Broiler alpha-interferon, medicine for preventing and treating avian influenza and preparation method of medicine

Abstract

The invention relates to the technical field of veterinary medicine, in particular to broiler alpha-interferon, a medicine for preventing and treating avian influenza and a preparation method of the broiler alpha-interferon. The invention relates to a broiler chicken alpha-interferon. The nucleotide sequence of the broiler chicken alpha-interferon gene is shown as SeqIDNO. 1. Through the synergistic effect of the broiler chicken alpha-interferon and the avian influenza antibody, the treatment effect is improved, the treatment cost is reduced, meanwhile, medicine residues are reduced, and breeding safety and food safety are guaranteed. Replication and infection of avian influenza viruses are more effectively inhibited, harm of the viruses to broiler chickens is relieved, and meanwhile rehabilitation of the broiler chickens is promoted. In addition, the broiler chicken alpha-interferon and the antibody are derived from the broiler chicken, so that the broiler chicken alpha-interferon has better biocompatibility and safety, and the risk of drug residue is reduced.

Description

Technical Field

[0001] The present application relates to the technical field of veterinary medicines, and in particular to a broiler α-interferon, a medicine for preventing and treating avian influenza, and a preparation method thereof. Background Art

[0002] Broiler α-interferon is a cytokine with high efficiency and broad-spectrum antiviral effects. It can be widely used in antiviral treatment in the animal field, inducing cells to express antiviral proteins to inhibit viral proliferation. This broiler α-interferon has a strong resistance or inhibitory effect on various invading viruses. It is part of the body's virus defense system and has a broad-spectrum effect in preventing and treating viral diseases. This broad-spectrum, non-specific broiler α-interferon does not target specific viruses, but has an inhibitory effect on a variety of viruses. Therefore, it is called a "green" drug, does not pollute the environment, and provides effective protection for animal health. In veterinary clinics, broiler α-interferon is used as a biological product with strong antiviral properties to prevent and control the prevalence of chicken viral diseases.

[0003] Antibody therapy is a common treatment for poultry viral diseases. However, antibodies are virus-specific, and each virus has many serotypes and strong variability. The preparation of targeted antibodies has very high requirements, which brings great difficulties to the production of vaccines that are suitable for a wide range of diseases.

[0004] Avian influenza is a serious poultry disease that causes huge economic losses to the broiler industry. Although there are many treatment and prevention methods for avian influenza, the effect of using avian influenza antibodies for treatment is not ideal due to the complexity and variability of the avian influenza virus.

[0005] Therefore, developing an efficient and safe drug for preventing and treating avian influenza is of great significance to the development of broiler farming industry. Summary of the invention

[0006] In order to improve the efficiency of α-interferon in broiler chickens, a highly effective and safe drug for preventing and treating avian influenza is provided.

[0007] In a first aspect, the present application provides a broiler α-interferon, which is implemented using the following technical solution.

[0008] A broiler alpha-interferon, the nucleotide sequence of the broiler alpha-interferon gene is shown in Seq ID NO.1.

[0009] In a second aspect, the present application provides a drug for preventing and treating avian influenza, comprising broiler α-interferon with biological activity, wherein the nucleotide sequence of the broiler α-interferon gene is shown in Seq ID NO.1.

[0010] Preferably, it also includes avian influenza antibodies.

[0011] In a third aspect, the present application provides a method for preparing broiler α-interferon, comprising the following steps: The genome was extracted from broiler chicken tissues or cells, and the target gene fragment was amplified using the following primers of broiler interferon-α gene: chi-a-P1: ATGGCTGTGCCTGCAAG; chi-a-P2: CTAAGTGCGCGTGTTGCCTG; The amino acid of broiler interferon-α gene was optimized, the signal peptide sequence of the gene was removed, and primers with restriction sites were designed according to the optimized gene sequence and the vector multiple cloning site as follows: chi-a-P1-site1:GGAATTCCATATGGCCACCACCGCCTCCG; chi-a-P2-site2:ATAAGAATGCGGCCGCAGTGCGCGTGTTGCCTGTGA; The recombinant plasmid is formed, transformed into the host cell E.coli BL21 (DE3), and purified; the broiler α-interferon has the nucleotide sequence shown in SEQ ID NO.1.

[0012] Preferably, the method further comprises the following steps: Prepare protective agent: weigh 50-80g of glucose and 3-5g of Tween-80, add water for injection to dissolve to 1L, sterilize at 115℃ for 15min, cool (4℃) and set aside; Mix broiler α-interferon with the protective agent, add sterile water and stir thoroughly.

[0013] In a fourth aspect, the present application provides a method for preparing a drug for preventing and treating avian influenza, wherein the preparation method comprises the following steps: Preparation of avian influenza antibodies: Preparation of H9 avian influenza virus immunogen: preparing oil phase and water phase, and preparing immunogen in a ratio of 3:1 (V / V) of mineral oil adjuvant and inactivated virus solution; Immunize laying hens to produce specific antibodies; Inspect and disinfect eggs and separate the yolks; Preparation of egg yolk antibody: Take egg yolk and sterile saline, place in a sterile mixing tank, homogenize, filter, add thimerosal, penicillin and streptomycin, and shake well; Mixed with the broiler α-interferon.

[0014] Preferably, the mixing ratio of the broiler α-interferon and the avian influenza antibody is 1:2-2:1.

[0015] In summary, the present application includes at least one of the following beneficial technical effects.

[0016] 1. Use the broad-spectrum and long-term antiviral properties of broiler α-interferon to enhance the body's immunity, and the immediate antiviral effect of antibodies to enhance broiler chickens' resistance to avian influenza virus and strengthen the therapeutic effect.

[0017] 2. By utilizing the synergistic effect of broiler α-interferon and avian influenza antibodies, the treatment effect can be improved, the treatment cost can be reduced, and at the same time, drug residues can be reduced to ensure breeding safety and food safety.

[0018] 3. More effectively inhibit the replication and infection of avian influenza virus, reduce the harm of the virus to broiler chickens, and promote the recovery of broiler chickens. In addition, since broiler α-interferon and antibodies are derived from broiler chickens themselves, they have better biocompatibility and safety, reducing the risk of drug residues. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the result of signal peptide analysis of broiler α-interferon gene.

[0020] Figure 2 This is the result of gel cutting and recovery test of mature peptide fragment of broiler α-interferon.

[0021] Figure 3 This is the electrophoresis detection diagram of the plasmid extraction of broiler α-interferon expression vector.

[0022] Figure 4 This is a graph showing the Western Blot test results of the washing solution and dissolving solution of broiler α-interferon inclusion bodies.

[0023] Figure 5 This is a picture showing the effect of broiler α-interferon chicken embryo fibroblasts against H9 virus.

[0024] Figure 6 This is a picture showing the effect of broiler α-interferon + protective agent chicken embryo fibroblasts against H9 virus.

[0025] Description of the drawings: Figure 2 The left lane in the middle is DNA maker: from top to bottom are 2000, 1000, 750, 500, 250, 100 bp, and the right lane is the target fragment of approximately 524 bp. Figure 3The left lane in the middle is DNA maker: from bottom to top, they are: 2,087bp, 3,049bp, 3,997bp, 5,026bp, 6,133bp, 8,023bp, 10,085bp, 11,849bp. The right lane is the target fragment of about 5889bp. Figure 4 M in the middle is the protein pre-stained maker, from small to large they are: 10, 17, 25, 33, 40, 53, 70, 95, 130, 180 kDa, 1 is the inclusion body washing solution, 2 and 3 are the supernatant of the inclusion body denatured solution and the precipitate of the inclusion body denatured solution. DETAILED DESCRIPTION

[0026] The present application is further described in detail below in conjunction with all the drawings and specific embodiments.

[0027] 1. Preparation of α-interferon in broiler chickens 1. Obtaining broiler interferon-α gene The genome was extracted from the tissue of white-feathered broiler chickens using a tissue cell kit, and the primers of the broiler α-interferon gene were designed to amplify the target gene fragment, as shown in Table 1. In other embodiments, it can also be obtained from broiler cells. After obtaining the gene fragment, it was purified using a nucleic acid fragment purification kit to remove impurities and excess nucleotides. It was sent to BGI for sequencing. The nucleotide sequence of the broiler α-interferon gene is shown in Seq ID NO.1.

[0028] Table 1 Primers for amplification of the whole gene of broiler α-interferon The chi-a-P1 base sequence is shown in Seq ID NO.2, and the chi-a-P2 base sequence is shown in Seq ID NO.3.

[0029] According to the sequencing results, the amino acid of broiler interferon-α gene was optimized, and the synonymous codons of the gene were adjusted according to the codon preference of the prokaryotic host of Escherichia coli to eliminate rare codons. The signal peptide in the sequence was analyzed using the software SignalP4.1Server, such as Figure 1 As shown, the prediction results showed that the first 25 amino acids were the signal peptide sequence of broiler α-interferon.

[0030] The signal peptide sequence of the gene was removed, and primers with restriction sites were designed according to the optimized gene sequence and the vector multiple cloning site, as shown in Table 2. The final correctly sequenced broiler α-interferon gene fragment was obtained, such as Figure 2 shown.

[0031] Table 2 Broiler α-interferon (without signal peptide) gene primers (with restriction enzyme cleavage sites) The chi-a-P1-site1 base sequence is shown in Seq ID NO.4, and the chi-a-P1-site2 base sequence is shown in SeqID NO.5.

[0032] 2. Construction of broiler interferon-α expression vector According to the experimental requirements and purpose, select a suitable expression vector pET-22b(+), which should have good replication ability, stable genetic characteristics and suitable expression characteristics.

[0033] The vector and target fragment were digested with restriction endonucleases NotⅠ and NedⅠ to generate matching sticky ends.

[0034] Use the TIANQEN nucleic acid fragment gel excision recovery kit to recover the fragments, and use the Sigma ligation kit to connect the target fragments and the vector to form a recombinant plasmid. Transform the recombinant plasmid into an appropriate host cell BL21 (DE3) to replicate and express it. Use the ampicillin resistance screening marker to screen out cells that have been successfully transformed and contain the recombinant plasmid. Figure 3 shown.

[0035] The recombinant plasmid was extracted using the PROMEGA plasmid extraction kit for purification and quality control. The recombinant plasmid was identified by PCR, restriction digestion, sequencing and other methods to ensure that it contained the correct broiler α-interferon gene sequence and structure.

[0036] 3. Verification of α-interferon expression in broiler chickens (1) The expression plasmid was transformed into E. coli BL21 (DE3), and the transformants were picked out and placed in 5 mL of liquid LB medium supplemented with antibiotics, and cultured at 37°C with shaking overnight; (2) Transfer the overnight cultured bacterial solution to LB liquid medium containing antibiotics at a ratio of 1%, and culture at 200rpm and 37℃ until OD600 is 0.6-0.8. Take 1mL of bacterial solution and centrifuge at 12,000rpm for 10min, add 100μL of lysis buffer to resuspend the bacteria, add 5×protein loading buffer, and treat in a boiling water bath for 10min; at the same time, add inducer IPTG to the bacterial solution until OD600 reaches 0.6 to a final concentration of 0.2mM, induce expression for 5h, and collect the bacteria by centrifugation; (3) Preparation of inclusion bodies: add an appropriate amount of lysis buffer to resuspend the cells; ultrasonically disrupt the induced E. coli cells at a power of 200 W, 5 s / time, 5 s / interval, for a total of 50 times, on ice; centrifuge at 10,000 rpm for 25 min, and collect the inclusion body precipitate.

[0037] (4) Washing of inclusion bodies: The crude inclusion body product of broiler α-interferon mature protein was added to a washing solution (45 mmol / L Tris-HCl, pH 8.0, 0.5% Triton X-100, 0.8 mmol / L EDTA) and washed at 4°C overnight. The washed inclusion body solution was centrifuged at 10,000 × g for 10 min, and the supernatant was discarded. The above operation was repeated for multiple washings until the washing was sufficient.

[0038] (5) Dissolution of inclusion bodies: Add the washed inclusion bodies to 10 mL of prepared inclusion body dissolution solution (8 mol / L urea, 10 mmol / L GSH, 0.15 mol / L NaCl, 0.8 mmol / L EDTA, 45 mmol / L Tris-HCl, pH 8.0), and stir on an electric magnetic stirrer until fully dissolved. Centrifuge at 10000xg for 30 min, take the supernatant, and obtain the broiler α-interferon inclusion body dissolution solution. Take 100uL of the liquid, add 25μL 5xSDS-PAGE Loading Buffer, boil for 10 min, and perform SDS-PAGE electrophoresis. Figure 4 shown.

[0039] (6) Dilution of protein: Dilution buffer (40-50mmol / L Tris, 100-150mmol / L NaCl, 0.8mmol / L EDTA, 0.5-1mmol / L oxidized glutathione (GSSG), 8-10mmol / L reduced glutathione (GSH), 2mol / L urea, pH 8.0) is slowly added to the denaturing solution in small amounts several times to slowly reduce the urea concentration until it drops to 4M. The ratio of dilution buffer to purified protein is 2:1, and ensure that no white flocculent precipitate is precipitated; (7) Place the sample in a dialysis bag and place it in a dialysis buffer (urea concentrations are: 2 M, 1 M, 0.5 M, 0 M), dialyze for 16 h at each urea concentration, change the dialysis buffer every 8 h, and stir the dialysis at 4 °C; use a Bradford kit to measure the protein concentration; In other embodiments, the above parameters such as mass, concentration and time may also be adjusted accordingly within a reasonable range.

[0040] 4. Detection of interferon-α activity in broiler chickens (1) Preparation of chicken embryo fibroblasts ①SPF chicken embryos are raised to 9-11 days old; ② 10-day-old SPF chicken embryo, observe each one with an egg candling device, select well-developed live embryos, and disinfect the eggshell with an alcohol cotton ball; ③ Aseptically remove the chicken embryo, discard the eyes, viscera and limbs, put it in a sterile culture dish, and rinse it with DMEM three times to wash away blood and sticky substances; ④ Use sterilized scissors to cut the chicken embryo into rotten pieces, pour them into a 10mL EP tube, add 5 to 10mL of trypsin, and place in a 37℃ water bath for digestion for 30 minutes, shaking gently every 5 minutes; ⑤ When the tissue fragments become fluffy and the sedimentation speed slows down, let them stand until the tissue fragments sink to the bottom, aspirate the trypsin, and then rinse with PBS twice and DMEM once to completely remove the trypsin; ⑥ Then add an appropriate amount of DMEM growth medium containing 10% bovine serum, shake and blow several times with a pipette to disperse the cells, let it stand for 8 minutes, take the cell suspension of the supernatant, and add DMEM growth medium containing 10% bovine serum; ⑦ Pipette 0.1 mL into a 96-well plate and culture in a CO2 incubator at 37°C overnight until the cells grow to about 80%.

[0041] In other embodiments, the above parameters such as mass, concentration and time may also be adjusted accordingly within a reasonable range.

[0042] (2) Testing the antiviral activity of α-interferon in broiler chickens using different avian influenza viruses ① Dilution and addition of broiler α-interferon: Wash the prepared chicken embryo fibroblasts out of the culture medium and wash them with PBS and DMEM. Use DMEM to dilute the renatured broiler α-interferon protein 4 times; add the diluted broiler α-interferon to the washed chicken embryo fibroblast 96-well plate with 8 parallels per gradient, and add DMEM to the last two columns as a control without broiler α-interferon and virus. Then put it in a CO2 constant temperature cell culture incubator and incubate for about 5 hours.

[0043] ② Virus attack: Take the stored H9 avian influenza virus solution, dilute it to 100TCID50, take the cell culture plate prepared in step (1), discard the supernatant, wash it once with DMEM, add the virus solution, 100μL per well. Incubate at 37℃, then place it in a CO2 constant temperature cell culture incubator for 48h, and detect the number of live cells in each experimental group.

[0044] ③ Prepare a culture medium containing 10% CCK-8, add it in the form of liquid replacement, and incubate in the incubator for 3 hours: measure the absorbance at 450nm. Calculate the number of viable cells according to the following calculation formula.

[0045] Table 3 Protection of broiler interferon-α against avian influenza virus in chicken embryo fibroblasts Interferon dilution multiple Mean cell viability Cell viability Cell viability 1 0.17275 0.014357 1.44％ 4 0.240775 0.168155 16.82％ 16 0.6439 1.079584 107.96％ 64 0.6826 1.167081 116.71％ 256 0.6926 1.18969 118.97％ 1024 0.68385 1.169907 116.99％ 4096 0.644033 1.079885 107.99％ 16384 0.57325 0.919851 91.99％ 65536 0.50465 0.764752 76.48％ 262144 0.5563 0.881528 88.15％ Negative control 0.608733 1.000075 100.00％ Blank control 0.166375 — — Cell viability = [(As-Ab) / (Ac-Ab)] x 100%.

[0046] (As: absorbance of the experimental wells (culture medium containing cells, CCK-8, and test drugs), Ac: absorbance of the control wells (culture medium containing cells, CCK-8, and no test drugs), Ab: absorbance of the blank wells (culture medium without cells and test drugs, CCK-8)).

[0047] 5. Broiler α-interferon product acquisition ① Preparation of protective agent: weigh 50-80g of glucose and 4g of Tween-80, add water for injection and dissolve to 1L, sterilize at 115℃ for 15min, cool (4℃) and set aside; ② Mix the renatured recombinant chicken α-interferon stock solution and the protective agent in a mass volume ratio of 20:1, add sterile water to the total volume, stir well, and filter with a 0.22μm pore size sterilization filter membrane to obtain the finished product with a concentration of about 200ng.

[0048] Table 4 Protection of broiler α-interferon (+protectant) against avian influenza virus in chicken embryo fibroblasts Interferon dilution multiple Mean cell viability Cell viability Cell viability 1 0.167975 0.028764 2.88％ 4 0.19015 0.036823 3.68％ 16 0.5619 1.13635 113.64％ 64 0.5847 1.203786 120.38％ 256 0.550425 1.102411 110.24％ 1024 0.617067 1.299517 129.95％ 4096 0.550875 1.103741 110.37％ 16384 0.460975 0.837844 83.78％ 65536 0.49115 0.927093 92.71％ 262144 0.503375 0.963251 96.33％ Negative control 0.515775 0.999926 100.00％ Blank control 0.1777 — — Reference Figure 5 and Figure 6 According to the test results, a certain concentration of broiler α-interferon has a good protective effect on chicken embryo fibroblasts against H9 avian influenza virus. A higher concentration of broiler α-interferon has a destructive effect on chicken embryo fibroblasts, while a low concentration of broiler α-interferon has no protective effect on chicken embryo fibroblasts. The effective concentration of the finished product is maintained at 15.5ng-248.1ng / mL.

[0049] 2. Preparation of avian influenza antibodies 1. Preparation of chicken flu immunogens: The different branches of H9 avian influenza virus are H9.4.2.1, H9.4.2.2, H9.4.2.3, H9.4.2.4, H9.4.2.5 and H9.4.2.6. The specific operations are as follows: ① Preparation of oil phase: Take 94 parts of white oil for injection and 6 parts of Siben 80, mix them, add 2 parts of aluminum stearate, heat and stir until transparent, then sterilize under high pressure for use, which is the oil phase.

[0050] ② Preparation of aqueous phase: Take 96 parts of antigen and 4 parts of sterilized Tween 80, mix and shake thoroughly to completely dissolve the Tween 80, which is the aqueous phase.

[0051] ③ Emulsification: Prepare the immunogen in a ratio of 3:1 (V / V) of mineral oil adjuvant to inactivated virus solution. Take 3 parts of mineral oil adjuvant and place them in a high-speed shear instrument. While stirring at 15,000 r / min, quickly add 1 part of inactivated virus solution and stir for 6 minutes to fully emulsify the mixture. After emulsification, aseptically dispense into 250 ml sterile bottles, write the name, preparation time, filling amount, etc. on the outer wall of the bottle, and store at 2-8°C.

[0052] ④Immunogen test A. Properties: a. Appearance: Milky white uniform emulsion: Oil-in-water type. Take a clean pipette and draw a small amount of immunogen into cold water. Except for the first drop, it will not spread.

[0053] b. Stability: Pipette 10 ml of immunogen into a centrifuge tube and centrifuge at 3000 r / min for 15 min. The water phase precipitated at the bottom of the tube should be 0.1 ml and should not exceed 0.5 ml.

[0054] c. Viscosity: Tested in accordance with the appendix of the current Chinese Pharmacopoeia of Veterinary Medicine, it is 100cP and does not exceed 200cP.

[0055] B. Sterility test is carried out in accordance with the current Appendix of the Chinese Veterinary Pharmacopoeia. C. Safety test: 10 14-day-old SPF chickens were injected with 2.0 ml of immunogen into the leg muscle and observed for 14 days. No local or systemic adverse reactions caused by the injection of immunogen were found.

[0056] 2. Immunization of laying hens: Immunize laying hens to produce specific antibodies. Select chicks 14 to 21 days old for primary immunization, the vaccination site is subcutaneous in the neck, and the first immunization dose is 0.5mL; booster immunization is performed every 3 to 4 weeks, the dose is 1mL, and booster immunization is performed again before laying, the dose is 0.5mL.

[0057] 3. Egg acceptance and disinfection: Soak eggs in 75% alcohol for 15 minutes, remove them from the water, rinse them with running water to remove surface dirt, spray fumigate the eggs with 0.05%-0.1% glutaraldehyde for 30 minutes, and blow dry the eggs before use.

[0058] 4. Separation of egg yolk: Open the eggshell under sterile operation, remove the egg white, and pour the egg yolk into a sterilized container.

[0059] 5. Preparation of egg yolk antibody: Take 1 part of egg yolk and 2 parts of sterile physiological saline, place in a sterile mixing cylinder, homogenize at 1500 rpm for 2-3 minutes, filter and add 0.01% thimerosal and 1000 units / mL of penicillin and streptomycin, shake well and dispense into sterilized saline bottles, cover and seal with wax, freeze and store for later use. Sterility test: Take 0.5 ml of the prepared egg yolk solution and inoculate on blood agar slant and anaerobic broth culture medium respectively, culture at 37℃ for 24 hours, both show no growth.

[0060] 6. Safety test: Five healthy chicks aged one week were subcutaneously injected with 2 mL of the prepared egg yolk antibody per chick and observed for 10 days. All chicks were healthy and alive.

[0061] 7. Antibody titer determination: Take 2 mL of the prepared egg yolk solution, add 4 mL of chloroform and mix well, place at room temperature for 1 hour, centrifuge at 3000 rpm / min for 20 minutes, take the supernatant for agar diffusion test, and the antibody titer should be above 6 log2.

[0062] 8. In vivo neutralization test: 10 healthy chicks aged 7 days were randomly divided into 2 groups, 5 in each group. Each chick in the first group was subcutaneously injected with 1 mL of a mixture of strong toxin and high-immune egg yolk, 1 part of a strong toxin liver and spleen tissue homogenate plus 9 parts of high-immune egg yolk antibody, and then incubated at 37°C for 1 hour. After 10 days of observation, all chicks survived in good health. Each chick in the second group was subcutaneously inoculated with 1 ml of a 1:10 diluted strong toxin tissue. Within 10 days, 3 chicks died, and typical chicken cancer lesions were found in autopsy. The remaining 2 chicks had diarrhea, mental depression, and anorexia.

[0063] 3. Synergistic treatment experiment of α-interferon and avian influenza antibody in broiler chickens 1. Establishment of a broiler chicken model infected with avian influenza virus (1) Eight-week-old SPF white-feathered broilers were used as model animals, and epidemic strains of influenza virus were used, including different branches of H9 avian influenza virus, namely H9.4.2.1, H9.4.2.2, H9.4.2.3, H9.4.2.4, H9.4.2.5 and H9.4.2.6 strains, as the challenge experiment selection; (2) Virus preparation: The stored virus was diluted 10 times, and 9-day-old chicken embryos were used for injection of allantoic fluid for challenge, with a challenge dose of 0.2 mL, and incubated in an incubator.

[0064] (3) The challenge dose was 100 TCID50, and the challenge method was subcutaneous injection. After infection, normal feeding was performed and the clinical symptoms of white-feathered broilers were observed.

[0065] (4) After infection, chickens become depressed, with a sharp rise in body temperature (43°C to 44°C), loss of appetite or loss of weight, and mild to severe respiratory symptoms. Sick birds cough and sneeze, have hiccups and tears in the trachea, edema of the face, mucous nasal discharge, and in severe cases, breathing difficulties. The comb and wattles are purple or pale, the hairless skin is purple, and the feathers are ruffled.

[0066] (5) The above can be used as an infection model for protection experiments.

[0067] 2. Synergistic protective effects of α-interferon and avian influenza antibodies in broiler chickens The established influenza virus broiler model was divided into groups, with a total of 7 groups, each with 20 broilers. The influenza virus model was divided into 6 groups, Group 1 was a negative control group without any treatment; Group 2 was a broiler α-interferon treatment group, where sick broilers were injected once a day at a dose of 0.1 mL for 3 consecutive days; Group 3 was an avian influenza virus antibody treatment group, where sick broilers were injected once a day at a dose of 0.1 mL for 3 consecutive days; Group 4 was a broiler α-interferon and avian influenza antibody combined treatment group, where the dosage was half of that when used alone, mixed in a 1:1 ratio, and sick broilers were injected once a day at a dose of 0.1 mL. L, continuous treatment for 3 days; Group 5 is a combined treatment group of broiler α-interferon and avian influenza antibody, the dosage is half of that when used alone, mixed at a ratio of 1:2, and the sick broilers are injected once a day, with a dose of 0.1mL, for 3 consecutive days; Group 6 is a combined treatment group of broiler α-interferon and avian influenza antibody, the dosage is half of that when used alone, mixed at a ratio of 2:1, and the sick broilers are injected once a day, with a dose of 0.1mL, for 3 consecutive days; The blank control group is Group 7, which is a healthy broiler that was not challenged with the virus and was raised normally. After seven days, the indicators were observed.

[0068] The experimental results showed that all 20 chickens in the blank control group (Group 7) survived healthily without any disease symptoms; the symptoms of the experimental group 1 were more severe, with depression, a sharp rise in body temperature (43℃~44℃), loss of appetite or loss of weight, mild to severe respiratory symptoms, and sick birds coughing, sneezing, hiccups in the trachea and a lot of tears, facial edema, mucous nasal discharge, and severe breathing difficulties. The comb and wattle were purple or pale, the hairless skin was purple, and the feathers were loose and messy. The number of deaths was 16; Group 2 showed depression, fever, loss of appetite or loss of weight, mild to severe respiratory symptoms, and sick birds showed mild coughing, sneezing, facial edema, and mucous nasal discharge. The combs and wattles were purple or pale, the hairless skin was purple, the feathers were ruffled, and 8 birds died; Group 3 showed depression, fever, loss or disappearance of appetite, weight loss, and mild respiratory symptoms. The sick birds showed mild coughing and sneezing, facial edema, and mucous nasal discharge. The number of deaths was 6; Groups 4, 5, and 6 had very few short-term fevers, loss or disappearance of appetite, weight loss, and mild respiratory symptoms, and no deaths occurred.

[0069] It was observed from the experimental results that the therapeutic effects of antibodies and broiler α-interferon alone on various types of strains were significantly lower than the effect of using broiler α-interferon and antibodies in combination. The nonspecific therapeutic effect of broiler α-interferon increased the body's resistance to avian influenza virus, and combined with the specific therapeutic properties of antibodies, it showed a broad spectrum and effectiveness in treating various branches of avian influenza virus.

[0070] The experimental results show that the recovery rate of the diseased broilers treated by the method of the present invention is significantly higher than that of the control group using only a single drug (broiler α-interferon or avian influenza antibody). At the same time, no obvious side effects were found during the treatment process of the method of the present invention, proving that the method is safe and effective.

[0071] The above are all preferred embodiments of the present application, and the protection scope of the present application is not limited thereto. Therefore, any equivalent changes made according to the structure, shape, and principle of the present application should be included in the protection scope of the present application.

Claims

1. A broiler interferon-α, characterized in that: The nucleotide sequence of the broiler α-interferon gene is shown in SeqIDNO.

1.

2. A drug for preventing and treating avian influenza, characterized in that: It comprises broiler alpha-interferon with biological activity, and the nucleotide sequence of the broiler alpha-interferon gene is shown as SeqIDNO.

1.

3. A drug for preventing and treating avian influenza according to claim 2, characterized in that: Also includes avian influenza antibodies.

4. A method for preparing broiler interferon-α, characterized in that: The following steps are involved: Extract the genome from broiler chicken tissues or cells, and amplify the target gene fragment using the following primers for the broiler α-interferon gene: chi-a-P1:ATGGCTGGCCTGCAAG; chi-a-P2: CTAAGTGCGCGTGTTGCCTG; The amino acid of broiler interferon-α gene was optimized, the signal peptide sequence of the gene was removed, and primers with restriction sites were designed according to the optimized gene sequence and the vector multiple cloning site as follows: chi-a-P1-site1:GGAATTCCATATGGCCACCACCGCCTCCG; chi-a-P2-site2:ATAAGAATGCGGCCGCAGTGCGCGTGTTGCCTGTGA; A recombinant plasmid is formed, transformed into a host cell E. coli BL21 (DE3), and purified; the broiler α-interferon has a nucleotide sequence as shown in SEQ ID NO.

1.

5. The method for preparing broiler interferon-α according to claim 4, characterized in that: The following steps are also included: Prepare protective agent: weigh 50-80g of glucose and 3-5g of Tween-80, add water for injection to dissolve to 1L, sterilize at 115℃ for 15min, cool (4℃) and set aside; Mix broiler α-interferon with the protective agent, add sterile water and stir thoroughly.

6. A method for preparing a drug for preventing and treating avian influenza, characterized in that: The preparation of broiler α-interferon as claimed in claim 1 or 2 further comprises the following steps: Preparation of avian influenza antibodies: Preparation of H9 avian influenza virus immunogen: preparing oil phase and water phase, and preparing immunogen in a ratio of 3:1 (V / V) of mineral oil adjuvant and inactivated virus solution; Immunize laying hens to produce specific antibodies; Inspect and disinfect eggs, and separate the yolks; Preparation of egg yolk antibody: Take egg yolk and sterile saline, place in a sterile mixing tank, homogenize, filter, add thimerosal, penicillin and streptomycin, and shake well; Mixed with the broiler α-interferon.

7. The method for preparing a drug for preventing and treating avian influenza according to claim 6, characterized in that: The mixing ratio of the broiler α-interferon and the avian influenza antibody is 1:2-2:1.

Images