A Cas protein and its application in detection

Abstract

The present invention relates to the field of detection technology, and discloses a Cas protein and its application in detection, wherein the amino acid sequence of the Cas protein is shown in SEQ ID NO. 1. The Cas protein obtained in the present invention has high cleavage activity, thereby being able to more accurately detect the content of low-concentration targets.

Description

Technical Field

[0001] The present invention relates to the field of detection technology, and in particular to a Cas protein and an application thereof in detection. Background Art

[0002] The CRISPR-Cas system was originally derived from a natural immune mechanism in bacteria and archaea to resist the invasion of foreign genetic material, such as plasmids and bacteriophages. In recent years, the CRISPR-Cas system has attracted widespread attention in the field of biological sciences as a revolutionary gene editing technology. With its simplicity and efficiency, this technology provides a powerful tool for gene editing, gene regulation, and nucleic acid detection. The system uses Cas nucleases and crRNAs to guide the recognition and cutting of specific DNA sequences, and has extremely high target specificity.

[0003] As an emerging detection method, CRISPR-Cas detection technology has shown great application potential in the fields of virus detection, disease diagnosis, metal ion detection, fungal toxin detection, etc. Among them, the trans-cleavage activity detection based on Cas12a has attracted much attention due to its high sensitivity and specificity. However, the Cas12a variants currently used for CRISPR-Cas detection still face insufficient cleavage activity, which limits its promotion in practical applications. Therefore, it is necessary to discover or improve the existing Cas12a protein and find a new Cas12a protease with better cleavage activity and easier use. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a Cas protein and its application in detection. The Cas protein obtained in the present invention has high cleavage activity, so that the content of low-concentration target can be detected more accurately.

[0005] The present invention provides a Cas protein, the amino acid sequence of the Cas protein is shown in SEQ ID NO.1.

[0006] The present invention also provides the use of the Cas protein in detecting target molecules.

[0007] Furthermore, the target molecule includes one of nucleic acid, lead metal ion and mycotoxin.

[0008] Furthermore, the application includes: dispersing a solution of Cas protein, a solution of target nucleic acid, a solution of guide RNA (crRNA), a solution of nucleic acid probe, nuclease-free water and a ribonuclease inhibitor in a buffer, then adding the target molecule, incubating, and performing fluorescence intensity detection.

[0009] Furthermore, the sequence of the nucleic acid probe is TTAATT, the N-terminus of the nucleic acid probe is modified with a fluorescent group, and the C-terminus of the nucleic acid probe is modified with a quenching group.

[0010] Furthermore, the fluorescent group is 5'-FAM.

[0011] Furthermore, the quenching group is 3'-BHQ1.

[0012] Furthermore, the target nucleic acid has a fragment that can bind to the guide RNA.

[0013] Furthermore, the target nucleic acid has a fragment that specifically binds to the Cas protein.

[0014] Furthermore, when the target nucleic acid, Cas protein and guide RNA are combined, the Cas protein is activated and can cut the single-stranded DNA in the nucleic acid probe.

[0015] Furthermore, when the target molecule is a nucleic acid, the target nucleic acid and the target molecule are the same substance, and only the target molecule needs to be added.

[0016] Further, when performing the test, one of the schemes i to iii is selected:

[0017] Scheme i: When the target molecule is a nucleic acid, the sequence of the target nucleic acid is consistent with the nucleic acid sequence, and the sequence of the target nucleic acid is shown in SEQ ID NO.6; the sequence of the guide RNA is shown in SEQ ID NO.7;

[0018] Scheme ii: When the target molecule is a lead metal ion, the sequence of the target nucleic acid is shown in SEQ ID NO.2; the sequence of the guide RNA is shown in SEQ ID NO.3;

[0019] Scheme iii: When the target molecule is ochratoxin A of the fungal toxin, the sequence of the target nucleic acid is shown as SEQ ID NO.4; the sequence of the guide RNA is shown as SEQ ID NO.5.

[0020] Furthermore, by volume, the ratio of the solution of Cas protein, the solution of guide RNA, the solution of nucleic acid probe, nuclease-free water, buffer, the solution of target nucleic acid and the ribonuclease inhibitor is 2:2:1:22:2:1:1.

[0021] Furthermore, the molar concentration of the Cas protein solution is 20 nM.

[0022] Furthermore, the method for preparing the solution of the Cas protein is specifically as follows: dissolving and dispersing the Cas protein in nuclease-free water.

[0023] Furthermore, the molar concentration of the target nucleic acid solution is 125 nM.

[0024] Furthermore, the method for preparing the target nucleic acid solution is specifically: dissolving and dispersing the target nucleic acid in nuclease-free water.

[0025] Furthermore, the molar concentration of the guide RNA solution is 20 nM.

[0026] Furthermore, the method for preparing the guide RNA solution is specifically: dissolving and dispersing the guide RNA in nuclease-free water.

[0027] Furthermore, the molar concentration of the nucleic acid probe solution is 200 nM.

[0028] Furthermore, the method for preparing the guide RNA solution is specifically: dissolving and dispersing the guide RNA in nuclease-free water.

[0029] Furthermore, the concentration of the ribonuclease inhibitor is 40 U / μL.

[0030] Furthermore, the ribonuclease inhibitor in the present invention was purchased from Sangon Biotech (Shanghai) Co., Ltd., and the CAS number of the product is B600478.

[0031] Furthermore, the preparation method of the buffer solution is: 10mM Tris-HCl (tris(hydroxymethyl)aminomethane hydrochloride), 10mM magnesium chloride, 10mM sodium chloride, 100g / mL bovine serum albumin solution (BSA).

[0032] Furthermore, the method for preparing the bovine serum albumin solution is specifically to disperse the bovine serum albumin solution in deionized water.

[0033] Furthermore, the incubation temperature is 36° C.-38° C., and the incubation time is 14 min-16 min.

[0034] Furthermore, the fluorescence intensity detection is performed using an enzyme marker with an excitation wavelength of 480nm-500nm and an emission wavelength of 510nm-540nm.

[0035] Furthermore, the concentration of the lead metal ions is 0.025nM-5nM.

[0036] Furthermore, the concentration of the fungal toxin is 2.5 pg / mL-1000 pg / mL.

[0037] The embodiments of the present invention have the following technical effects:

[0038] 1. After the target molecule is added in the present invention, when the target nucleic acid, crRNA and Cas protein form a ternary complex, the cleavage activity of the Cas protein will be activated, and the fluorescent group on the nucleic acid probe will be cleaved by the Cas protein. The Cas protein obtained by the present invention has a high cleavage activity, so for targets with low content, the detection accuracy can be improved.

[0039] 2. The Cas protein obtained in the present invention has high cleavage activity and can be successfully used to detect nucleic acids, lead ion content and fungal toxins. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0041] Figure 1 This is a diagram of the expression results of the Cas protein provided in an embodiment of the present invention.

[0042] Figure 2 It is a comparison of the protein activity of the Cas protein provided in the embodiment of the present invention and the control group.

[0043] Figure 3 This is the standard curve of the Cas protein provided in the embodiment of the present invention for detecting lead ions.

[0044] Figure 4 This is a result diagram of the Cas protein provided in an embodiment of the present invention being used to detect lead ions of known concentration.

[0045] Figure 5 This is the standard curve of the Cas protein provided in the embodiment of the present invention for detecting ochratoxin A.

[0046] Figure 6 This is a result diagram of the use of the Cas protein provided in an embodiment of the present invention to detect known ochratoxin A. DETAILED DESCRIPTION

[0047] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention.

[0048] In a first aspect, some embodiments of the present invention provide a Cas protein, the amino acid sequence of the Cas protein is shown in SEQ ID NO.1.

[0049] In a second aspect, some embodiments of the present invention also provide the use of the Cas protein in detecting target molecules.

[0050] In some embodiments, the target molecule includes one of nucleic acid, lead metal ion, and fungal toxin.

[0051] In some embodiments, the application includes: dispersing a solution of Cas protein, a solution of target nucleic acid, a solution of guide RNA (crRNA), a solution of nucleic acid probe, nuclease-free water and a ribonuclease inhibitor in a buffer, then adding the target molecule, incubating, and detecting the fluorescence intensity.

[0052] In some embodiments, the sequence of the nucleic acid probe is TTAATT, the N-terminus of the nucleic acid probe is modified with a fluorescent group, and the C-terminus of the nucleic acid probe is modified with a quenching group.

[0053] In some embodiments, the fluorescent group is 5'-FAM.

[0054] In some embodiments, the quenching group is 3'-BHQ1.

[0055] In some embodiments, the target nucleic acid has a segment that can bind to the guide RNA.

[0056] In some embodiments, the target nucleic acid has a fragment that specifically binds to the Cas protein.

[0057] In some embodiments, when the target nucleic acid, Cas protein and guide RNA are combined, the Cas protein is activated and can cut the single-stranded DNA in the nucleic acid probe.

[0058] In some embodiments, when the target molecule is a nucleic acid, the target nucleic acid and the target molecule are the same substance, and only the target molecule needs to be added.

[0059] In some embodiments, when performing the detection, one of schemes i to iii is selected:

[0060] Scheme i: When the target molecule is a nucleic acid, the sequence of the target nucleic acid is consistent with the nucleic acid sequence, and the sequence of the target nucleic acid is shown in SEQ ID NO.6; the sequence of the guide RNA is shown in SEQ ID NO.7;

[0061] Scheme ii: When the target molecule is a lead metal ion, the sequence of the target nucleic acid is shown in SEQ ID NO.2; the sequence of the guide RNA is shown in SEQ ID NO.3;

[0062] Scheme iii: When the target molecule is ochratoxin A of the fungal toxin, the sequence of the target nucleic acid is shown as SEQ ID NO.4; the sequence of the guide RNA is shown as SEQ ID NO.5.

[0063] In some embodiments, the ratio of the solution of Cas protein, the solution of guide RNA, the solution of nucleic acid probe, nuclease-free water, buffer, target nucleic acid and ribonuclease inhibitor is 2:2:1:22:2:1:1 by volume.

[0064] In some embodiments, the molar concentration of the Cas protein solution is 20 nM.

[0065] In some embodiments, the method for preparing the solution of the Cas protein is specifically: dissolving and dispersing the Cas protein in nuclease-free water.

[0066] In some embodiments, the molar concentration of the target nucleic acid solution is 125 nM.

[0067] In some embodiments, the method for preparing the target nucleic acid solution is specifically: dissolving and dispersing the target nucleic acid in nuclease-free water.

[0068] In some embodiments, the molar concentration of the guide RNA solution is 20 nM.

[0069] In some embodiments, the method for preparing the guide RNA solution is specifically: dissolving and dispersing the guide RNA in nuclease-free water.

[0070] In some embodiments, the molar concentration of the nucleic acid probe solution is 200 nM.

[0071] In some embodiments, the method for preparing the guide RNA solution is specifically: dissolving and dispersing the guide RNA in nuclease-free water.

[0072] In some embodiments, the concentration of the ribonuclease inhibitor is 40 U / μL.

[0073] In some embodiments, the ribonuclease inhibitor in the present invention is purchased from Sangon Biotech (Shanghai) Co., Ltd., and the CAS number of the product is B600478.

[0074] In some embodiments, the buffer solution is prepared by: 10 mM Tris-HCl (tris(hydroxymethyl)aminomethane hydrochloride), 10 mM magnesium chloride, 10 mM sodium chloride, and 100 g / mL bovine serum albumin solution (BSA).

[0075] In some embodiments, the method for preparing the bovine serum albumin solution is specifically to disperse the bovine serum albumin solution in deionized water.

[0076] In some embodiments, the incubation temperature is 36° C.-38° C., and the incubation time is 14 min-16 min.

[0077] In some embodiments, the fluorescence intensity is detected using an enzyme reader with an excitation wavelength of 480nm-500nm and an emission wavelength of 510nm-540nm.

[0078] In some embodiments, the concentration of the lead metal ions is 0.025 nM-5 nM.

[0079] In some embodiments, the concentration of the fungal toxin is 2.5 pg / mL-1000 pg / mL.

[0080] The following is described in detail with reference to some specific embodiments:

[0081] Embodiment 1:

[0082] (1) Construction of Cas protein plasmid

[0083] Using LbCas12a as the seed sequence, bioinformatics analysis was performed in the metagenomic data, and Cas12a from the Butyrivibrio_Asp000431815 bacterium was discovered and named Cas protein.

[0084] The nucleotide sequence corresponding to the amino acid sequence of the synthetic Cas protein. The plasmid for synthesizing the Cas protein was synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the plasmid vector was pET-28a(+);

[0085] Amino acid sequence of Cas protein (SEQ ID NO.1):

[0086]

[0087] (2) Purification of Cas protein:

[0088] The Cas protein plasmid obtained in (1) was transformed into E. coli BL21 (DE3) competent cells, spread on E. coli culture medium (commercially available) (Kan+) and cultured overnight at 37°C. Then, a single clone was picked and inoculated into 100 mL of E. coli liquid culture medium (Kan+) and cultured at 37°C and 220 rpm with shaking until OD 600 =0.6, to obtain a Cas protein plasmid solution; add isopropylthiogalactoside (IPTG) to the Cas protein plasmid solution until the final concentration of isopropylthiogalactoside is 0.5 mmol / L, and induce for 20 hours at 16°C and 200 rpm to obtain an induced bacterial solution;

[0089] The induced bacterial solution was centrifuged, and the bacterial solution precipitate was collected. The bacteria were resuspended in 20 mL of buffer A (20 mM tris(hydroxymethyl)aminomethane hydrochloride, pH 8.0, 500 mM sodium chloride, 5% glycerol), and the resuspended bacterial solution was ultrasonically disrupted at 350 W power. After centrifugation for 1 h, the supernatant was taken for affinity purification, and the purified target protein was obtained after liquid exchange and concentration through a 10K ultrafiltration tube.

[0090] The purified protein was subjected to SDS-PAGE electrophoresis and Coomassie Brilliant Blue staining was used to observe the protein bands. The expression results of the Cas protein were as follows: Figure 1 As shown. Among them, lane 1 is a standard protein Marker, and lane 2 is the Cas protein of the present invention (i.e., BaCas12a), and the molecular weight of the Cas protein is about 130k Da.

[0091] Example 2: Identification of the cleavage activity of the Cas protein obtained in Example 1:

[0092] (1) Target molecule preparation:

[0093] The target molecule nucleic acid was designed and commissioned to be synthesized by Sangon Biotech (Shanghai) Co., Ltd. The target molecule (target nucleic acid) was obtained by PCR amplification at 37°C for 30 min. The sequence is shown in SEQ ID NO.6, and the target molecule is GGGGGCACGGGAGGTTGCATCGAGCGGTGG.

[0094] (2) Preparation of nucleic acid probes:

[0095] The structure of the nucleic acid probe is: the N-terminus is modified with a 5'-FAM group, the C-terminus is modified with a 3'-BHQ1 quenching group, and it was commissioned to Sangon Biotech (Shanghai) Co., Ltd. for synthesis. The sequence of the nucleic acid probe is: TTAATT.

[0096] (3) Preparation of guide RNA: Design a guide sequence according to the characteristics of the target nucleic acid in (1), as shown in SEQ ID NO.7:

[0097] The guide RNA sequence is UAAUUUCUACUAAGUGUAGAUAUGCAACCUCCCGUGCCCCC;

[0098] (3) Identification of cleavage activity:

[0099] The trans-cleavage activity of Cas protein on nucleic acid probe was detected with a 30 bp nucleic acid sequence (GGGGGCACGGGAGGTTGCATCGAGCGGTGG) as the target site. Specifically, 2 μL of 20 nM Cas protein solution was taken, and 2 μL of 20 nM guide RNA solution, 2 μL of buffer (10 mM tris(hydroxymethyl)aminomethane hydrochloride, 10 mM magnesium chloride, 10 mM sodium chloride, 100 g / mL bovine serum albumin), 1 μL of 200 nM nucleic acid probe solution, 1 μL of 125 nM target nucleic acid solution, 1 μL of ribonuclease inhibitor (concentration 40 U / μL) and 22 μL of nuclease-free water (ddHO) were added. H2O), and finally use ultrapure water to make up to 40 μL, with no Cas protein (i.e., the concentration of Cas protein is 0 nmol / L, expressed as NC) and LbCas12a protein (i.e., the concentration of LbCas12a protein (commercially available) is 200 nmol / L, expressed as LbCas12a) as controls, incubate at 37°C for 30 minutes, and observe the results under 488nm ultraviolet light. The test results are as follows Figure 2 shown.

[0100] The results showed that the Cas protein emitted strong fluorescence, and its fluorescence intensity was much greater than that of the control group (without Cas protein and LbCas12 protein), indicating that the Cas protein obtained in the present invention has better cutting activity than the LbCas12 protein in the prior art.

[0101] Example 3: Application of the Cas protein of Example 1 in detecting lead metal ions

[0102] (1) Preparation of target molecules

[0103] The lead ion-specific GR-5 DNA enzyme (as shown in SEQ ID NO.2) is used as the target nucleic acid.

[0104] The GR-5 DNA enzyme sequence is shown in SEQ ID NO.2:

[0105] ACAGACATCATCTCTGAAGTAGCGCCGCCGTATAGTGAGAAACTCACTATrAGGAAGAGATGATGTCTGTAGTT.

[0106] (2) Preparation of guide RNA:

[0107] According to the characteristics of the target nucleic acid in (1), a guide sequence is designed, as shown in SEQ ID NO.3:

[0108] UAAUUUCUACUAAGUGUAGAUAACUACAGACAUCAUCUCUUCC.

[0109] (3) Preparation of nucleic acid probes:

[0110] The structure of the nucleic acid probe is: the N-terminus is modified with a 5'-FAM group, the C-terminus is modified with a 3'-BHQ1 quenching group, and it was commissioned to Sangon Biotech (Shanghai) Co., Ltd. for synthesis. The sequence of the nucleic acid probe is: TTAATT.

[0111] (4) Application of lead metal ion detection:

[0112] Specifically: take 2 μL of 20nM Cas protein solution, add 2 μL of 20nM guide RNA, 2 μL of buffer (10mM tris(hydroxymethyl)aminomethane hydrochloride, 10mM magnesium chloride, 10mM sodium chloride, 100g / mL bovine serum albumin), 1 μL of 200nM nucleic acid probe, 1 μL of 125nM target nucleic acid, 1 μL of ribonuclease inhibitor (concentration 40U / μL) and 22 μL of nuclease-free water (dd H2O), and finally make up to 40 μL with ultrapure water. The solutions with standard molar concentrations of 0 nM, 0.02 nM, 0.1 nM, 0.5 nM, 1 nM, and 5 nM lead ion concentrations were tested respectively. After incubation at 37 °C for 30 min, the fluorescence intensity was recorded at an excitation wavelength of 485 nm and an emission wavelength of 530 nm to establish a standard curve of lead ion concentration and fluorescence intensity (such as Figure 3 As shown); it can be found that the standard curve is y=856.63x+280.85, R 2 =0.996, and the lead ion detection limit is calculated to be 0.025 nM. The method of the present invention is then used to detect a solution with a known lead ion concentration of 0.5 nM, and the detected fluorescence intensity is 709 a.u. (e.g. Figure 4 As shown), Figure 4The fluorescence intensity in the standard curve was taken. It was found that the sample with a known lead ion concentration of 0.5 nM was detected, and the final calculation found that its concentration was 0.49 nM. It can be seen that the cas protein obtained in the present invention has higher activity and can accurately detect solutions containing low concentrations of lead ions.

[0113] Example 4: Application of the Cas protein of Example 1 in detecting fungal toxins

[0114] (1) Target molecule preparation

[0115] Taking mycotoxin as the target molecule, a targeted aptamer DNA is designed and constructed as the target nucleic acid. Taking ochratoxin A (OTA) as an example, the sequence of the target nucleic acid is shown in SEQ ID NO.4:

[0116] 5'-TTTTTTATCGACCGATGCTCCATAG-3'.

[0117] (2) Preparation of guide RNA:

[0118] The guide RNA sequence is designed according to the characteristics of the target molecule, as shown in SEQ ID NO.5:

[0119] UAAUUUCUACUAAGUGUAGAUCUAUGGAGCAUCGGUCGAUAAAA.

[0120] (3) Preparation of nucleic acid probes:

[0121] The structure of the nucleic acid probe is: the N-terminus is modified with a 5'-FAM group, the C-terminus is modified with a 3'-BHQ1 quenching group, and it was commissioned to Sangon Biotech (Shanghai) Co., Ltd. for synthesis. The sequence of the nucleic acid probe is: TTAATT.

[0122] (4) Application of mycotoxin detection:

[0123] Take 2 μL of Cas protein solution with a molar concentration of 20 nM, add 2 μL of guide RNA with a molar concentration of 20 nM, 2 μL of buffer (10 mM tris(hydroxymethyl)aminomethane hydrochloride, 10 mM magnesium chloride, 10 mM sodium chloride, 100 g / mL bovine serum albumin), 1 μL of nucleic acid probe with a molar concentration of 200, 1 μL of target nucleic acid with a molar concentration of 125 nM, 1 μL of ribonuclease inhibitor (concentration of 40 U / μL) and 22 μL of nuclease-free water (ddHO). H2O), and finally use ultrapure water to make up to 40μL; detect OTA with standard concentrations of 0pg / mL, 2pg / mL, 10pg / mL, 50pg / mL, 250pg / mL, and 1000pg / mL, respectively. After incubation at 37℃ for 30min, record the fluorescence intensity at an excitation wavelength of 485nm and an emission wavelength of 530nm, and then fit a reasonable standard curve of the ratio of OTA concentration to fluorescence intensity (such as Figure 5 shown), in Figure 5 The standard curve is found to be y=3.6358x+314.79, R 2 =0.992, and the detection limit of OTA was calculated to be 2.5 pg / mL. The method of the present invention was then used to detect a solution with a known OTA concentration of 10 pg / mL, and the detected fluorescence intensity was 351 a.u. (e.g. Figure 6 As shown), Figure 6 The fluorescence intensity in the standard curve was brought into the standard curve. It was found that the concentration of the sample with a known OTA concentration of 10 pg / mL was finally calculated to be 9.95 pg / mL, which shows that the cas protein obtained in the present invention has higher activity.

[0124] It should be noted that the terms used in the present invention are only for describing specific embodiments, rather than limiting the scope of the present application. As shown in the present specification, unless the context clearly indicates an exception, the words "one", "a", "a kind of" and / or "the" do not specifically refer to the singular, but may also include the plural. The terms "include", "comprise" or any other variant thereof are intended to cover non-exclusive inclusion, so that the process, method or device including a series of elements includes not only those elements, but also includes other elements not explicitly listed, or also includes elements inherent to such process, method or device. In the absence of more restrictions, the elements defined by the sentence "include one..." do not exclude the presence of other identical elements in the process, method or device including the elements.

[0125] It should also be noted that the terms "center", "up", "down", "left", "right", "vertical", "horizontal", "inside", "outside", etc., indicating the orientation or positional relationship, are based on the orientation or positional relationship shown in the drawings, and are only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore cannot be understood as a limitation on the present invention. Unless otherwise clearly specified and limited, the terms "installed", "connected", "connected", etc. should be understood in a broad sense, for example, it can be a fixed connection, a detachable connection, or an integral connection; it can be a mechanical connection or an electrical connection; it can be a direct connection, or it can be an indirect connection through an intermediate medium, or it can be a connection between the two elements. For those of ordinary skill in the art, the specific meanings of the above terms in the present invention can be understood according to specific circumstances.

[0126] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the technical solutions of the embodiments of the present invention.

Claims

1. A Cas protein, characterized in that The amino acid sequence of the Cas protein is shown in SEQ ID NO.

1.

2. Use of the Cas protein according to claim 1 in detecting target molecules; the use is for non-disease diagnosis purposes and / or non-therapeutic purposes.

3. The use according to claim 2, characterized in that: The target molecule includes one of nucleic acid, lead metal ion and mycotoxin.

4. The use according to claim 3, characterized in that The application includes: dispersing a solution of Cas protein, a solution of target nucleic acid, a solution of guide RNA, a solution of nucleic acid probe, nuclease-free water and a ribonuclease inhibitor in a buffer, then adding a target molecule, incubating, and performing fluorescence intensity detection.

5. The use according to claim 4, characterized in that The sequence of the nucleic acid probe is TTAATT, the N-terminus of the nucleic acid probe is modified with a fluorescent group, and the C-terminus of the nucleic acid probe is modified with a quenching group; the fluorescent group is 5'-FAM; and the quenching group is 3'-BHQ1.

6. The use according to claim 4, characterized in that The target nucleic acid has a segment that can bind to the guide RNA; The target nucleic acid has a fragment that specifically binds to the Cas protein; When the target nucleic acid, Cas protein and guide RNA are combined, the Cas protein is activated and can cut the single-stranded DNA in the nucleic acid probe.

7. The use according to claim 4, characterized in that When performing the test, choose one of the options from plan i to plan iii: Scheme i: When the target molecule is a nucleic acid, the sequence of the target nucleic acid is consistent with the nucleic acid sequence, and the sequence of the target nucleic acid is shown as SEQ ID NO.6; the sequence of the guide RNA is shown as SEQ ID NO.7; Scheme ii: When the target molecule is a lead metal ion, the sequence of the target nucleic acid is shown in SEQ ID NO.2; the sequence of the guide RNA is shown in SEQ ID NO.3; Scheme iii: When the target molecule is ochratoxin A of the fungal toxin, the sequence of the target nucleic acid is shown as SEQ ID NO.4; the sequence of the guide RNA is shown as SEQ ID NO.

5.

8. The use according to claim 4, characterized in that The ratio of the solution of Cas protein, the solution of guide RNA, the solution of nucleic acid probe, nuclease-free water, buffer, the solution of target nucleic acid and ribonuclease inhibitor is 2:2:1:22:2:1:1 by volume; The molar concentration of the Cas protein solution is 20 nM; The molar concentration of the target nucleic acid solution is 125 nM; The molar concentration of the guide RNA solution is 20 nM; The molar concentration of the nucleic acid probe solution is 200 nM; The concentration of the ribonuclease inhibitor is 40 U / μL.

9. The use according to claim 4, characterized in that The incubation temperature is 36°C-38°C, and the incubation time is 14min-16min; The fluorescence intensity is detected by using an enzyme marker, with an excitation wavelength of 480nm-500nm and an emission wavelength of 510nm-540nm.

10. The use according to claim 3, characterized in that The concentration of the lead metal ions is 0.025nM-5nM; The concentration of the fungal toxin is 2.5 pg / mL-1000 pg / mL.

Images