Bacillus natto for inhibiting porcine rotavirus as well as construction method and application of bacillus natto

Abstract

The invention discloses bacillus natto for inhibiting porcine rotavirus as well as a construction method and application of the bacillus natto, and belongs to the technical field of medicines and animal husbandry. According to the invention, a recombinant bacillus natto strain is constructed, pig intestine epithelial cells (IPEC-J2) are taken as a research object, and a negative control group, a PoRV infection group and a fermentation broth + PoRV infection group are respectively set according to whether PoRV or original bacillus natto fermentation broth and constructed bacillus natto fermentation broth (100 [mu] L) are used for treating the IPEC-J2 cells. By detecting the replication and proliferation conditions of PoRV in IPEC-J2 cells, it is found that the constructed bacillus natto can effectively inhibit replication of porcine rotavirus, and the bacillus natto has wide application in antiviral drug production and feed additives.

Description

Technical Field

[0001] The invention mainly relates to a bacillus natto capable of inhibiting porcine rotavirus and a construction method and application thereof, belonging to the technical field of medicine and animal husbandry. Background Art

[0002] Porcine rotavirus disease is an acute gastroenteritis infectious disease caused by porcine rotavirus (PoRV), with diarrhea, vomiting, anorexia, and dehydration as clinical symptoms. PoRV belongs to the genus Rotavirus of the family Reoviridae. It is a non-enveloped double-stranded RNA (dsRNA) virus containing 11 segments of dsRNA genome, encoding 6 structural proteins VP1-VP4, VP6, VP7 and 6 non-structural proteins NSP1-NSP6. Among them, NSP5 and VP6 are important components of virus invasion and replication. Porcine rotavirus is one of the main pathogens causing severe diarrhea in piglets worldwide, causing huge economic losses to the global pig industry. Porcine rotavirus infection has the characteristics of short incubation period, strong infectivity, wide epidemic range, and high morbidity. It is often mixed with other bacteria and viruses to aggravate the disease and increase the mortality rate of sick pigs.

[0003] Vaccines for preventing porcine rotavirus mainly include inactivated vaccines and attenuated vaccines. Inactivated vaccines have good safety, are easy to transport and store, but the immune effect cannot be guaranteed, and the injection dose is large and the cost is high; attenuated vaccines have a fast immune effect, but there is a risk of virulence reversion. However, there is currently no specific therapeutic drug for PoRV. To this end, the present invention provides a method that can effectively treat PoRV infection. The probiotics used reproduce quickly, have strong vitality, and are safe and non-toxic. The present invention provides a new research direction for studying porcine rotavirus, and at the same time provides a scientific basis for the production of antiviral drugs or feed additives. Summary of the invention

[0004] In view of the above-mentioned deficiencies of the prior art, the present invention provides a natto Bacillus subtilis for inhibiting porcine rotavirus and a construction method and application thereof, aiming to solve the technical problem in the prior art of lacking a natto Bacillus subtilis that can effectively act on rotavirus-infected porcine intestinal epithelial cells.

[0005] The first technical solution provided by the present invention is a recombinant Bacillus natto, wherein the recombinant Bacillus natto is based on the Bacillus natto with a deposit number of CCTCC CB 20081702 as a chassis strain, and a mutant of a DegU regulatory protein (degU) is overexpressed on the chassis strain, wherein the mutant is a leucine mutation at position 74 of the HTH region of the DegU regulatory protein parent.

[0006] In certain embodiments, the nucleotide sequence of the coding gene (degU gene) of the parent is shown in SEQ ID NO: 1, and the genebank ID of the degU gene is CP101933.1.

[0007] In certain embodiments, the mutant is a mutant in which the leucine at position 74 of the HTH region of the DegU regulatory protein parent is mutated to arginine.

[0008] Furthermore, the nucleotide sequence of the gene encoding the mutant is shown in SEQ ID NO:2.

[0009] The second technical solution provided by the present invention is a method for constructing a recombinant Bacillus natto, wherein the method is to overexpress a mutant having a DegU regulatory protein (degU) on a chassis strain, wherein the chassis strain is Bacillus natto with a deposit number of CCTCCCB 20081702, and the mutant is a mutation of the 74th leucine in the HTH region of the DegU regulatory protein parent to arginine.

[0010] In certain embodiments, the nucleotide sequence of the coding gene (degU gene) of the parent is shown in SEQ ID NO: 1, and the genebank ID of the degU gene is CP101933.1.

[0011] In certain embodiments, the nucleotide sequence of the gene encoding the mutant is shown in SEQ ID NO:2.

[0012] In certain embodiments, the method comprises the following steps: (1) using the total DNA of Bacillus natto as a template, amplifying the degU gene by PCR, and connecting it with the vector pHY-P43 to obtain the recombinant plasmid pHY-P43-degU;

[0013] (2) using the Dpn I method and the recombinant plasmid pHY-P43-degU of step (1) as a template to point mutate the degU gene to obtain the degU' gene;

[0014] (3) Using the p7c6 plasmid, BS00 genome, and the degU' gene from step (2) as templates, a three-segment fusion PCR method was used to clone the lox71-Cm containing the chloramphenicol resistance gene. r -lox66 box and degU' gene fragment were connected together to obtain the fusion fragment Cm r -degU';

[0015] (4) The fusion fragment Cm in step (3) r-degU' was transformed into natto Bacillus subtilis competent cells, and then the chloramphenicol resistance gene in the strain was knocked out through the Cre / lox recombination system to obtain recombinant Bacillus subtilis natto.

[0016] The third technical solution provided by the present invention is a product containing the recombinant Bacillus sp. described in the first technical solution.

[0017] In certain embodiments, the products include microbial preparations, compositions, and feed additives.

[0018] In certain embodiments, the amount of the recombinant Bacillus natto added to the product is not less than 1×10 6 CFU / mL or 1×10 6 CFU / g.

[0019] The fourth technical solution provided by the present invention is the use of the Bacillus natto described in the first technical solution, or the product described in the third technical solution, in the preparation of a drug for treating and / or alleviating porcine rotavirus infection.

[0020] The fifth technical solution provided by the present invention is a method for inhibiting rotavirus infection of porcine intestinal epithelial cells in vitro, wherein the method comprises using the Bacillus natto described in the first technical solution as a fermentation agent for fermentation, and contacting the obtained fermentation product with rotavirus-infected porcine intestinal epithelial cells.

[0021] The sixth technical solution provided by the present invention is the use of the Bacillus natto described in the first technical solution in the preparation of a product for inhibiting rotavirus infection of porcine intestinal epithelial cells.

[0022] In certain embodiments, the inhibition comprises at least one of the following effects:

[0023] (1) Reduce the expression of NSP5 gene in rotavirus-infected porcine intestinal epithelial cells;

[0024] (2) Reduce rotavirus titer;

[0025] (3) Reduce the expression of VP6 protein in rotavirus-infected porcine intestinal epithelial cells.

[0026] The seventh technical solution provided by the present invention is a mutant of a DegU regulatory protein, wherein the leucine at position 74 of the HTH region of the parent DegU regulatory protein is mutated to arginine, and the nucleotide sequence of the parent is as shown in SEQ ID NO:1.

[0027] The beneficial effects of the present invention are as follows:

[0028] The present invention constructs a recombinant Bacillus natto, takes porcine intestinal epithelial cells (IPEC-J2) as the research object, and sets a negative control group, a PoRV infection group, and a fermentation liquid + PoRV infection group according to whether the IPEC-J2 cells are treated with PoRV or the original Bacillus natto fermentation liquid and the constructed Bacillus natto fermentation liquid (100 μL). By detecting the replication and proliferation of PoRV in IPEC-J2 cells, it is found that the constructed Bacillus natto can effectively inhibit the replication of porcine rotavirus, and the present invention has a wide range of uses in the production of antiviral drugs and feed additives. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is a graph showing the effects of BS00, BS01, BS02 and BS03 fermentation broth on IPEC-J2 cell viability.

[0030] Figure 2 This graph shows the effect of adding BS00, BS01, BS02 and BS03 fermentation broth at different stages on the RNA copy number of PoRV after PoRV infected IPEC-J2 cells.

[0031] Figure 3 This graph shows the effect of adding BS00, BS01, BS02 and BS03 fermentation broth in the late and full stages on the viral titer after PoRV infection of IPEC-J2 cells.

[0032] Figure 4 This graph shows the effect of adding BS01, BS02 and BS03 fermentation broth in the late and full stages on the expression of VP6 protein after PoRV infection of IPEC-J2 cells. DETAILED DESCRIPTION

[0033] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0034] The following embodiments relate to the method:

[0035] 1. Virus infection and propagation: IPEC-J2 cells were cultured for 24-48 hours until they were confluent and adherent to the wall. An appropriate amount of PoRV dissolved in DMEM / F12 was taken and trypsin was added to a final concentration of 10 μg mL -1 , 37℃ metal bath for 30min to activate PoRV. Rinse the cells twice with 1×PBS buffer, discard the residual liquid, add virus-trypsin mixture, place at 37℃ and 5% CO2 for adsorption for 1h, shake the cell culture bottle every 20min to make the virus adsorb evenly. After adsorption, rinse the cells once with 1×PBS buffer, discard the residual liquid, add 1μg·mL -1Trypsin-free DMEM / F12 was used as the cell maintenance medium, and the cells were maintained at 37°C and 5% CO2 until more than 85% cytopathic effect (CPE) appeared. The infection method of Vero cells was the same as that of IPEC-J2 cells. The infected Vero cells were placed at -80°C and room temperature for three times of freezing and thawing, and then 5000r / min. -1 Centrifuge for 10 minutes, remove the cell pellet, and take the supernatant as the amplified virus.

[0036] 2. Virus genome copy number detection method: The virus genome copy number was detected by fluorescent quantitative PCR. According to the instructions of the total RNA extraction kit, the total RNA of the cells was extracted, and the concentration was unified after the RNA concentration was determined. 1 μg of total RNA was used as a template for reverse transcription into cDNA, and ddH2O was added to dilute the cDNA 5 times to prepare the qPCR system. The qPCR system is as follows:

[0037] 2×ChamQ SYBR qPCR Master Mix 5.0μL, 50×ROX Reference Dye I 0.2μL, upstream and downstream primers (10μmol·L -1 ) 0.2 μL each, cDNA 2.0 μL, ddH2O 2.4 μL, total 10 μL. The qPCR reaction procedure is as follows: 95℃ pre-denaturation for 30 s, 95℃ denaturation for 10 s, 60℃ annealing for 30 s, melting curve analysis after 40 cycles. GAPDH was used as the internal reference gene for normalization of the samples, and each sample was repeated 3 times. -ΔΔct The relative expression of the target gene was calculated by the primer sequence used in this experiment as shown in Table 1.

[0038] Table 1 Gene primer sequences

[0039]

[0040] NSP5. Nonstructural protein 5; GAPDH. Glyceraldehyde-3-phosphate dehydrogenase

[0041] 3. Virus titer detection method: The virus titer was determined by the half cell culture infection dose (TCID50) method. The virus was dissolved in DMEM / F12 and diluted 10 times in a row, from 10 -1 Dilute to 10 -10. The diluted viruses were inoculated into Vero cells in a 96-well plate, with one column of 8 wells for each dilution, and 100 μL was inoculated into each well. Two columns of uninoculated normal cells were set up as negative controls. The cytopathic effect (CPE) was observed 24 hours after virus inoculation, and the virus titer was calculated according to the Reed Muench method. The calculation method is as follows: virus titer (-lg TCID50 / mL) = (pathological rate above 50% - 50%) / (pathological rate above 50% - pathological rate below 50%) × dilution logarithm difference + dilution logarithm of pathological rate above 50%.

[0042] 4. Detection method of VP6 protein expression: Western blot was used to determine the target protein content. The denatured protein sample was concentrated and separated by SDS-PAGE gel electrophoresis. After the electrophoresis, wet transfer was performed to transfer the protein from the gel to the polyvinylidene fluoride (PVDF) membrane. After the transfer, the PVDF membrane was placed in a 5% skim milk powder solution and blocked on a shaker at room temperature for 2 hours. After the blocking, a membrane washing buffer (TBST) containing Tween-20 was added and the membrane was rinsed on a shaker for 3 to 5 times, each time for 5 minutes. After the rinsing, the corresponding protein primary antibody was added and incubated on a shaker at 4°C for 12 hours. After the incubation, the primary antibody was recovered, TBST was added, and the membrane was rinsed on a shaker for 3 to 5 times, each time for 5 minutes. After the rinsing, the corresponding secondary antibody was added and the membrane was incubated on a shaker at room temperature for 90 minutes. After the incubation, the secondary antibody was recovered, TBST was added, and the membrane was rinsed on a shaker for 3 to 5 times, each time for 5 minutes. After rinsing, enhanced chemiluminescent solution was added, and the PVDF membrane was developed and photographed using an ultrasensitive chemiluminescent gel imaging system. GAPDH was used as the internal reference antibody, and the results were analyzed using ImageJ software for relative grayscale values ​​and statistics. The antibody information used is shown in Table 2.

[0043] Table 2 Antibody information

[0044]

[0045] VP6. PoRV structural protein 6; GAPDH. Glyceraldehyde-3-phosphate dehydrogenase

[0046] The raw materials used in the embodiment:

[0047] 1. Bacillus natto BS00 is from China Type Culture Collection of Wuhan University, with the number CCTCC CB20081702.

[0048] 2. pHY-P43 plasmid, p7c6 plasmid, and pDG plasmid were from the Future Food Science Center, School of Bioengineering, Jiangnan University. For the construction process, please refer to the article (Yan, X., Yu, HJ, Hong, Q., Li, SP, 2008. Cre / lox system and PCR-based genome engineering in Bacilus subtilis. Appl Environ Microb. 74, 5556-5562).

[0049] 3. Porcine intestinal epithelial cells IPEC-J2 cells were obtained from Shanghai Binsui Biotechnology Co., Ltd.

[0050] 4. The composition of LB liquid culture medium is: peptone 10g / L, yeast extract 5g / L, NaCl 10g / L, pH 7.0.

[0051] 5. The composition of LB solid medium is: peptone 10g / L, yeast extract 5g / L, NaCl 10g / L, agar 10-15g / L, pH 7.0.

[0052] 6. The liquid fermentation medium consists of: glucose 10-30 g / L, peptone 10-30 g / L, yeast extract 10-30 g / L, sodium glutamate monohydrate 10-30 g / L, sodium chloride 5-15 g / L, potassium dihydrogen phosphate trihydrate 0.5-1.5 g / L, magnesium sulfate heptahydrate 0.5-1.5 g / L, pH 7.0-7.2.

[0053] Example 1

[0054] 1. Construction of recombinant Bacillus natto

[0055] Take Bacillus natto BS00 as the original strain and follow the steps below:

[0056] (1) Using the total DNA of Bacillus natto as a template, the degU gene was amplified by PCR, and the primers were P3-P4 as shown in SEQ ID No: 3-4.

[0057] P3: CGC GGATCC ATGACTAAAGTAAACATTGTTATTATCGAC(SEQ ID No:3)

[0058] P4: CC CCCGGG CTATTCATTTCTACCCAGCCATTTTTAATGG(SEQ ID No:4)

[0059] The underlined parts are the restriction sites of BamHI and XmaI respectively.

[0060] After the amplified product was purified, the PCR product and the vector pHY-P43 were double-digested with BamHI and XmaI, and the recovered products of the two were ligated with T4 ligase at 22°C for 4 hours to obtain the recombinant plasmid pHY-P43-degU.

[0061] (2) The Dpn I method was used to point mutate the leucine at position 74 in the HTH region of the DegU coding gene to arginine. The DegU sequences before and after the point mutation were as shown in SEQ ID No: 1-2, respectively.

[0062] The point mutation primers are P5-P6 (SEQ ID No: 5-6)

[0063] P5: CAGCTTGTTGAG CGA TACCCTGAATCTAAGG (SEQ ID No: 5)

[0064] P6: CCTTAGATTCAGGGTA TCG CTCAACAAGCTG (SEQ ID No: 6)

[0065] The underlined part represents the codon corresponding to the mutation of the 74th position of the mutant gene to arginine. The PCR amplification system is: 0.5μL of recombinant plasmid DNA, 5uL of 5× Primer star Buffer, 0.5μL of each primer, 2μL of dNTP, 0.25μL of Primer star, ddH2O to 25μL, PCR amplification conditions: denaturation at 95℃ for 1min, 18 cycles (95℃ for 40s, 50℃ for 15s, 66℃ for 390s), and 72℃ for 10min.

[0066] The PCR product was treated with Dpn I enzyme at 37°C for 3 h to remove the template DNA and obtain the degU point mutation fragment (degU' gene).

[0067] (3) Using the p7c6 plasmid, BS00 genome, and degU' gene as templates, primers P7-P12 (SEQ ID No: 7-12) in Table 3 were used to clone the lox71-Cm containing the chloramphenicol resistance gene by a three-segment fusion PCR method. r-lox66 cassette and the two-component regulatory factor degU point mutation fragment were connected together. The method is shown in the article (Yan, X., Yu, HJ, Hong, Q., Li, SP, 2008. Cre / lox system and PCR-based genome engineering in Bacilus subtilis. Appl Environ Microb. 74, 5556-5562) to obtain the fusion fragment Cm r -degU'.

[0068] (4) The fusion fragment Cm was transformed by Sipizizen method r -degU' was transformed into Bacillus subtilis natto 00 competent cells, and then the chloramphenicol resistance gene sandwiched between lox71 and lox66 sites in the strain was knocked out by transferring the pDG plasmid (containing the Cre / lox recombination system) (Yan, X., Yu, HJ, Hong, Q., Li, SP, 2008. Cre / lox systemand PCR-based genome engineering in Bacilus subtilis. Appl Environ Microb. 74, 5556-5562) to obtain the recombinant strain Bacilus subtilis 00Cm r -degU' and name it BS01.

[0069] Table 3 Amplification primers for three-segment fusion

[0070]

[0071] 2. Effects of fermentation products on PoRV infection of IPEC-J2 cells

[0072] 1. Preparation of fermentation broth of BS00 and BS01

[0073] The strain was activated on an LB solid culture medium plate, and the activated strain was inoculated into a 250 mL Erlenmeyer flask containing 50 mL LB liquid culture medium, and cultured at 37° C. and 210 r / min for 9 h. Subsequently, it was inoculated into a liquid fermentation medium at an inoculum size of 3%, and cultured at 37° C. and 210 r / min for 72 h to obtain an expansion culture solution.

[0074] The culture conditions of the 3L fermentation tank were as follows: the initial glucose concentration was 20 g / L, glucose was added to the culture medium at 3% inoculum to reach 20 g / L at 24, 48, and 60 h, 500 rpm, 40°C, and cultured for 120 h to obtain BS00 and BS01 fermentation liquids, respectively.

[0075] 2. Preparation of fermentation products of BS00 and BS01

[0076] The fermentation broth cultured in a 3L fermenter was centrifuged at 4 000r / min for 20 min and then separated. The supernatant was added with 4% activated carbon that had been dried and dehydrated at 105°C, heated and stirred at 40°C for 20 min to adsorb impurities and remove odors. The carbon residue was then removed by coarse filtration with gauze and cooled to room temperature. The supernatant was centrifuged at 4°C and 4 000r / min for 20 min, and then centrifuged at 4°C and 4 500r / min for 20 min to remove the remaining carbon residue. The supernatant was stored at 4°C for sedimentation overnight and then sterilized by 0.22μm filtration to obtain the fermentation products of BS00 and BS01.

[0077] 3. Effects of BS00 and BS01 fermentation products on IPEC-J2 cell viability

[0078] 1 × 10 4 IPEC-J2 cells were cultured at 37°C and 5% CO2 for 24 hours. 100 μL of sterile fermentation medium (control group), BS00 fermentation product and BS01 fermentation product were added to a 96-well plate, with 3 replicates for each culture medium and blank wells without treatment. The 96-well plate was cultured at 37°C and 5% CO2 for 24 hours. Subsequently, 10 μL of CCK-8 reagent was added to each well, incubated at 37°C and 5% CO2 for 1 to 4 hours, and the absorbance at 450 nm was measured using an enzyme reader. The results are as follows: Figure 1 As shown, compared with the untreated blank wells and the control group with only sterile fermentation medium added, the addition of 100 μL BS00 and BS01 fermentation products had no significant effect on cell viability (P>0.05).

[0079] 4. Effects of adding BS00 and BS01 fermentation products at different stages on PoRV infection of IPEC-J2 cells

[0080] IPEC-J2 cells were treated with BS00 and BS01 fermentation products at different time periods of PoRV (MOI = 0.1) infection. The grouping and treatment methods are as follows: 1) Negative control group (NC): no BS00 and BS01 fermentation products were added at each stage and no PoRV infection; 2) Positive control group (PoRV): only PoRV was inoculated, and no BS00 and BS01 fermentation products were added at each stage; 3) BS00 fermentation product group: BS00 fermentation products were added at each stage; 4) BS01 fermentation product: BS01 fermentation product was added at each stage; 5) Pre-infection stage (early stage): BS00 and BS01 fermentation products were added to pre-treat cells for 24 hours before PoRV infection, and PoRV was inoculated after rinsing with 1×PBS buffer, and maintained at 37°C and 5% CO2 for 24 hours; 6) Bacterial liquid and virus co-treatment stage (mid-term): BS00 and BS01 fermentation products were dissolved in virus culture medium and then infected with cells, adsorbed for 1 hour, rinsed with 1×PBS buffer, and placed at 37°C and 5% Maintained under CO2 conditions for 24h; 7) Post-infection maintenance stage (late stage): After PoRV infected cells, the cells were maintained at 37°C and 5% CO2 for 24h with a cell maintenance solution containing BS00 and BS01 fermentation products; 7) Full stage (full stage): Before infection, during the co-treatment of fermentation products and viruses, and after infection, the virus, cell culture medium, and maintenance solution all contained BS00 and BS01 fermentation products and were maintained at 37°C and 5% CO2 for 24h. Three replicates were performed in each group. The cytopathic effect of each group was observed, and cell RNA, protein samples, and viral supernatant were collected to detect the viral genome copy number, viral titer, and VP6 protein expression.

[0081] The results are as follows Figure 2-4 As shown, compared with the positive control group, the NSP5 gene expression was reduced from 10.30±0.51 to 9.21±0.49 and 8.11±0.44 ( Figure 2 ), the virus titer decreased from 5.22±0.14 to 4.62±0.03 and 4.34±0.01 ( Figure 3 ), the relative expression of VP6 protein decreased from 1.01±0.03 to 0.25±0.02 and 0.20±0.01 ( Figure 4 ).

[0082] Comparative Example 1

[0083] 1. Construction of recombinant Bacillus natto

[0084] Take Bacillus natto BS00 as the original strain and follow the steps below:

[0085] (1) Using the total DNA of Bacillus natto as a template, the degU gene was amplified by PCR, and the primers were P13-P14 as shown in SEQ ID No: 13-14.

[0086] P13: CGC GGATCC ATGACTAAAGTAAACATTGTTATTATCGAC(SEQ ID No:13)

[0087] P14: CC CCCGGG CTATTCATTTCTACCCAGCCATTTTTAATGG(SEQ ID No:14)

[0088] The underlined parts are the restriction sites of BamHI and XmaI respectively.

[0089] After the amplified product was purified, the PCR product and the vector pHY-P43 were double-digested with BamHI and XmaI, and the recovered products of the two were ligated with T4 ligase at 22°C for 4 hours to obtain the recombinant plasmid pHY-P43-degU.

[0090] (3) Using p7c6 plasmid, pHY-P 43 -degU plasmid and BS00 gene were used as templates, and primers P15-P20 (SEQ ID No: 15-20) in Table 4 were used to clone the lox71-Cm containing the chloramphenicol resistance gene by fusion PCR. r -lox66 box, P 43 The promoter and the two-component regulatory factor degU fragment were connected together. The method is described in the article (Yan, X., Yu, HJ, Hong, Q., Li, SP, 2008. Cre / lox system and PCR-based genome engineering in Bacilus subtilis. Appl Environ Microb. 74, 5556-5562) to obtain the fusion fragment P43-degU.

[0091] (4) The fusion fragment P was transformed by Sipizizen method. 43-degU was transformed into Bacillus subtilis natto BS00 competent cells, and then the chloramphenicol resistance gene sandwiched between lox71 and lox66 sites in the strain was knocked out by transferring into pDG plasmid (containing Cre / lox recombination system) (Yan, X., Yu, HJ, Hong, Q., Li, SP, 2008. Cre / lox systemand PCR-based genome engineering in Bacilus subtilis. Appl Environ Microb. 74, 5556-5562) to obtain the degU overexpression strain Bacilus subtilis 00P43-degU, which was named BS02.

[0092] Table 4 Amplification primers for three-segment fusion

[0093]

[0094] 2. Effects of fermentation products on PoRV infection of IPEC-J2 cells

[0095] 1. Preparation of fermentation broth of BS00 and BS02

[0096] The strain was activated on an LB solid culture medium plate, and the activated strain was inoculated into a 250 mL Erlenmeyer flask containing 50 mL LB liquid culture medium, and cultured at 37° C. and 210 r / min for 9 h. Subsequently, it was inoculated into a liquid fermentation medium at an inoculum size of 3%, and cultured at 37° C. and 210 r / min for 72 h to obtain an expansion culture solution.

[0097] The culture conditions of the 3L fermentation tank were as follows: the initial glucose concentration was 20 g / L, glucose was added to the culture medium at 3% inoculum to reach 20 g / L at 24, 48, and 60 h, 500 rpm, 40°C, and cultured for 120 h to obtain BS00 and BS02 fermentation broths, respectively.

[0098] 2. Preparation of fermentation products of BS00 and BS02

[0099] The fermentation broth cultured in a 3L fermenter was centrifuged at 4 000r / min for 20 min and then separated. The supernatant was added with 4% activated carbon that had been dried and dehydrated at 105°C, heated and stirred at 40°C for 20 min to adsorb impurities and remove odors. The carbon residue was then removed by coarse filtration with gauze and cooled to room temperature. The supernatant was centrifuged at 4°C and 4 000r / min for 20 min, and then centrifuged at 4°C and 4 500r / min for 20 min to remove the remaining carbon residue. The supernatant was stored at 4°C for sedimentation overnight and then sterilized by 0.22μm filtration to obtain the fermentation products of BS00 and BS02.

[0100] 3. Effects of BS00 and BS02 fermentation products on IPEC-J2 cell viability

[0101] 1 × 10 4 IPEC-J2 cells were cultured at 37°C and 5% CO2 for 24 hours. 100 μL of sterile fermentation medium (control group), BS00 fermentation product and BS02 fermentation product were added to a 96-well plate, with 3 replicates for each culture medium and blank wells without treatment. The 96-well plate was cultured at 37°C and 5% CO2 for 24 hours. Subsequently, 10 μL of CCK-8 reagent was added to each well, incubated at 37°C and 5% CO2 for 1 to 4 hours, and the absorbance at 450 nm was measured using an enzyme reader. The results are as follows: Figure 1 As shown, compared with the untreated blank wells and the control group with only sterile fermentation medium added, the addition of 100 μL BS00 and BS02 fermentation products had no significant effect on cell viability (P>0.05).

[0102] 4. Effects of adding BS00 and BS02 fermentation products at different stages on PoRV infection of IPEC-J2 cells

[0103] IPEC-J2 cells were treated with BS00 and BS02 fermentation products at different time periods of PoRV (MOI = 0.1) infection. The grouping and treatment methods are as follows: 1) Negative control group (NC): no BS00 and BS02 fermentation products were added at any stage and no PoRV infection; 2) Positive control group (PoRV): only PoRV was inoculated, and no BS00 and BS02 fermentation products were added at any stage; 3) BS00 fermentation product group: BS00 fermentation products were added at all stages; 4) BS02 fermentation products: BS02 fermentation products were added at all stages; 5) Pre-infection stage (early stage): BS00 and BS02 fermentation products were added to pre-treat cells for 24 hours before PoRV infection, and PoRV was inoculated after rinsing with 1×PBS buffer and placed at 37°C and 5% Maintained under CO2 conditions for 24h; 6) Bacterial solution and virus co-treatment stage (mid-term): BS00 and BS02 fermentation products were dissolved in virus culture medium and then infected cells, adsorbed for 1h, rinsed with 1×PBS buffer and maintained at 37°C and 5% CO2 for 24h; 7) Post-infection maintenance stage (late stage): After PoRV infected cells, the cells were maintained at 37°C and 5% CO2 for 24h with cell maintenance medium containing BS00 and BS02 fermentation products; 7) Full stage (full stage): Before infection, fermentation product and virus co-treatment and post-infection stages, the virus, cell culture medium and maintenance medium all contained BS00 and BS02 fermentation products, and were maintained at 37°C and 5% CO2 for 24h. Three replicates were performed in each group. The cytopathic effect of each group was observed, and cell RNA, protein samples and virus supernatant were collected to detect the viral genome copy number, virus titer and VP6 protein expression.

[0104] The results are as follows Figure 2-4 As shown, compared with the positive control group, the NSP5 gene expression was reduced from 10.30±0.51 to 9.21±0.49 and 8.11±0.44 ( Figure 2 ), the virus titer decreased from 5.22±0.14 to 4.76±0.03 and 4.69±0.08 ( Figure 3 ), the relative expression of VP6 protein decreased from 1.01±0.03 to 0.54±0.04 and 0.52±0.06 ( Figure 4 ).

[0105] Comparative Example 2

[0106] 1. Construction of recombinant Bacillus natto

[0107] Take Bacillus natto BS00 as the original strain and follow the steps below:

[0108] (1) Using the total DNA of Bacillus natto as a template, the degU gene was amplified by PCR, and the primers were P21-P22 as shown in SEQ ID No: 21-22.

[0109] P21: CGC GGATCC ATGACTAAAGTAAACATTGTTATTATCGAC(SEQ ID No:21)

[0110] P22: CC CCCGGG CTATTCATTTCTACCCAGCCATTTTTAATGG(SEQ ID No:22)

[0111] The underlined parts are the restriction sites of BamHI and XmaI respectively.

[0112] After the amplified product was purified, the PCR product and the vector pHY-P 43 The two products were digested with double enzymes and ligated with T4 ligase at 22°C for 4 h to obtain the recombinant plasmid pHY-P 43 -degU.

[0113] (2) The Dpn I method was used to point mutate the leucine at position 96 in the HTH region of the DegU coding gene to arginine. The DegU sequence after point mutation is shown in SEQ ID No: 23.

[0114] The point mutation primers are P24-P25 (SEQ ID No: 24-25)

[0115] P24:GTAACACATGCC CGA AAAACAGGTGCAAGA (SEQ ID No: 24)

[0116] P25:TCTTGCACCTGTTTT TCG GGCATGTGTTAC (SEQ ID No: 25)

[0117] The underlined part represents the codon corresponding to the mutation of the 96th position of the mutant gene to arginine. The PCR amplification system is: 0.5μL of recombinant plasmid DNA, 5uL of 5× Primer star Buffer, 0.5μL of each primer, 2μL of dNTP, 0.25μL of Primer star, ddH2O to 25μL, PCR amplification conditions: denaturation at 95℃ for 1min, 18 cycles (95℃ for 40s, 50℃ for 15s, 66℃ for 390s), and 72℃ for 10min.

[0118] The PCR product was treated with Dpn I enzyme at 37°C for 3 h to remove the template DNA and obtain the degU point mutation fragment (degU" gene).

[0119] (3) Using the p7c6 plasmid, BS00 genome, and degU" gene as templates, primers P5-P10 (SEQ ID No: 7-12) in Table 5 were used to clone the lox71-Cm containing the chloramphenicol resistance gene by a three-segment fusion PCR method. r -lox66 cassette and the two-component regulatory factor degU point mutation fragment were connected together. The method is shown in the article (Yan, X., Yu, HJ, Hong, Q., Li, SP, 2008. Cre / lox system and PCR-based genome engineering in Bacilus subtilis. Appl Environ Microb. 74, 5556-5562) to obtain the fusion fragment Cm r -degU".

[0120] (4) The fusion fragment Cm was transformed by Sipizizen method r -degU" was transformed into Bacillus subtilis natto 00 competent cells, and then the chloramphenicol resistance gene sandwiched between lox71 and lox66 sites in the strain was knocked out by transferring the pDG plasmid (containing the Cre / lox recombination system) (Yan, X., Yu, HJ, Hong, Q., Li, SP, 2008. Cre / lox system and PCR-based genome engineering in Bacilus subtilis. Appl Environ Microb. 74, 5556-5562) to obtain the recombinant strain Bacilus subtilis 00Cm r -degU", and named it BS03.

[0121] Table 5 Amplification primers for three-segment fusion

[0122]

[0123] 2. Effects of fermentation products on PoRV infection of IPEC-J2 cells

[0124] 1. Preparation of fermentation broth of BS00 and BS03

[0125] The strain was activated on an LB solid culture medium plate, and the activated strain was inoculated into a 250 mL Erlenmeyer flask containing 50 mL LB liquid culture medium, and cultured at 37° C. and 210 r / min for 9 h. Subsequently, it was inoculated into a liquid fermentation medium at an inoculum size of 3%, and cultured at 37° C. and 210 r / min for 72 h to obtain an expansion culture solution.

[0126] The culture conditions of the 3L fermentation tank were as follows: the initial glucose concentration was 20 g / L, glucose was added to the culture medium at 3% inoculum to reach 20 g / L at 24, 48, and 60 h, 500 rpm, 40°C, and cultured for 120 h to obtain BS00 and BS03 fermentation broths, respectively.

[0127] 2. Preparation of fermentation products of BS00 and BS03

[0128] The fermentation broth cultured in a 3L fermenter was centrifuged at 4 000r / min for 20 min and then separated. The supernatant was added with 4% activated carbon that had been dried and dehydrated at 105°C, heated and stirred at 40°C for 20 min to adsorb impurities and remove odors. Subsequently, the carbon residue was removed by coarse filtration with gauze and cooled to room temperature. The supernatant was centrifuged at 4°C and 4 000r / min for 20 min, and then centrifuged at 4°C and 4 500r / min for 20 min to remove the remaining carbon residue. The supernatant was stored at 4°C for sedimentation overnight and then sterilized by 0.22μm filtration to obtain the fermentation products of BS00 and BS03.

[0129] 3. Effects of BS00 and BS03 fermentation products on IPEC-J2 cell viability

[0130] 1 × 10 4 IPEC-J2 cells were cultured at 37°C and 5% CO2 for 24 hours. 100 μL of sterile fermentation medium (control group), BS00 fermentation product and BS03 fermentation product were added to a 96-well plate, with 3 replicates for each culture medium and blank wells without treatment. The 96-well plate was cultured at 37°C and 5% CO2 for 24 hours. Subsequently, 10 μL of CCK-8 reagent was added to each well, incubated at 37°C and 5% CO2 for 1 to 4 hours, and the absorbance at 450 nm was measured using an enzyme reader. The results are shown in Figure 2. Figure 1 As shown, compared with the untreated blank wells and the control group with only sterile fermentation medium added, the addition of 100 μL BS00 and BS03 fermentation products had no significant effect on cell viability (P>0.05).

[0131] 4. Effects of adding BS00 and BS03 fermentation products at different stages on PoRV infection of IPEC-J2 cells

[0132] IPEC-J2 cells were treated with BS00 and BS03 fermentation products at different time periods of PoRV (MOI = 0.1) infection. The grouping and treatment methods are as follows: 1) Negative control group (NC): no BS00 and BS03 fermentation products were added at any stage and no PoRV infection; 2) Positive control group (PoRV): only PoRV was inoculated, and no BS00 and BS03 fermentation products were added at any stage; 3) BS00 fermentation product group: BS00 fermentation products were added at all stages; 4) BS03 fermentation products: BS03 fermentation products were added at all stages; 5) Pre-infection stage (early stage): BS00 and BS03 fermentation products were added to pre-treat cells for 24 hours before PoRV infection, and PoRV was inoculated after rinsing with 1×PBS buffer, and placed at 37°C and 5% Maintained under CO2 conditions for 24h; 6) Bacterial solution and virus co-treatment stage (mid-term): BS00 and BS03 fermentation products were dissolved in virus culture medium and then infected cells, adsorbed for 1h, rinsed with 1×PBS buffer and maintained at 37°C and 5% CO2 for 24h; 7) Post-infection maintenance stage (late stage): After PoRV infected cells, the cells were maintained at 37°C and 5% CO2 for 24h with cell maintenance medium containing BS00 and BS03 fermentation products; 7) Full stage (full stage): Before infection, fermentation product and virus co-treatment and post-infection stages, the virus, cell culture medium and maintenance medium all contained BS00 and BS03 fermentation products, and were maintained at 37°C and 5% CO2 for 24h. Three replicates were performed in each group. The cytopathic effect of each group was observed, and cell RNA, protein samples and virus supernatant were collected to detect the viral genome copy number, virus titer and VP6 protein expression.

[0133] The results are as follows Figure 2-4 As shown, compared with the positive control group, the NSP5 gene expression was reduced from 10.30±0.51 to 9.94±0.49 and 9.79±0.49 ( Figure 2 ), the virus titer decreased from 5.22±0.14 to 4.61±0.06 and 4.52±0.1 ( Figure 3 ), the relative expression of VP6 protein decreased from 1.01±0.03 to 0.89±0.05 and 0.82±0.07 ( Figure 4 ).

[0134] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A recombinant Bacillus natto, characterized in that: The recombinant Bacillus natto is based on Bacillus natto BS00 with a deposit number of CCTCCCB 20081702 as a chassis strain, and a mutant of a DegU regulatory protein is overexpressed on the chassis strain, wherein the mutant is a leucine mutation at position 74 of the HTH region of the parent DegU regulatory protein.

2. The recombinant Bacillus natto according to claim 1, characterized in that: The nucleotide sequence of the encoding gene of the parent is shown in SEQ ID NO:

1.

3. The recombinant Bacillus natto according to claim 1, characterized in that The mutant is a mutant in which the leucine at position 74 in the HTH region of the DegU regulatory protein parent is mutated to arginine.

4. A method for constructing a recombinant Bacillus natto, characterized in that: The method is to overexpress a mutant with a DegU regulatory protein on a chassis strain, wherein the chassis strain is Bacillus natto BS00 with a preservation number of CCTCC CB 20081702, and the mutant is a mutation of the 74th leucine in the HTH region of the DegU regulatory protein parent to arginine.

5. The method according to claim 4, characterized in that The steps include: (1) Using the total DNA of Bacillus natto as a template, the degU gene was amplified by PCR and ligated with the vector pHY-P43 to obtain the recombinant plasmid pHY-P 43 -degU; (2) Using the Dpn I method, the recombinant plasmid pHY-P 43 -degU is used as a template for point mutation of degU gene to obtain degU' gene; (3) Using the p7c6 plasmid, the genome of Bacillus natto BS00, and the degU' gene of step (2) as templates, a three-segment fusion PCR method was used to clone the lox71-Cm containing the chloramphenicol resistance gene. r -lox66 box and degU' gene fragment were connected together to obtain the fusion fragment Cm r -degU'; (4) The fusion fragment Cm in step (3) r -degU' was transformed into the competent cells of Bacillus natto, the chloramphenicol resistance gene in the strain was knocked out, and the recombinant Bacillus natto was obtained.

6. A product, characterized in that Contains the recombinant Bacillus natto according to any one of claims 1 to 3.

7. The product according to claim 6, characterized in that The products include microbial preparations, compositions and feed additives.

8. The product according to claim 6, characterized in that The amount of the recombinant Bacillus natto added to the product is not less than 1×10 6 CFU / mL or 1×10 6 CFU / g.

9. Use of the Bacillus natto according to any one of claims 1 to 3, or the product according to any one of claims 6 to 8, in the preparation of a medicament for treating and / or alleviating porcine rotavirus infection.

10. A method for inhibiting rotavirus infection of porcine intestinal epithelial cells in vitro, characterized in that: The method comprises the following steps: using the Bacillus natto described in any one of claims 1 to 3 as a fermentation agent for fermentation, and contacting the obtained fermentation product with porcine intestinal epithelial cells infected with rotavirus.

11. Use of the Bacillus natto according to any one of claims 1 to 3 in the preparation of a product for inhibiting rotavirus infection of porcine intestinal epithelial cells.

12. The use according to claim 11, characterized in that: The inhibition includes at least one of the following effects: (1) Reduce the expression of NSP5 gene in rotavirus-infected porcine intestinal epithelial cells; (2) Reduce the titer of rotavirus; (3) Reduce the expression of VP6 protein in rotavirus-infected porcine intestinal epithelial cells.

13. A mutant of a DegU regulatory protein, characterized in that: The mutant is a mutation of the leucine at position 74 in the HTH region of the DegU regulatory protein parent to arginine, and the nucleotide sequence of the encoding gene of the parent is shown in SEQ ID NO:1.

Images