdB toxin, such as epithelial rupture, edema, inflammation and cryptogenic damage.

[0033] Therefore, the present invention provides the use of the above protein, or the above IgG1_Fc homodimer or the above IgG1_Fc heterodimer or the above pharmaceutical composition in the preparation of an exotoxin B neutralizer or a drug for preventing or treating related diseases or symptoms caused by Clostridium difficile infection.

[0034] In a specific embodiment, the exotoxin B includes TcdB1, TcdB2, TcdB3, and TcdB4; the related diseases or symptoms caused by the Clostridium difficile infection include diarrhea, colitis, or inflammatory bowel disease caused by Clostridium difficile infection, especially intestinal damage, such as epithelial rupture, edema, inflammation, and cryptogenic damage. In some embodiments, the related diseases or symptoms caused by Clostridium difficile infection are diseases or symptoms caused by TcdB1, TcdB2, TcdB3, and TcdB4.

[0035] Beneficial Effects

[0036] The present invention designs and transforms a combined protein inhibitor against Clostridium difficile exotoxin B, which has the following advantages:

[0037] 1. The protein inhibitor H3 of the present application is designed from scratch by computer and is currently the first protein inhibitor in the world that has a broad spectrum against the DRBD domain of TcdB. The protein inhibitor exhibits a binding affinity with the DRBD domain of TcdB ranging from picomolar to nanomolar.

[0038] 2. The modified protein 5N2 in the present application is a modified protein based on the Repeat1 domain of the human CSPG4 protein. It better binds to the second RBI of TcdB and shows very high efficacy in blocking CSPG4-mediated TcdB entry into cells, while having the characteristic of low immunogenicity.

[0039] 3. The components in the protein inhibitor composition of the present application have been artificially modified and have the advantages of stable properties and high expression levels, and have the potential for mass production.

[0040] 4. The protein inhibitor and its composition of the present application are a protein preparation that neutralizes Clostridium difficile exotoxin B. Different from the commonly used clinical antibiotics such as fidaxomicin and vancomycin, the protein inhibitor and its composition of the present application can overcome the shortcomings of these common antibiotics that destroy the health of intestinal flora and reduce drug sensitivity.

[0041] 5. The protein inhibitors and their compositions of the present application have a broader spectrum of activity and can inhibit intestinal damage caused by infection of the exotoxin B subtypes TcdB1, TcdB2, TcdB3 and TcdB4 produced by Clostridium difficile. Unlike the currently marketed monoclonal antibody Bezlotoxumab, which can only treat TcdB1 infection, the combined protein inhibitors and their compositions of the present application may have stronger broad-spectrum performance.

[0042] 6. The protein inhibitors and compositions of the present application successfully neutralized the major subtypes of TcdB in vitro and in vivo. These findings provide an important basis for developing new strategies for treating difficult infectious diseases such as CDI by de novo design. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 :A shows the domain composition of exotoxin B subtype 1 (TcdB1) and the distribution of two receptor binding interfaces (RBIs). TcdB consists of four domains, including the glucosyltransferase domain (GTD, pink), the cysteine ​​protease domain (CPD, khaki), the transmission and receptor binding domain (DRBD, light blue) and a C-terminal combined repeat oligopeptide domain (CROPs, gray). The first receptor binding interface (RBI-1, orange) is located in the transmission and receptor binding domain, while the second receptor binding interface (RBI-2, navy blue) is composed of multiple domains of CPD, DRBD and CROP.

[0044] B: Shows the relationship between the various TcdB subtypes. The left figure draws an evolutionary tree based on the sequence information of the first receptor binding interface (RBI-1), showing two clusters formed by the RBI-1 sequence information of two TcdB family members; the right figure draws the existing TcdB evolutionary tree and shows the proportion of different subtypes of TcdB.

[0045] C: The left picture shows the distribution of two receptor binding interfaces in the three-dimensional structure of TcdB. Receptor binding interface 1 (RBI-1) is orange, and receptor binding interface 2 (RBI-2) is navy blue; the middle picture shows the binding positions of monoclonal antibody bezlotoxumab (pink), chondroitin sulfate proteoglycan 4 (CSPG4, cyan), Frizzled protein 2 (FZD2, green) and tissue factor pathway inhibitor (TFPI, yellow) in the three-dimensional structure of TcdB; the right picture shows that members of TcdB family 1 (TcdB1, TcdB3) can bind to FZD2 through RBI-1, while members of TcdB family 2 (TcdB2, TcdB4) can bind to TFPI through RBI-1.

[0046] Figure 2 :Schematic diagram of the technical route of the present application. A: Taking TcdB1 as an example, the composition of the exotoxin B domain and the distribution of two receptor binding interfaces (RBIs) are shown. TcdB is composed of four domains, including a glucosyltransferase domain (GTD, pink), a cysteine ​​protease domain (CPD, khaki), a transmission and receptor binding domain (DRBD, light blue) and a C-terminal combined repeat oligopeptide domain (CROPs, gray). The first receptor binding interface (RBI-1, orange) is located in the transmission and receptor binding domain, while the second receptor binding interface (RBI-2, navy blue) is composed of multiple domains including CPD, DRBD and CROP. B: Taking TcdB1 as an example, two results of the first phase of work are shown. 43829 / H3 (green) can broadly bind to the TcdBRBI-1 site. 5N2 (pink) can broadly bind to the TcdB RBI-2 site. C: Taking TcdB1 as an example, the results of the second phase of work are shown. IgG1Fc knob _5N2 (pink) and IgG1Fc hole _H3 (green) completes multi-site saturation of exotoxin B by forming a heterodimer.

[0047] Figure 3 : FPLC chromatogram (A) and SDS-PAGE photo (B) of the protein inhibitor 43829 of the present application.

[0048] Figure 4: FPLC chromatogram (A) and SDS-PAGE photo (B) of the protein inhibitor H3 of the present application.

[0049] Figure 5 : Protein identification of Fc homodimers (Fc_5N2 and Fc_R1 and Fc_H3) fused with protein inhibitors. FPLC chromatogram (A) and SDS-PAGE photo (B) of Fc_5N2, FPLC chromatogram (C) and SDS-PAGE photo (D) of Fc_R1, FPLC chromatogram (E) and SDS-PAGE photo (F) of Fc_H3.

[0050] Figure 6 : FPLC chromatogram (A) and SDS-PAGE photograph (B) of Fc heterodimer (Fc_H3_5N2) fused with protein inhibitor.

[0051] Figure 7 : SDS-PAGE photograph of recombinant exotoxin B.

[0052] Figure 8 : Affinity determination of 43829 with the DRBD domains of various TcdBs, A: 43829 with TcdB1; B: 43829 with TcdB2; C: 43829 with TcdB3; D: 43829 with TcdB4.

[0053] Fig. 9 : Affinity determination of H3 and the DRBD domains of various TcdBs, A: H3 and TcdB1; B: H3 and TcdB2; C: H3 and TcdB3; D: H3 and TcdB4.

[0054] Fig.10 : Affinity determination of Fc_5N2 and various TcdBs A: Fc_5N2 and TcdB1; B: Fc_5N2 and TcdB2; C: Fc_5N2 and TcdB3; D: Fc_5N2 and TcdB4.

[0055] Fig.11 :43829、CSPG4 caused by H3 infection of TcdB - / - Effect of cell rounding. A: For TcdB1-induced cytopathic effect, H3 showed a more significant effect of reducing lesions compared with 43829; B: For TcdB4-induced cytopathic effect, H3 showed a more significant effect of reducing lesions compared with 43829.

[0056] Fig.12:The effects of Fc_R1 and Fc_5N2 on the rounding of FZD1 / 2 / 7- / - cells caused by TcdB1 infection. A: The fitting curve of TcdB1-induced cytopathic effect. Compared with Fc_R1, Fc_5N2 showed a more significant effect in reducing lesions; B: For the TcdB1-induced cytopathic effect in A, the dose of inhibitor required for 50% of cells not to round was calculated.

[0057] Fig.13 : Effects of combined inhibitors on colon damage caused by multiple TcdB infection. A: Schematic diagram of the structures of Fc_H3, Fc_5N2, and Fc_H3_5N2; B, C, D, E: H&E staining showing the colon tissue pathology of mice induced by TcdB1 (B), TcdB2 (C), TcdB3 (D), and TcdB4 (E), as assessed by the colon ring assay, and the improvement of colon pathology by Fc_H3, Fc_5N2, and Fc_H3_5N2. The figure shows representative images, scale bar = 100 μm. Six mice were analyzed in each group, and the error bars represent the mean ± SEM. DETAILED DESCRIPTION

[0058] The technical solution of the present application is explained in detail below through specific implementation methods. However, those skilled in the art will understand that the protection scope of the present application is not limited thereto.

[0059] the term

[0060] In the present application, "therapeutically effective amount" refers to an amount sufficient to achieve control of a disease when a drug is administered to a human for treating the disease.

[0061] The present invention is described in detail below through specific examples to enable those skilled in the art to better understand the present invention. However, these embodiments do not limit the scope of the present invention.

[0062] Combination Figure 2 To elaborate on the design ideas of this application: This application work can be divided into two stages, with a total of three results.

[0063] In the first stage, we targeted the two types of receptor binding surfaces (RBI) of TcdB1-4 and produced broad-spectrum neutralizing proteins targeting the binding surfaces. Result 1: Based on the extracellular structure threshold Repeat1 (R1) of the human protein CSPG4, directed evolution produced proteins that can bind to four pathogenic subtypes of TcdB RBI-2 Achievement 2: Based on the existing structural biology information of TcdB1 and TcdB4, a computer-generated design of a novel inhibitor that can efficiently bind to four pathogenic subtypes of TcdB was conducted based on RBI-1. RBI-1A broad-spectrum mini-binding protein (43829) was generated, and a broad-spectrum mini-binding protein (H3) with picomolar binding ability was evolved in vitro.

[0064] In the second stage, we tried to use 5N2 and H3 together to obtain a highly efficient TcdB neutralizer that can saturate two RBI sites at the same time. Result 3: This case aims to target two different sites at the same time, which is similar to the construction of bispecific antibodies. Therefore, based on the Knob into hole bispecific antibody construction model, we combined 5N2 with IgG1Fc knob Fusion expression, H3 and IgG1Fc Hole Fusion expression, using IgG1Fc Hole and IgG1Fc knob Drive the formation of heterodimers (abbreviated as Fc_H3_5N2), thereby obtaining a broad-spectrum and highly effective neutralizer that can effectively neutralize toxins and protect the colon. Fc_H3_5N2 can bind to two types of RBI of four pathogenic exotoxins B, thereby effectively blocking the cell invasion of pathogenic TcdB.

[0065] Preparation Example 1. Purification and expression of a miniprotein inhibitor (named as 43829 in this article).

[0066] The amino acid sequence of 43829 is SEQ ID No.: 1, and the nucleotide sequence is SEQ ID No.: 20. The preparation method is protein expression in Escherichia coli, and the expression vector is pET-28b.

[0067] To facilitate the subsequent extraction of proteins using His-tag, in actual operation, a His-tag and a TEV restriction site were added before the coding sequence of 43829. Its amino acid sequence is SEQ ID No.: 4, and the corresponding DNA coding sequence is SEQ ID No.: 23.

[0068] The expression strain was Lemo (DE3), and LB medium and 1 mM isopropyl-β-D-thiogalactoside (IPTG) were used as inducers to induce expression at 37°C. The bacteria were harvested after 6 hours, and each liter of bacteria was collected into 40 ml phosphate buffer (PBS) (137 mM sodium chloride, 2.7 mM potassium chloride, 10 mM sodium dihydrogen phosphate, 2 mM potassium dihydrogen phosphate), and lysed by ultrasonic disruption. The lysed mixture was centrifuged at 13000 rpm, and the supernatant was passed through 1 ml Ni Sepharose 6 Fast Flow resin (Cytiva Life Sciences). The resin was washed with 50 ml buffer 2 (PBS, 40 mM imidazole, pH 8.0), and then eluted with 5 ml buffer 3 (PBS, 300 mM imidazole, pH 8.0). After the eluate was concentrated to 1 ml, molecular sieve protein purification was performed in PBS buffer (Superdex 75Increase 10 / 300GL column, Cytiva Life Sciences) and subjected to SDS-PAGE ( Figure 3 ).

[0069] Preparation Example 2. Purification and expression of a miniprotein inhibitor (named H3 herein).

[0070] The amino acid sequence of H3 is SEQ ID No.: 2, and the nucleotide sequence is SEQ ID No.: 21. The preparation method is protein expression in Escherichia coli, and the expression vector is pET-28b (+).

[0071] To facilitate the subsequent extraction of proteins using His-tag, in actual operation, a His-tag and a TEV restriction site are added before the coding sequence of H3. Its amino acid sequence is SEQ ID No.: 4, and the corresponding DNA coding sequence is SEQ ID No.: 23.

[0072] The expression strain was Lemo (DE3), and LB medium and 1 mM IPTG were used as inducers. Expression was induced at 37°C, and the bacteria were harvested after 6 hours. Each liter of bacteria was collected into 40 ml PBS buffer (137 mM sodium chloride, 2.7 mM potassium chloride, 10 mM sodium dihydrogen phosphate, 2 mM potassium dihydrogen phosphate), and lysed by ultrasonic disruption. The lysed mixture was centrifuged at 13000 rpm, and the supernatant was passed through 1 ml Ni Sepharose 6 Fast Flow resin (Cytiva Life Sciences). The resin was washed with 50 ml buffer 2 (PBS + 40 mM imidazole, pH 8.0), and then eluted with 5 ml buffer 3 (PBS + 300 mM imidazole, pH 8.0). After the eluate was concentrated to 1 ml, molecular sieve protein purification (Superdex 75 Increase 10 / 300GL column, Cytiva Life Sciences) was performed in PBS buffer and SDS-PAGE ( Figure 4 ).

[0073] Preparation Example 3. Purification and expression of recombinant TcdB inhibitor homologous protein dimers (named in this article: Fc_5N2, Fc_R1, Fc_H3).

[0074] The TcdB inhibitor of the present application can, in principle, neutralize the toxicity of TcdB after combining with TcdB, and alleviate the toxic effects of TcdB at the cellular and animal levels. In order to fully explore the function of the TcdB inhibitor, a verification experiment of a mouse model is required. Unlike in vitro cell and biochemical experiments, protein drugs will be degraded after entering the animal body or be excreted from the body by renal filtration due to molecular size problems. In order to increase the molecular size of the inhibitor and reduce the renal filtration effect, this embodiment adopts the strategy of using the human IgG1Fc domain to produce a homologous recombinant dimer inhibitor. Generally speaking, the IgG1 Fc domain has the characteristics of homodimerization, and has the advantages of low immunogenicity and a longer half-life. The combined use of IgG1 Fc and TcdB inhibitors may enhance the effect of the inhibitor, so this embodiment prepares three recombinant TcdB inhibitor homologous protein dimers.

[0075] Human IgG1 Fc used in this section YTE Mutant (hFc YTE), it has the characteristics of low cytotoxicity, low immunogenicity and long half-life. R1, which is the CSPG4R1 domain, a human TcdB receptor protein, and it has been identified that this domain has the ability to neutralize TcdB to protect cells. Its amino acid sequence is SEQ ID No.: 18, and its nucleotide sequence is: SEQ ID No.: 37. 5N2 is a variant of R1, produced by directed evolution of R1, and its amino acid sequence is SEQ ID No.: 3, and its nucleotide sequence is: SEQ ID No.: 22.

[0076] In order to facilitate the subsequent extraction of proteins using His-tag, in actual operation, based on the commercial expression vector pcDNA3.4, the H1 signal peptide and IgG1 Fc YTE Tag, whose amino acid sequence is SEQ ID No.: 7, and the corresponding DNA coding sequence is SEQ ID No.: 26. His-tag (amino acid sequence is (SEQ ID No.: 5), and the corresponding DNA coding sequence is SEQ ID No.: 24) is also added after the coding sequence of the inhibitor sequence (5N2, R1, H3). Then pcDNA3.4_H1_hFc YTE _5N2_His plasmid, pcDNA3.4_H1_hFc YTE _H3_His plasmid and pcDNA3.4_H1_hFc YTE _R1_His plasmid. The plasmid propagation strain was Dh5α, and 1 L of LB culture medium was used to culture at 37°C for 12 hours to harvest the bacteria, and the plasmid was extracted using an endotoxin-free plasmid extraction kit (Kangwei) for subsequent cell culture.

[0077] In this example, HEK293F cells were used as expression cells. When the number of cells in 1L of culture medium reached 2*10 6 When 2 mg of plasmid (pcDNA3.4_H1_hFc YTE _5N2_His plasmid, pcDNA3.4_H1_hFc YTE _H3_His plasmid or pcDNA3.4_H1_hFc YTE _R1_His plasmid) and 4 mg of PEI (linear polyethyleneimine) (Thermo Fisher Scientific) were added to the culture medium. After 72 hours of induction expression at 37°C, the cell supernatant was collected by centrifugation. 0.1 mM phenylmethylsulfonyl fluoride (SIGMA) and 1 tablet of cocktail protein inhibitor (Cytoskeleton) were added to the supernatant.

[0078] The supernatant was washed with 3 ml of Ni Sepharose excel resin (Cytiva Life Sciences) using 50 ml of buffer 2 (PBS + 10 mM imidazole, pH 8.0). Then, 5 ml of buffer 3 (PBS + 300 mM imidazole, pH 8.0) was used for elution. After the eluate was concentrated to 1 ml, molecular sieve protein purification (Superdex 200 Increase 10 / 300 GL column, Cytiva Life Sciences) was performed using PBS buffer and SDS-PAGE was performed with the addition of 1% 2-mercaptoethanol (see Figure 5 ).

[0079] Preparation Example 4. Purification and expression of the recombinant TcdB inhibitor heterologous protein dimer (named in this article: Fc_H3_5N2).

[0080] Since TcdB has two RBIs, neutralizing two sites simultaneously may have stronger cell protection ability. knob -IgG1_Fc Hole Heterodimers, respectively, in IgG1_Fc knob , IgG1_Fc Hole 5N2 or H3 was fused to the C-terminus of the recombinantly expressed TcdB inhibitor heterologous protein dimer.

[0081] In the specific operation, H1_Fc was first added to the N-terminus of 5N2. knob The nucleotide sequence corresponding to SEQ ID No.: 9 is SEQ ID No.: 28, and the GG_Flag sequence (SEQ ID No.: 6, the nucleotide sequence corresponding to SEQ ID No.: 25) is added to its C-terminus to construct pc3.4_H1_Fc knob _5N2_Flag vector. At the same time, H1_Fc was added to the N-terminus of H3 hole The sequence (SEQ ID No.: 8, the corresponding nucleotide sequence is SEQ ID No.: 27), and the His sequence (SEQ ID No.: 5) was added to its C-terminus to construct pc3.4_H1_Fc hole _H3_His vector.

[0082] HEK293F cells were used as expression cells. When the number of cells in 1L of culture medium reached 2*10 6 When 1 mg of pc3.4_H1_Fc knob _5N2_Flag plasmid, 1 mg of pc3.4_H1_Fc holeA mixture of _H3_His plasmid and 4 mg of PEI (linear polyethyleneimine) was added to the culture medium. After 72 hours of induced expression in the cells at 37°C, the cell supernatant was collected by centrifugation. 0.1 mM phenylmethylsulfonyl fluoride (SIGMA) and 1 tablet of cocktail protein inhibitor (Cytoskeleton) were added to the supernatant. The supernatant was washed with 3 ml of Ni Sepharose excel resin (Cytiva LifeSciences), and the washing buffer was 50 ml of buffer 2 (PBS + 10 mM imidazole, pH 8.0). Then 5 ml of buffer 3 (PBS + 300 mM imidazole, pH 8.0) was used for elution. After the eluate was concentrated to 1 ml, molecular sieve protein purification (Superdex 200Increase 10 / 300GL column, Cytiva Life Sciences) was performed using PBS buffer to obtain Fc_H3_5N2, 1% 2-mercaptoethanol was added and SDS-PAGE was performed (see Figure 6 ).

[0083] Preparation Example 5. Purification, expression and in vitro biotinylation modification of recombinant exotoxin B (named in this article: TcdB1-4) (named in this article: TcdB1-4 DBRD-Biotin ).

[0084] The full-length exotoxin B (named TcdB1, TcdB2, TcdB3 and TcdB4 in this article) was obtained by recombinant expression.

[0085] The sequence information is as follows:

[0086] The amino acid sequence of TcdB1 is SEQ ID No.: 10, and the nucleotide sequence is SEQ ID No.: 29;

[0087] The amino acid sequence of TcdB2 is SEQ ID No.: 11, and the nucleotide sequence is SEQ ID No.: 30;

[0088] The amino acid sequence of TcdB3 is SEQ ID No.: 12, and the nucleotide sequence is SEQ ID No.: 31;

[0089] The amino acid sequence of TcdB4 is SEQ ID No.:13, and the nucleotide sequence is SEQ ID No.:32.

[0090] The specific operation is to clone the exotoxin B (TcdB1-4) gene fragment into the pHT01 vector, and introduce a His tag (SEQ ID No.: 5) at its C-terminus to construct pHT01_TcdB1_His plasmid, pHT01_TcdB2_His plasmid, pHT01_TcdB3_His plasmid and pHT01_TcdB4_His plasmid, respectively. After chemical transformation, TcdB protein can be expressed in Bacillus subtilis strain SL401. Culture at 37°C until OD600 reaches 0.6. Induce expression at 25°C for 16 hours with 1mM isopropyl-β-d-thiogalactoside (Shanghai Biotechnology). Ni affinity chromatography and size exclusion chromatography were used to purify the his-tagged TcdB ( Figure 7 When applied to cultured cells, all purified TcdB variants induced cytopathic effects normally, indicating that they were well folded and active.

[0091] For exotoxin B with a partial DRBD domain (named TcdB1 in this article), DRBD 、TcdB2 DRBD 、TcdB3 DRBD and TcdB4 DRBD ) obtained by recombinant expression.

[0092] The sequence information is as follows:

[0093] TcdB1 DRBD The amino acid sequence is SEQ ID No.: 14, and the nucleotide sequence is SEQ ID No.: 33;

[0094] TcdB2 DRBD The amino acid sequence is SEQ ID No.: 15, and the nucleotide sequence is SEQ ID No.: 34;

[0095] TcdB3 DRBD The amino acid sequence is SEQ ID No.: 16, and the nucleotide sequence is SEQ ID No.: 35;

[0096] TcdB4 DRBD The amino acid sequence is SEQ ID No.: 17, and the nucleotide sequence is SEQ ID No.: 36.

[0097] The specific operation is to add exotoxin B (TcdB1-4 DRBD ) gene fragment was cloned into the pET21a vector, and the avi tag (amino acid sequence SEQ ID No.: 19, nucleotide sequence SEQ ID No.: 38) was fused to its N-terminus and the His tag (SEQ ID No.: 5) was introduced to its C-terminus to construct pET21a_avi_TcdB1DRBD _His plasmid, pET21a_avi_TcdB2 DRBD _His plasmid, pET21a_avi_TcdB3 DRBD _His plasmid and pET21a_avi_TcdB4 DRBD _His plasmid.

[0098] The expression strain was Lemo (DE3), and LB medium and 1 mM IPTG were used as inducers. The expression was induced at 37°C, and the bacteria were harvested after 6 hours. Each liter of bacteria was collected into 40 ml PBS buffer (137 mM sodium chloride, 2.7 mM potassium chloride, 10 mM sodium dihydrogen phosphate, 2 mM potassium dihydrogen phosphate), and lysed by ultrasonic disruption. The lysed mixture was centrifuged at 13000 rpm, and the supernatant was passed through 1 ml Ni Sepharose 6 Fast Flow resin (Cytiva Life Sciences). The resin was washed with 50 ml buffer 2 (PBS + 40 mM imidazole, pH 8.0), and then eluted with 5 ml buffer 3 (PBS + 300 mM imidazole, pH 8.0).

[0099] Biotinylated protein of exotoxin B with a partial DRBD domain (named TcdB1 in this article) DRBD -Biotin 、TcdB2 DRBD-Biotin 、TcdB3 DRBD-Biotin and TcdB4 DRBD-Biotin ) Sample preparation. Purchase the Avi-tagged protein biotin labeling kit (BirA method) from Bio-Technology Co., Ltd.: In a 100 μl system, add 1 μl BirA enzyme, 10 μl biotinylation A buffer, 10 μl biotinylation B buffer and a target protein (TcdB1) at a final concentration of 40 uM. DRBD 、TcdB2 DRBD 、TcdB3 DRBD or TcdB4 DRBD ), react at 30 degrees for 30 minutes.

[0100] The reaction solution was diluted to 3 ml and washed with 0.1 ml of Ni Sepharose resin (Cytiva Life Sciences) using 5 ml of buffer 2 (PBS + 10 mM imidazole, pH 8.0). Then, biotinylated TcdB1 was obtained after elution with 1 ml of buffer 3 (PBS + 300 mM imidazole, pH 8.0). DRBD-Biotin 、TcdB2 DRBD-Biotin 、TcdB3 DRBD -Biotin and TcdB4 DRBD-Biotin。

[0101] Preparation Example 6. Test cell lines (named in this article: HeLa, HeLa CSPG4 - / - 、HeLa FZD1 / 2 / 7 - / - ) Source and preparation.

[0102] Human cervical cancer cell line HeLa (H1, #CRL-1958) was originally obtained from the American Type Culture Collection (ATCC).

[0103] HeLa-Cas9 cell line was made based on HeLa cell line. The human codon-optimized Streptococcus pyogenes Cas9 gene sequence was subcloned from the plasmid lentiCas9-Blast (Addgene #52962), and the pQCXIH retroviral vector (Clontech) was constructed to prepare retrovirus and transduce HeLa cells. Mixed stable cells were selected under the action of hygromycin B (200 μg / ml, Life Technologies). Monoclonal cells were sorted, and after growing to a suitable density, the cells were lysed and the expression of Cas9 protein was detected by Western Blot, and the appropriate clones were selected.

[0104] Production of CSPG4 based on HeLa-Cas9 cell line - / - HeLa knockout cell line, FZD1 / 2 / 7 - / - HeLa cells. First, the following sgRNA sequences were cloned into the LentiGuide-Puro vector (Addgene), targeting the target genes: CCGGAGACACGGAGCAGTGG (CSPG4, SEQ ID No.: 39), TGCGAGCACTTCCCGCGCCA (FZD2, SEQ ID No.: 40), GTGTAATGACAAGTTCGCCG (FZD1, SEQ ID No.: 41) and GAGAACGGTAAAGAGCGTCG (FZD7, SEQ ID No.: 42). HeLa-Cas9 cells were transduced with lentivirus expressing these sgRNAs. Stable mixed cell populations were selected with puromycin (2.5 μg / ml) and hygromycin B (200 μg / ml). FZD1 / 2 / 7 - / - Cells were transduced with FZD1 and FZD7 sgRNA lentiviruses sequentially into FZD2 - / - Cells were further screened in the presence of 100pM TcdB1-1830. The mutagenesis rate of these mixed stable cells was determined by next-generation sequencing. Subsequently, monoclonal cells were selected and verified by TA cloning and first-generation sequencing to determine whether these monoclonal cells had successfully achieved gene knockout.

[0105] Test Example 1: Affinity determination of 43829, H3 and 5N2 (OCTET)

[0106] The affinity between various toxin proteins TcdB and mini-binding protein 43829 (or H3) was determined using an Octet RED96 (ForteBio) instrument.

[0107] During the assay, both the protein diluent and the reaction buffer were PBST (PBS+0.05% Tween20).

[0108] The main process is that the SA probe (ForteBio) is sequentially passed through 200 μl volume of PBST (equilibrium, 60 s), containing TcdB1 DRBD-Biotin 、TcdB2 DRBD-Biotin 、TcdB3 DRBD-Biotin or TcdB4 DRBD-Biotin (10ng / mL) PBST (solidification, 60s), PBST containing Biotin (blocking, 120s), different concentrations of test samples (43829, H3) (binding, 120s), and PBST (dissociation, 120s-30min), complete the stages of equilibrium, solidification, blocking, re-equilibrium, binding, and dissociation. The affinity (K) between samples was calculated by Data Analysis software (ForteBio) D ), and the corresponding results were drawn by Origin software.

[0109] The affinity determination of Fc_5N2 and Fc_R1 was carried out according to the above-mentioned determination method, except that the AHC probe was used.

[0110] The above affinity determination experimental results are as follows Figure 8-10 As shown in Table 1 below.

[0111] Table 1: Detailed table of affinity determination data.

[0112]

[0113]

[0114] from Figure 8It can be seen that 43829 has a high affinity for a class of TcdB toxins (TcdB1, TcdB3). The affinity of 43829 for TcdB1 can reach 21.5±3.78pM, and the affinity for TcdB3 can reach 49.1±1.09pM. The affinity of 43829 for another class of TcdB toxins is at the nanomolar level, with an affinity of 10.1 0.13nM for TcdB2 and 5.07±0.08nM for TcdB4.

[0115] from Fig. 9 It can be seen that compared with the wild type (43829), the affinity of H3 to two types of TcdB toxins is significantly improved. The affinity of H3 to TcdB2 is 965±10.7pM, and the affinity to TcdB4 is up to 278±5.4pM. The affinity of H3 to a type of TcdB toxin is similar to that of 43829. The affinity of H3 to TcdB1 is 99.3±2.42pM, and the affinity to TcdB3 is 41.8pM.

[0116] from Fig.10 It can be seen that compared with the wild-type Fc_R1, the affinity of the evolved Fc_5N2 to TcdB1 has been significantly enhanced, from 30.3±0.2nM to 4.24±0.07nM. At the same time, there is a relatively balanced affinity between Fc_5N2 and TcdB2, TcdB3 and TcdB4, which are 4.24±0.07nM, 6.52±0.07nM, 5.16±0.1nM and 3.95±0.08nM respectively.

[0117] Test Example 2: Determination of the Toxin Neutralization Capacity of 43829 and H3

[0118] The mitigating effects of mini-binding proteins 43829 or H3 on TcdB1- or TcdB4-induced cytopathic effects were further compared using a cell rounding assay. The cell rounding assay is a classic experimental approach to assess the toxic effects of exotoxin B (TcdB) on mammalian cells. TcdB has a glucosyltransferase domain (GTD) that can glucosylate uridine diphosphate-glucose (UDP), thereby inactivating Rho GTPase, leading to cytoskeletal changes, cell rounding, and loss of intestinal integrity. Therefore, cell rounding can be used as a marker of TcdB toxicity observed by optical microscopy. The cytoprotective potential of different inhibitors was evaluated by assessing their effects on cell rounding in the presence of equal amounts of TcdB.

[0119] In this test, the gold standard cell rounding assay was used to analyze the cytopathic effect of TcdB (i.e., rounding of cells). Inhibitors at different ratios were mixed with toxin at a final concentration of 100 pM and complete medium was added to culture CSPG4 - / - HeLa cells (prepared above). The cells were photographed after 4 to 6 hours of incubation. Phase contrast images were obtained using a ×10-20 objective on an Olympus IX73 microscope instrument, and manual counting of round and regular shaped cells was performed. The percentage of round cells was analyzed using GraphPad Prism 8 software.

[0120] From the CR50 (50% of cells are round) curve ( Fig.11 ) that H3 is more effective than wild-type 43829 in reducing cytopathic effects induced by different classes of TcdB toxins. Specifically, two times the concentration of H3 protected half of the cells from attack by TcdB1, while about 100 times the concentration of H3 protected 50% of the cells from attack by TcdB4.

[0121] Test Example 3: Determination of the TcdB1 Neutralization Capacity of Fc_5N2 and Fc_R1

[0122] 5N2 is an R1 mutant obtained through directed evolution in this project. At the biochemical level, 5N2 shows a stronger affinity for TcdB1, but whether it can function at the cellular level is a more important issue.

[0123] In this test case, the neutralization ability of different exotoxin inhibitors (R1, 5N2) on TcdB1 toxin was investigated. Through the classic cell rounding experiment, the cytopathic effect of TcdB1 in the presence of 5N2 and R1 was further compared. In this test, the gold standard cell rounding method was used to analyze the cytopathic effect of TcdB1 (i.e., cell morphology becomes rounded). Different ratios of inhibitors (Fc_5N2, Fc_R1) were mixed and incubated with TcdB1 at a final concentration of 100pM, and complete culture medium was added to culture FZD1 / 2 / 7 - / - HeLa cells (prepared above). The cells were photographed after 4 to 6 hours of incubation. Phase contrast images were obtained using a ×10-20 objective on an Olympus IX73 microscope instrument, and manual counting of round and normal-shaped cells was performed. The percentage of round cells was analyzed using GraphPad Prism 8 software.

[0124] From the CR50 (50% of cells are round) curve ( Fig.12) It can be clearly seen that Fc_5N2 is more effective than wild-type Fc_R1 in reducing TcdB1 toxin-induced cytopathicity. In terms of the CR50 (50% of cells are round) bar graph, 30 times the molar concentration of TcdB in Fc_5N2 can protect half of the cells from attack by TcdB1, while wild-type Fc_R1 requires 300 times the concentration to achieve the same level of protection.

[0125] Test Example 4: Determination of the neutralization ability of combined inhibitors against different TcdB toxins in a colon injury model

[0126] Since TcdB1-4 are the predominant isoforms present in more than 99.6% of pathogenic C. difficile strains, a colon loop assay was used in this example to assess whether the combination of inhibitor combinations mitigates the pathological effects caused by the major TcdB isoforms in the colon.

[0127] In this test, animal experiments were approved by the Institutional Animal Care and Use Committee of Westlake University (IACUC Protocol # 22-018-2-TL). Mice were housed under the supervision of full-time staff and had unlimited access to food and water in their housing. 6-8 week old C57BL / 6J female mice were purchased from Jiangsu Jicui Yaokang Experimental Animal Management Co., Ltd. For female mice aged 6-8 weeks, 1% sodium pentobarbital was injected intraperitoneally to induce anesthesia. A midline laparotomy was performed to find the colon and a closed loop of about 2 cm was ligated with silk thread. 2 μg of toxin and 100 μg of inhibitor (Fc_H3, Fc_5N2, Fc_H3_5N2) were mixed and diluted to a volume of 100 μL with 1xPBS, and then injected into the closed colon segment using an insulin syringe, the negative control was injected with only 100 μL PBS, and the positive control was injected with only PBS solution containing 2 μg of toxin (TcdB1-4). The skin incision was then sutured. Mice were placed in a 37°C thermostat to rest. After 6 hours, mice were euthanized and the ligated colon sections were excised. Colon samples were fixed in formalin for 12 to 24 hours, embedded in paraffin, dried with graded alcohol, and cleared with xylene. Paraffin blocks with a thickness of 5 μm were cut and stained with hematoxylin and eosin. Two pathologists blindly graded the H&E-stained sections from 0 to 4 (moderate to severe) according to edema, inflammatory cell infiltration, epithelial enterocyte damage, and crypt damage. The average score was marked on the chart.

[0128] Existing studies have shown that blocking these two RBIs simultaneously is the key to providing optimal protection against TcdB in vivo. Therefore, the present application prepared heterodimeric TcdB inhibitors (Fc_H3_5N2) and recombinant homodimeric TcdB inhibitors (Fc_H3, Fc_5N2). In order to determine the intestinal protective effects of these recombinant TcdB inhibitors on the main clinical TcdB variants in the intestinal epithelium, 2μg of TcdB variants and 100μg of microprotein conjugates were injected into the ligated mouse colon. This method has the advantage of precisely controlling the toxin / binder dose and time, making it possible to compare the relative differences in the neutralization effects of different test binders.

[0129] The four major clinical TcdBs (TcdB1-4) all caused significant damage to the mouse colonic epithelium, including epithelial disruption, edema, inflammation, and cryptogenic damage. Specifically, TcdB2 caused severe mucosal and submucosal edema, TcdB3 produced a stronger inflammatory response, and TcdB4 caused greater damage to the colonic crypts ( Fig.13 ). Addition of Fc_H3 or Fc_5N2 partially mitigated intestinal damage. Impressively, the same dose of Fc_H3_5N2 provided further enhanced protection against all 4 major TcdB variants in the colonic epithelium compared with Fc_H3 or Fc_5N2. These results suggest that newly designed heterodimeric Tcd B inhibitors may serve as a general approach for treating CDI caused by different prevalent variants.

[0130] Since TcdB1-4 are significant TcdB variants detected in more than 99.6% of patients infected with pathogenic C. difficile strains, we used the colon loop assay to evaluate whether the combination of inhibitors alleviated the pathological effects caused by major TcdB variants in the colon. It is known that TcdB variants can cause different degrees of intestinal damage, including epithelial degradation, edema, inflammatory cell infiltration, and crypt damage. Specifically, histological scores (based on the above 4 indicators) showed that tcdb1-induced colon pathology was the most severe overall, resulting in the most severe epithelial degradation. In addition to mild epithelial destruction, crypt destruction, and inflammatory cell infiltration, TcdB2 also caused significant mucosal and submucosal edema. TcdB3 mainly caused inflammatory responses, while TcdB4 severely damaged colonic crypts. The overall intestinal damage of mice co-injected with TcdB and inhibitors was reduced, among which Fc_H3_5N2 had the best protective effect. According to the different TcdB isoforms in patients, the best inhibitor can be selected for treatment ( Fig.13 ).

Claims

1. A protein comprising: (1) the amino acid sequence of SEQ ID No.: 3; or (2) An amino acid sequence derived from (1) in which 1 to 10 amino acids are substituted, deleted or added in the amino acid sequence defined in (1) and which has the activity of (1). A polynucleotide encoding the protein according to claim 1. A recombinant vector comprising the polynucleotide according to claim 2. A host cell comprising the recombinant vector according to claim 3 .

5. A pharmaceutical composition comprising: A therapeutically effective amount of a protein selected from claim 1; and Optionally, a pharmaceutically acceptable carrier.

6. Use of the protein according to claim 1 in the preparation of an exotoxin B neutralizer or a drug for preventing or treating related diseases or symptoms caused by Clostridium difficile infection.

7. The use according to claim 6, wherein The diseases or symptoms related to Clostridium difficile infection include diarrhea, colitis, or inflammatory bowel disease caused by Clostridium difficile infection.

8. The use according to claim 6, wherein The diseases or symptoms related to Clostridium difficile infection include intestinal damage caused by Clostridium difficile infection.

9. The use according to claim 6, wherein The related diseases or symptoms caused by Clostridium difficile infection are diseases or symptoms caused by TcdB1, TcdB2, TcdB3, and TcdB4.

Images