High-activity RNA cleavage type deoxyribozyme resistant to organic solvent and application of RNA cleavage type deoxyribozyme

Abstract

The invention provides an organic-solvent-resistant high-activity RNA cleavage type deoxyribozyme and application thereof.Firstly, a library for screening the organic-solvent-resistant high-activity RNA cleavage type deoxyribozyme is established on the basis of organic-solvent-resistant DNAzyme (E3), and TJ11-3 with high catalytic activity is found; the catalytic activity is more than 4 times of that of the publically reported fastest RNA cutting type DNAzyme10-23 (kcat-10min <-1 >); the invention further constructs a multi-component DNAzyme triggered by a target sequence, and the multi-component DNAzyme can be used for detecting a pathogen nucleic acid target sequence and has relatively high safety and convenience.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to the invention of an organic solvent-resistant high-activity RNA-cleaving DNAzyme and its application. Background Art

[0002] DNAzyme is a type of artificially synthesized nucleic acid molecule with catalytic function, which is mainly isolated from random DNA libraries through in vitro selection or directed evolution technology. 2+ ions as cofactors were obtained from random DNA library screening. 2+ Catalyzes ester exchange reactions in the presence of. The DNAzymes that have been discovered can catalyze a variety of reaction types including DNA or RNA cleavage, phosphorylation or alkylation. Compared with proteases, DNAzymes have the advantages of small molecular weight, chemical synthesis, high stability, low immunogenicity, and the ability to catalyze reactions to produce signals under the stimulation of target substances (such as metal ions, small molecules or macromolecules, etc.). Therefore, they have broad application prospects in the fields of biosensing, biotherapy, logical operations, and molecular devices. Among them, DNAzymes with RNA cleavage activity are the most noteworthy. Currently, portable heavy metal ion detectors based on DNAzymes have been successfully commercialized.

[0003] RNA-cleaving DNAzyme consists of a substrate chain and an enzyme chain. In addition to the complete RNA sequence, a single RNA base is often embedded in a DNA sequence as a substrate to screen DNAzyme. The cleavage site is usually the phosphodiester bond connecting RNA and DNA. The enzyme chain is a DNA sequence, generally including a catalytic region and a substrate binding arm region. DNAzyme can catalyze substrate cleavage in two modes: cis or trans. The former is that the DNAzyme and the substrate are connected into one molecule, and the latter is that the DNAzyme and the substrate are two independent molecules. Currently, most of the publicly reported DNAzymes work under normal physiological conditions or near normal physiological conditions, which limits their application under abnormal conditions, such as in a mixed solvent system of organic solvent-water (this condition is of great significance in the field of detection of molecules that are poorly soluble in water). In addition, the RNA-cleaving DNAzyme with the fastest catalytic reaction speed publicly reported internationally is 10-23 screened by the Joyce research group in 1997, and the catalytic conversion constant k in aqueous solution is 10-23. cat Maximum 10 minutes -1So far, there is no new DNAzyme that breaks through this reaction speed. Therefore, it is necessary to develop DNAzymes that can be applied to a variety of abnormal conditions and have higher catalytic speeds to expand their application range and improve their practical application value. Summary of the invention

[0004] The purpose of the present invention is to provide a screening library design strategy for obtaining highly active RNA-cleaving DNAzymes, highly active RNA-cleaving DNAzymes resistant to organic solvents and their potential applications, so as to solve or improve the problems in the prior art of low DNAzyme activity and difficulty in application under conditions containing organic solvents.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] In a first aspect, the present invention provides an organic solvent-resistant RNA-cleaving DNAzyme screening or design library, wherein the library is constructed based on DNAzyme E3P (5'-AAGTGGTGCCCGGAAAGGGTGACTC A-substrate recognition region-3'), comprising: introducing several bases at the 3' and 5' ends of E3P as PCR primer recognition regions, respectively, and introducing a random sequence in the variable region, wherein the variable region of E3P refers to the 20th to 26th bases from the 5' end of E3.

[0007] In a specific embodiment of the present invention, the length of the random sequence is 10-60 bases, preferably 20-50 bases, more preferably 30-50 bases, and most preferably 40 bases.

[0008] In a specific embodiment of the present invention, the length of the primer recognition region is 16-19 bases.

[0009] In a specific embodiment of the present invention, ATACAG is introduced at the 5' end, and GTCCGA is introduced at the 3' end, and these, together with a portion of the original sequence of E3, serve as the primer recognition region.

[0010] In a specific embodiment of the present invention, the 5' end PCR primer is: 5'-ATACAGAAGTGGTG CCC-3'; the 3' end PCR primer is: 5'TCGGACCTATGAACTGATG-3'.

[0011] In a specific embodiment of the present invention, the introduction refers to the insertion of a random sequence into the variable region, or the replacement of part or all of the bases in the variable region.

[0012] Preferably, the substrate recognition region is any DNA sequence longer than 10 nt; preferably 5'-TCAGTTCA TAG-3'.

[0013] In a specific embodiment of the present invention, the DNAzyme screening or design library comprises a nucleic acid molecule with the following sequence: 5'-ATACAGAAGTGGTGCCCGGAAAGGGTG-N40-ACTCATCAG TTCATAGGTCCGA-3', wherein N40 is 40 random bases.

[0014] The second aspect of the present invention provides an organic solvent-resistant DNAzyme for cutting RNA, the DNAzyme comprising the following structure: a 5' partial primer recognition region comprising 6 nt from 5' to 3', a stem-loop region at positions 1-19 of E3P, a variable region at positions 20-26 of E3P, and a directed evolution region (a sequence obtained from a random library by in vitro screening) optionally located in the variable region of E3P, a substrate recognition region, and an optional 3' partial primer recognition region;

[0015] The 3' end of the enzyme may optionally contain 1-6, preferably 1-3 base truncations, and the bases at positions 1 and 2 of the 5' end may contain any mutations, wherein the positions are determined relative to E3P;

[0016] The directed evolution region is:

[0017] TJ11-3 directed evolution region: GCGCTGTGTAACGTGCATGGTGAGTTACGCGCGA GATAGTAC (SEQ ID No. 61);

[0018] The sequence of the E3P is:

[0019] E3P (5'-AAGTGGTGCCCGGAAAGG GTGA CTCA-substrate recognition region-3').

[0020] In a specific embodiment of the present invention, the meaning of "located in" is to insert into the variable region, or to replace part or all of the bases in the variable region.

[0021] In a specific embodiment of the present invention, the directed evolution region replaces positions 21-23 (5'→3') of E3P.

[0022] In a specific embodiment of the present invention, the 5' primer recognition region is ATACAG.

[0023] In a specific embodiment of the present invention, the substrate recognition region is any DNA sequence longer than 10 nt, preferably 5'-TCAGTTCATAG-3'.

[0024] In a specific embodiment of the present invention, the 5' end of the DNAzyme is connected to the substrate to form a cis structure.

[0025] The third aspect of the present invention provides an organic solvent-resistant RNA-cleaving DNAzyme, comprising:

[0026] 1) Enzymes in the following table:

[0027]

[0028] 2) introducing ATACAG at the 5' end of the enzyme in 1);

[0029] 3) introducing an optional mutation at position 1 or 2, 21, 22, 23, 24 or 25 of the 5' end of the enzyme in 1), wherein the positions are referenced to E3P;

[0030] 4) introducing a base sequence of any length, preferably 6 nt, at the 3' end of the enzyme in 1), preferably GTCCGA;

[0031] 5) Introducing a truncation of no more than 6 nt, preferably no more than 3 nt, at the 3' end of the enzyme in 1), that is, the substrate recognition region may be less than 10 nt;

[0032] 6) The 5' end of the enzyme of 2-5) above is connected to the substrate to form a cis structure;

[0033] 7) Any combination of the above 2-6).

[0034] In a specific embodiment of the present invention, the DNAzyme is:

[0035]

[0036] Among them: A mutates to B (B=C / G / T), G mutates to H (H=A / T / C), T mutates to V (V=A / G / C), and C mutates to D (D=G / A / T).

[0037] The fourth aspect of the present invention provides the use of the above-mentioned DNAzyme in substrate cleavage reaction.

[0038] In a specific embodiment of the present invention, the cutting is performed in a solution containing an organic solvent. Preferably, the organic solvent is selected from methanol, ethanol, acetone, acetonitrile, dimethyl sulfoxide, and dimethylformamide.

[0039] In a specific embodiment of the present invention, the cleavage is carried out in the presence of a divalent metal cation, preferably Mg 2+ or Mn 2+ ;

[0040] Preferably, the cleavage produces fluorescence;

[0041] Preferably, the cutting is used for analytical detection, especially analytical detection of biological samples;

[0042] Preferably, the cleavage is used for analysis and detection of nucleic acids such as DNA or RNA;

[0043] Preferably, the cleavage is used to amplify the analytical detection signal.

[0044] In a specific embodiment of the present invention, the substrate cleaved by the DNAzyme is:

[0045]

[0046] Note: F in the middle of the sequence represents the middle base dT modified with 6-FAM fluorescence, rA is the RNA base A, Q in the middle of the sequence is the middle dT modified with the quenching group Dabcyl; F at the 5' end is the 6-FAM modification of the 5' end of the DNA sequence.

[0047] A fifth aspect of the present invention provides a multi-component DNAzyme activated by a target sequence nucleic acid, wherein the multi-component DNAzyme comprises the following parts:

[0048] A) L part: the 5' end fragment cleaved from the appropriate site by the DNAzyme described in the second or third aspect of the present invention, and the target sequence recognition fragment L is connected at the 3' end;

[0049] B) R part, which is a 3' end fragment cleaved from a suitable site by the DNAzyme according to the second aspect or the third aspect of the present invention, and is connected to the target sequence recognition fragment R at the 5' end;

[0050] wherein the target recognition fragment R and the target recognition fragment L recognize a continuous portion of the target sequence or two portions with an interval of less than 10 nt, preferably less than 5 nt, more preferably less than 2 nt, and the recognition is complementary base pairing;

[0051] The target is single-stranded DNA, double-stranded DNA, single-stranded RNA or double-stranded RNA;

[0052] Preferably, the suitable site is located between the substrate recognition region and the catalytic region;

[0053] The preferred suitable site is the C70 (5'→3') site with TJ11-3 as the reference sequence, and the cleavage is that C70 is located in the R part or the L part.

[0054] In a specific embodiment of the present invention, the target sequence is a conserved sequence (30 nt) target sequence of different gene segments (A, E, N, F) of the SARS-Cov-2 virus, and the two corresponding parts of the target sequence and the corresponding multi-component DNAzyme are:

[0055]

[0056] The sixth aspect of the present invention provides the use of the multi-component DNAzyme in the preparation of nucleic acid detection kits such as DNA and RNA detection or pathogen detection or disease diagnosis kits.

[0057] The seventh aspect of the present invention provides a signal amplifier comprising the above-mentioned DNAzyme enzyme and a coupled biological recognition element such as an antibody and an aptamer;

[0058] Preferably, the signal amplifier is used in an organic solvent system.

[0059] The eighth aspect of the present invention provides a kit comprising the above-mentioned DNAzyme enzyme, or the above-mentioned multi-component DNAzyme, or the above-mentioned signal amplifier.

[0060] Beneficial effects:

[0061] 1. The construction of the screening library proposed in the present invention is helpful to obtain highly active RNA-cleaving DNAzyme.

[0062] 2. The organic solvent-resistant DNAzyme (TJ11-3) of the present invention has a high activity in catalyzing RNA substrate cleavage in the presence of various organic solvents, wherein the catalytic conversion rate in methanol buffer is as high as 44.68 min -1 , which is 4 times that of the internationally recognized RNA-cleaving DNAzyme (10-23) with the fastest catalytic efficiency of the same type.

[0063] 3. The organic solvent-resistant DNAzyme (TJ11-3) of the present invention has high catalytic activity and the ability to catalyze multiple conversions of substrates, and can be used as a signal output or signal amplification tool for sensors in an organic solvent environment.

[0064] 4. The organic solvent-resistant DNAzyme (TJ11-3) of the present invention can be designed into a nucleic acid sequence-activated multi-component DNAzyme (MNAzyme), which can produce highly selective and highly sensitive responses to DNA and RNA sequences, and may be used for rapid detection of different forms of nucleic acid sequences, such as microRNA or RNA viruses (such as the new coronavirus and influenza virus). BRIEF DESCRIPTION OF THE DRAWINGS

[0065] The drawings in the specification, which constitute a part of this application, are used to provide a further understanding of the present invention. The illustrative embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0066] in:

[0067] Figure 1 A flowchart of RNA-cleaving DNAzyme screening provided by one embodiment of the present invention;

[0068] Figure 2 A schematic diagram of the principle of a substrate reaction catalyzed by an RNA-cleaving DNAzyme according to an embodiment of the present invention;

[0069] Figure 3 is the reaction rate of the substrate catalyzed by RNA-cleaving DNAzyme TJ11-3 under single-turnover conditions;

[0070] Figure 4 The requirement of organic solvent for TJ11-3 DNAzyme-catalyzed substrate cleavage reaction;

[0071] Figure 5 The requirement of divalent metal ions for TJ11-3 DNAzyme-catalyzed substrate reaction;

[0072] Figure 6 is the catalytic activity of TJ11-3 DNAzyme at different pH;

[0073] Figure 7 is the catalytic reaction rate of TJ11-3 DNAzyme under multi-transition conditions;

[0074] Figure 8 Schematic diagram of the design principle of MNAzymes activated by nucleic acid sequences;

[0075] Fig. 9 Designing the MNAzyme site for TJ11-3;

[0076] Fig.10 To optimize the concentration ratio of MNAzyme and FRQ30;

[0077] Fig.11 is the detection limit of the MNAzyme for the target sequence;

[0078] Fig.12 The specific result diagram of MNAzyme and its corresponding target DNA;

[0079] Fig.13 Results of MNAzyme activation for single-stranded / double-stranded DNA targets;

[0080] Fig.14 Results of MNAzyme activation for RNA targets;

[0081] Fig.15 Secondary structure diagram of E3 and substrate (A: catalytic activity of E3 variants; B: catalytic activity retention of different substrate variants; C: catalytic activity retention of E3 mutants; D: secondary structure of E3 and substrate);

[0082] Fig.16Secondary structure diagram of TJ11-3 and substrate (A: catalytic kinetic curves of TJ11-3 and its variants; B: secondary structure of TJ11-3 and substrate).

[0083] Fig.17 : Comparison of the secondary structures of E3, TJ11-3 and substrate. DETAILED DESCRIPTION

[0084] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. All other embodiments obtained based on the embodiments of the present invention belong to the protection scope of the present invention.

[0085] The present invention will be described in detail below in conjunction with embodiments. It should be noted that the embodiments and features in the embodiments of the present invention can be combined with each other without conflict.

[0086] Unless otherwise specified, the technical means used in the embodiments and experimental examples of the present invention are conventional means well known to those skilled in the art, and the materials and reagents used can be obtained from commercial sources. The nucleotide sequences in the present invention are screened and optimized by the inventors through a large number of experiments, and then sequenced, and then the candidate sequences are synthesized by chemical methods.

[0087] The present invention aims to solve the existing problems and provides a method for designing a screening library for screening out highly active RNA-cleaving DNAzymes. The screening library design includes the following steps:

[0088] (1) Using the DMSO-dependent RNA-cleaving deoxyribozyme (E3) currently obtained by our team as the backbone, 6 deoxynucleotides were introduced into the 5' and 3' ends of E3, and 40 random sequences were introduced into the variable region to construct a random library.

[0089] (2) designing upstream and downstream primers to construct a random library;

[0090] (3) Under the action of DNA ligase, the 5'-end phosphorylated random library and the substrate with a fluorescent group, a quenching group and an rA cleavage site are connected to construct a screening library.

[0091] 1. Example 1

[0092] Library design and other sequences for screening highly active RNA-cleaving DNAzymes resistant to organic solvents include:

[0093] (1) DNAzyme resistant to organic solvents (E3): AAGTGGTGCCCGGAAAGG GTGACTCATCA GTTCATAG (SEQ ID No. 1)

[0094] (2) Library containing random bases:

[0095] ATACAGAAGTGGTGCCCGGAAAGGGTG-N40-ACTCATCAGTTCATAGGTCCGA (SEQ ID No. 2);

[0096] (3) RNA substrate (QRF30 (SEQ ID No. 3)):

[0097] CTATGAACTGACQ / rA / FGACCTCACTACCAAG (where: Q represents the dT in the middle of the sequence modified by the quenching group Dabcyl; rA represents the RNA base A; F represents the dT in the middle of the sequence modified by the fluorescent group 6-FAM.)

[0098] (4) Forward primer FP: ATACAGAAGTGGTGCCC (SEQ ID No. 4);

[0099] (5) Reverse primer RP1: TCGGACCTATGAACTGATG (SEQ ID No. 5);

[0100] (6) Reverse primer RP2: A 20 / iSp9 / TCGGACCTATGAACTGATG(SEQ ID No.6);

[0101] (7)padlock:GCACCACTTCTGTATCTTGGTAGTGAGGTC (SEQ ID No. 7).

[0102] The screening process includes: (1) Construction of screening library: connecting the random library to the substrate (first phosphorylating the 5' end of the random library under the action of phosphorylation kinase (PNK), and then connecting the random library to the substrate under the action of T4 DNA ligase and padlock chain) to construct a screening library; (2) Positive screening: The screening library is in a methanol-water buffer solution (containing Mg 2+ NH 4 + , pH = 7.5) for a certain period of time; (3) PCR amplification: PCR1 amplification is performed using the product obtained from the positive screening as a template, and PCR2 is performed using PCR1 as a template; (4) Preparation of single strands: Using PCR2 upstream and downstream primers of different lengths, the positive strand is recovered by dPAGE; the prepared single strand is connected to the substrate to construct a screening library, and the above steps are repeated. Figure 1 ;

[0103] The above screening process was repeated for multiple rounds. In order to improve the activity of RNA-cleaving DNAzyme, the screening conditions were gradually adjusted during the repeated screening process, including gradually reducing the amount of the screening library, reducing the incubation time, etc., and finally an enriched library was obtained;

[0104] Through high-throughput sequencing analysis, we obtained more than 50,000 original DNA sequences. According to the percentage from high to low, those with high percentage were selected as candidate sequences to analyze catalytic activity, among which TJ11-3 with higher catalytic activity was found.

[0105] 2. Example 2

[0106] The purpose of Example 2 is to analyze the catalytic activity of the TJ11-3 sequence under single-turnover conditions. The catalytic activity of the candidate sequence was determined in the form of a trans-cleavage reaction in which the DNAzyme and the substrate are independent of each other, and the apparent rate constant k obs Indicates the level of catalytic activity (see the schematic diagram of the RNA-cleaving DNAzyme principle Figure 2 ). The specific steps are as follows:

[0107] (1) Under single conversion conditions (the concentration of the enzyme is much greater than that of the substrate, for example, 10 times that of the substrate), TJ11-3 and QRF30 are heated and denatured at 90°C for 1 minute, cooled to room temperature, and then added to a methanol-water buffer to start the reaction;

[0108] (2) Take a certain volume of the reaction solution at different time periods and add EDTA to terminate the reaction;

[0109] (3) Separating the cleavage products by dPAGE and analyzing the substrate cleavage rate using image analysis software;

[0110] (4) Through kinetic testing, the yield of the candidate sequence cleaving the substrate at different reaction time points can be obtained. Then, the experimental data obtained are fitted according to the one-phase exponential equation using GraphPad Prism 8 software. The results are shown in Figure 3 shown.

[0111] Y=Y 0 +(Y m -Y 0 )×(1-e -kt )

[0112] Y is the substrate cleavage rate of DNAzyme at a specific reaction time, Y 0 is the background cut rate (at t = 0), Y m is the maximum substrate cleavage rate, and k is the resulting apparent rate constant k obs

[0113] Depend on Figure 3It can be seen that the candidate sequence TJ11-3 completely cuts the substrate in 5 seconds, k obs More than 30 minutes -1 Since the activity of TJ11-3 under single conversion conditions was too high, exceeding the time limit of manual testing, it was difficult to accurately determine its specific value manually, so multiple conversions were used next (the concentration of the substrate was in excess of the enzyme, for example, the substrate was 100 times that of the enzyme). This also shows that the present invention has screened a highly active RNA-cleaving DNAzyme that tolerates organic solvents.

[0114] The sequences used in Example 2 are shown in the table below:

[0115]

[0116] Note: rA represents RNA base A; Q represents Dabcyl-modified dT; F represents 6-FAM-modified dT.

[0117] 3. Example 3:

[0118] The purpose of Example 3 is to evaluate the tolerance of TJ11-3 to organic solvents and optimize the experimental conditions. The specific steps are as follows:

[0119] (1) Under multiple conversion conditions, TJ11-3 and substrate (QRF30) were heated at 90°C for 1 minute, cooled to room temperature, and then added to an organic solvent (methanol, ethanol, acetone, acetonitrile, dimethyl sulfoxide, dimethylformamide)-water buffer for 10 minutes. A blank control without organic solvent was used; the results are shown in Figure 4 .

[0120] (2) Under multiple conversion conditions, TJ11-3 and substrate (QRF30) were denatured by heating at 90°C for 1 min, cooled to room temperature, and then added to methanol-water buffer containing different divalent metal cations (Mg 2+ , Mn 2+ 、Zn 2+ 、Co 2+ , Ca 2+ , Ba 2 + , Hg 2+ , Cu 2+ ) for 10 minutes, without divalent ions as a control; the results are shown in Figure 5 .

[0121] (3) Under multiple conversion conditions, TJ11-3 and substrate (QRF30) were heated at 90°C for 1 min, cooled to room temperature, and then added to methanol-water buffers with different pH values ​​for 10 min. The pH range was set to 4.50-5.50 (NaOAc / HAc), 5.50-6.78 (MES), 6.78-7.50 (HEPES), and 7.50-9.00 (Tris-HCl); the results are shown in Figure 6 .

[0122] (4) Add EDTA to terminate the reaction after 10 minutes;

[0123] (5) Separate the cleavage products by dPAGE and analyze the cleavage rate of the substrate using image analysis software.

[0124] Depend on Figure 4 It can be seen that when TJ11-3 does not contain organic solvents, the cleavage is zero within 10 minutes; within a certain range of organic solvents, TJ11-3 has high activity, but no cleavage occurs beyond the range; among several common organic solvents, TJ11-3 has the highest activity in methanol-water buffer;

[0125] Depend on Figure 5 It can be seen that there is Mg in the buffer 2+ , Mn 2+ When several divalent ions were present, TJ11-3 had catalytic activity, but when there were no divalent ions, it had no catalytic activity, indicating that TJ11-3 was highly dependent on divalent metal cations (such as Mg 2+ ).

[0126] Depend on Figure 6 It can be seen that when the buffer solution of TJ11-3 is 4.50-5.06, the cleavage rate is zero, and when the pH value is 5.19-5.79, the cleavage rate increases, tends to be stable at 5.79-8.00, and has a downward trend after 8.49.

[0127] The TJ11-3 screened by the present invention relies on divalent metal cations and organic solvents, tolerates a variety of organic solvents, and has high catalytic activity within the pH range of 5.79-9.00.

[0128] 4. Example 4:

[0129] The purpose of Example 4 is to determine the catalytic activity of TJ11-3 in methanol-water buffer. Under multi-transition conditions, the concentration of TJ11-3 was fixed (2.5 nM), the concentration of the substrate was changed (50-750 nM), and the initial velocity at each concentration was used to fit k cat (k cat represents the catalytic conversion constant, which is used to evaluate the catalytic ability), the specific steps are as follows;

[0130] (1) Under multiple conversion, TJ11-3 and different concentrations of substrate were heated at 90°C for 1 min, cooled to room temperature, and then added to methanol-water buffer for reaction;

[0131] (2) At different time periods, a certain volume of reaction solution (EDTA) is taken to terminate the reaction;

[0132] (3) Separate the products by dPAGE, and then use image analysis software (such as ImageJ) to analyze the cleavage rate of the substrate. Take the first 10% cleavage rate of each substrate and plot it against the corresponding reaction time to obtain the initial velocity, which is the initial velocity corresponding to TJ11-3 under the substrate concentration condition;

[0133] (4) Through kinetic testing, the initial velocity of catalytic substrate cleavage of TJ11-3 at different substrate concentrations can be obtained, and then the formula can be used:

[0134]

[0135] V 0 is the initial rate of TJ11-3 cleavage of a certain substrate concentration under multiple conversion (nM·min -1 ); S is the concentration of substrate (nM); K m is the Michaelis constant; V max (nM·min -1 ) is the maximum rate of TJ11-3 cleavage of substrate under multiple turnover.

[0136] (5)V max The ratio of the concentration of TJ11-3 is k cat The results of the measurement are as follows Figure 7 .

[0137] Depend on Figure 7 It can be seen that TJ11-3 cleaves the optimal substrate 5'FRQ30 V in methanol buffer. max 111.7nM·min -1 , catalytic constant k cat 44.68min -1 , is the fastest RNA-cleaving DNAzyme 10-23 (k cat ~10min -1 The following substrates were tested (catalytic conversion rate k cat All longer than 10 minutes -1 ):

[0138]

[0139] In summary, the present invention screened out an RNA-cleaving DNAzyme with high activity and tolerance to a variety of organic solvents, and its catalytic efficiency reached the international leading level.

[0140] This indicates that TJ11-3 has high reactivity and the ability to catalyze multiple conversions of substrates. It has the basic properties of protein enzymes and can be used in applications similar to protein enzymes, such as signal output or amplification. (Under optimal conditions, when the substrate to enzyme concentration ratio is 1:100, within 1 minute, one molecule of enzyme can cut the substrate 13 times, which is equivalent to 13 times amplification.)

[0141] 5. Example 5

[0142] Example 5 aims to construct an engineered DNAzyme that can achieve signal conversion and output under organic solvent conditions, such as converting the specific recognition of nucleic acid targets into an enzyme-catalyzed substrate cleavage reaction and outputting the reaction signal for highly selective nucleic acid sequence analysis. TJ11-3 can be designed as a target sequence-triggered multi-component DNAzyme (MNAzyme). The design principle of MNAzyme is shown in Figure 8 , the specific steps are as follows:

[0143] (1) Select appropriate sites to "split" TJ11-3 into two nucleic acid sequences, and introduce complementary chains of the nucleic acid sequences to be identified to capture or identify the target nucleic acid sequences, see Fig. 9 ; When the target sequence (T-SC-A) is absent, the MNAzyme (TJ11-3-AR, TJ11-3-AL) is inactive; when the target sequence is present, the MNAzyme is activated, cutting FRQ30 to release a signal;

[0144] (2) Optimizing the concentration ratio of MNAzyme to FRQ30 (see Fig.10 ), when the target concentration is constant, the concentration ratio of MNAzyme to substrate is the optimal when the cleavage rate is the highest;

[0145] (3) After optimizing the cleavage design site and the concentration ratio of MNAzyme to substrate, the detection limit of MNAzyme for the target nucleic acid sequence was evaluated. MNAzyme, FRQ30, and target sequences of different concentrations (50-5000 pM) were denatured at 90°C for 1 minute, reacted in methanol-water buffer for 1 hour, and then EDTA was added to terminate the reaction. The curve of target sequence concentration and cleavage rate was obtained, and a linear fit was performed to calculate the detection limit under this condition (see Fig.11 ).

[0146] (5) In the above steps, dPAGE was used to separate the cleavage products, and image analysis software was used to calculate the cleavage rate of the substrate.

[0147] Fig. 9In the experiment, the C70 position of TJ11-3 was “cleaved” and designed into an MNAzyme. When the target sequence was not present, the MNAzyme had no cleavage activity. When the target sequence was present, the MNAzyme was activated and cleaved FRQ30 to release the signal.

[0148] Fig.10 In the experiment, when the ratio of MNAzyme to substrate was 1:25, the response signal to 500pM target sequence was the highest;

[0149] Fig.11 In the experiment, under optimized conditions, the detection limit of MNAzyme for the target sequence T-SC-A was 167 pM.

[0150] In summary, TJ11-3 can be designed as a target sequence-activated multicomponent DNAzyme.

[0151] The sequence used in Example 5 is:

[0152]

[0153] 6. Example 6

[0154] The purpose of Example 6 is to verify the specificity of MNAzyme's response to nucleic acid sequences. The conservative sequence (30nt) target sequences of different gene fragments (A, E, N, F) of SARS-Cov-2 virus were selected and named T-SC-A, T-SC-E, T-SC-N, and T-SC-F respectively; different target sequences activated the corresponding MNAzymes, which were named M-SC-F, M-SC-N, and M-SC-E respectively. The specific steps are as follows:

[0155] (1) Cleavage TJ11-3 at C70, introduce bases (15 nt) complementary to the target sequence at both ends, and construct different MNAzymes;

[0156] (2) When the ratio of MNAzyme to substrate was 1:25, the MNAzyme, target sequence or interference sequence, and FRQ30 were heated at 90°C for 1 min, cooled to room temperature, and then reacted in methanol-water buffer for 1 h;

[0157] (3) Separate the cleavage products by dPAGE and calculate the substrate cleavage rate using image analysis software. Fig.12 .

[0158] Depend on Fig.12 It can be seen that only the MNAzyme corresponding to the target has a substrate cleavage reaction, and the interfering sequence cannot activate the MNAzyme. Therefore, the MNAzyme developed with TJ11-3 has high selectivity and sensitivity in response to nucleic acid sequences.

[0159] The sequence used in Example 6 is:

[0160]

[0161] 7. Example 7

[0162] The purpose of Example 7 is to verify the ability of double-stranded DNA to activate MNAzyme. DNA often exists as double strands in biological genomes. In order to explore whether MNAzyme can respond to double-stranded DNA targets, the complementary sequence of T-SC-A was synthesized to see whether T-SC-A and the complementary sequence of T-SC-A can jointly activate MNAzyme.

[0163] The specific steps are as follows:

[0164] (1) No target or single-stranded target was added as the control group; an equal amount of double-stranded target was used as the experimental group;

[0165] (2) The control group and the experimental group were heated with FRQ30 at 90 °C for 1 min and reacted in methanol-water buffer for 1 h;

[0166] (3) Separate the cleavage products by dPAGE and calculate the substrate cleavage rate using image analysis software. Fig.13 .

[0167] Depend on Fig.13 It can be seen that MNAzyme can be activated by single-stranded targets and double-stranded DNA targets, indicating that the MNAzyme designed based on TJ11-3 can be used to detect double-stranded DNA.

[0168] 8. Example 8

[0169] The purpose of Example 8 is to verify whether the RNA target sequence can activate MNAzyme. Given that SARS-Cov-2 is an RNA virus, in order to explore the application value of MNAzyme in RNA virus detection, an RNA version of the T-SC-A sequence was synthesized. The specific steps are as follows:

[0170] (1) No target was added as control group 1;

[0171] (2) Randomly generated RNA single strands were used as control group 2;

[0172] (3) T-SC-A of DNA chain was used as control group 3;

[0173] (4) Using randomly generated single-stranded DNA as control group 4;

[0174] (5) T-SC-A of RNA chain was used as the experimental group;

[0175] (6) The control group and experimental group were denatured with FRQ30 at 90°C for 1 min and reacted in methanol-water buffer for 1 h;

[0176] (7) Separate the cleavage products by dPAGE and calculate the substrate cleavage rate using image analysis software. Fig.14 .

[0177] Depend on Fig.14 It can be seen that MNAzyme has a specific response to single-stranded RNA. In the absence of target and the addition of random RNA sequences, MNAzyme was not found to cleave the substrate. Only in the presence of target RNA did MNAzyme cleave the substrate.

[0178] In summary, the MNAzyme designed based on TJ11-3 has a high response to single-stranded RNA. Therefore, when used to detect RNA viruses, it is possible to directly detect RNA in samples inactivated by organic solvents without the need to reverse transcribe RNA into cDNA, which will shorten the detection time while improving the safety and convenience of viral nucleic acid detection.

[0179] 9. Example 9

[0180] In this example, we explored the possible mechanism of action of E3 and TJ11-3 with the target and designed random sequence screening to obtain the effects of each part of TJ11-3 using E3 as the skeleton. The specific steps are as follows;

[0181] (1) Delete 3 or 6 bases at the 3' end of E3 and name them E3-1 and E3-2 respectively. Under single transformation, E3, E3-1 and E3-2 were reacted in methanol-water buffer for a certain time. The results are shown in Fig.15 A;

[0182] (2) The bases in the substrate FRQ30 were deleted from the 3' end and named FRQ28, FRQ 26, FRQ24, FRQ22, FRQ20, FRQ17, and FRQ15. Under single transformation, E3 was reacted with the above substrates in DMSO-water buffer for 24 hours. The results are shown in Fig.15 B;

[0183] (3) The first 26 bases of E3 were mutated, for example, A mutated to B (B = C / G / T), G mutated to H (H = A / T / C), T mutated to V (V = A / G / C), and C mutated to D (D = G / A / T). The mutants were reacted with FRQ30 in methanol-water buffer for 1 or 24 hours, and E3 was used as a positive control. The results are shown in Fig.15 C;

[0184] (4) Six bases were added to the 5' end of E3 (ATACAG), and the protein was named E3-A. These six bases were deleted from the 5' end of TJ11-3 (ATACAG), and the protein was named TJ11-3-A. Six bases were added to the 3' end of TJ11-3 (GTCCGA), and the protein was named TJ11-3FL. E3-A, TJ11-3-A and FRQ30 were reacted in methanol-water buffer for a certain period of time. The results are shown in Table 1. Fig.15 A.

[0185] Depend on Fig.15 A shows that deleting the 3'-end base of E3 reduces the reaction rate, indicating that reducing the number of base pairings between DNAzyme and substrate is not conducive to DNAzyme-catalyzed substrate cleavage;

[0186] Depend on Fig.15 B shows that when the number of bases of the substrate is reduced to 17, the rate of E3 catalyzing the substrate remains almost unchanged, indicating that deleting the 13 bases at the 3-end of the substrate does not affect the catalytic activity of E3, and also indicating that E3 catalyzes the substrate FRQ30 with only one binding arm to play a catalytic role;

[0187] Depend on Fig.15 C shows that the stem-loop structure in E3 has a great influence on the catalytic performance.

[0188] From the above experiments, we can see that the secondary structure of E3 catalytic FRQ30 contains a binding arm and a stem-loop domain, so the secondary structure is roughly Fig.15 As shown in D;

[0189] Depend on Fig.16 A shows that for TJ11-3 and TJ11-3FL, the cleavage reaction reaches a plateau within 5 seconds, and the catalytic rates of TJ11-3 and TJ11-3FL are almost the same, indicating that GTCCGA is dispensable;

[0190] Depend on Fig.16 B shows that when 6 bases are added to the 5' end of E3, the catalytic activity is 10 times that of E3; when these 6 bases are deleted from the 5' end of TJ11-3 (TJ11-3-A), the catalytic activity is close to that of E3;

[0191] like Fig.15 , 16As shown in the figure, the substrate recognition regions of E3 and TJ11-3 are consistent and both are located on one side. The stem-loop structure has a great influence on the catalytic performance. In addition, the 6 bases added to the 5' end of E3 (used as the primer recognition region for screening the library) have a great influence on the activity, which can increase the catalytic rate by 10 times. How to affect the catalytic activity is currently under study. A 40-nt random sequence was inserted into the variable region of E3, and the TJ11-3 obtained after screening had a greatly improved catalytic activity, which was 15,000 times faster than that of E3. In addition, the effect of the 40-nt sequence in TJ11-3 is highly dependent on the 6-nt sequence added to its 5' end. If the 6-nt sequence here is removed, the catalytic activity is close to that of E3.

[0192] The sequence used in Example 9 is:

[0193]

[0194]

[0195] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A DNAzyme screening or design library for cutting RNA that is resistant to organic solvents, the library is constructed based on DNAzyme E3P (5'-AAGTGGTGCCCGGAAAGGGTGACTCA-substrate recognition region-3'), comprising: Several bases were introduced at the 3' and 5' ends of E3P, respectively, and used together with a part of the original sequence of E3P as the PCR primer recognition region, and a random sequence was introduced into the variable region, where the variable region of E3P refers to the 20th to 26th bases from the 5' end of E3P; Preferably, the length of the random sequence is 10-60 bases, preferably 20-50 bases, more preferably 30-50 bases, and most preferably 40 bases; Preferably, the length of the primer recognition region is 16-19 bases respectively; Preferably, ATACAG is introduced at the 5' end and GTCCGA is introduced at the 3' end, together with a part of the original sequence of E3 as the primer recognition region; Preferably, the 5' end PCR primer is: 5'-ATACAGAAGTGGTG CCC-3'; the 3' end PCR primer is: 5'TCGGACCTATGAACTGATG-3'; Preferably, the introduction refers to the insertion of a random sequence into the variable region, or the replacement of part or all of the bases in the variable region; Preferably, the substrate recognition region is any DNA sequence greater than 10 nt; preferably 5'-TCAGTTCA TAG-3'; Preferably, the DNAzyme screening or design library comprises nucleic acid molecules with the following sequence: 5'-ATACAGAAGTGGTGCCCGGAAAGGGTG-N40-ACTCATCAGTTCATAGGTCCGA-3', wherein N40 is 40 random bases.

2. An organic solvent-resistant DNAzyme for cutting RNA, the DNAzyme comprising the following structure: from 5' to 3', it comprises in sequence a 5' primer recognition region, a stem-loop region at positions 1-19 of E3P, a variable region at positions 20-26 of E3P, and an optional directed evolution region located in the E3P variable region (a sequence obtained from a random library by in vitro screening), a substrate recognition region, and an optional 3' primer recognition region; The 3' end of the enzyme may also optionally contain 1-6, preferably 1-3 base truncations, and the bases at positions 1 and 2 of the 5' end may contain any mutations, wherein the positions are determined relative to E3P; The directed evolution region is: TJ11-3 directed evolution region: GCGCTGTGTAACGTGCATGGTGAGTTACGCGCGA GATAGTAC; The sequence of the E3P is: E3P (5′-AAGTGGTGCCCGGAAAGG GTGA CTCA-substrate recognition region-3′); Preferably, the directed evolution region replaces positions 21-23 (5'→3') of E3P; Preferably, the length of the 3' or 5' primer recognition region is 6 nt; further preferably, the 5' primer recognition region is ATACAG; Preferably, the substrate recognition region is any DNA sequence greater than 10 nt, preferably 5'-TCAGTTCA TAG-3'; Preferably, the 5' end of the DNAzyme is connected to the substrate to form a cis structure.

3. RNA-cleaving DNAzymes resistant to organic solvents, including: 1) Enzymes in the following table: Preferably, the substrate recognition region is any DNA sequence greater than 10 nt, preferably 5'-TCAGTTC ATAG; 2) introducing ATACAG at the 5' end of the enzyme in 1); 3) introducing an optional mutation at position 1, 2, 21, 22, 23, 24 or 25 of the 5' end of the enzyme in 1), wherein the positions are based on E3P; 4) introducing a base sequence of any length, preferably 6 nt, at the 3' end of the enzyme in 1), preferably GTCCGA; 5) introducing a truncation of no more than 6 nt, preferably no more than 3 nt, at the 3' end of the enzyme in 1); 6) The 5' end of the enzyme in 2-5) above is connected to the substrate to form a cis structure; 7) Any combination of the above 2-6).

4. The enzyme of claim 3, comprising: Among them: A mutates to B (B=C / G / T), G mutates to H (H=A / T / C), T mutates to V (V=A / G / C), and C mutates to D (D=G / A / T).

5. Use of the DNAzyme according to any one of claims 2 to 4 for substrate cleavage reaction; Preferably, the cutting is performed in a solution containing an organic solvent; preferably, the organic solvent is selected from methanol, ethanol, acetone, acetonitrile, dimethyl sulfoxide, dimethylformamide; Preferably, the cleavage is carried out in the presence of a divalent metal cation, preferably Mg 2+ or Mn 2+ ; Preferably, the cleavage produces fluorescence; Preferably, the cutting is used for analytical detection, especially analytical detection of biological samples; Preferably, the cleavage is used for analysis and detection of nucleic acids such as DNA or RNA; Preferably, the cleavage is used to amplify the analytical detection signal.

6. A target sequence nucleic acid activated multi-component DNAzyme (MNAzyme), the multi-component DNAzyme comprising the following parts: A) L part: the 5' end fragment cleaved from the appropriate site by the DNAzyme according to any one of claims 2 to 4, and the target sequence recognition fragment L is connected to the 3' end; B) R part, which is a 3' end fragment cleaved from a suitable site by the DNAzyme according to any one of claims 2 to 4, and is connected to the target sequence recognition fragment R at the 5' end; wherein the target recognition fragment R and the target recognition fragment L recognize a continuous portion of the target sequence or two portions with an interval of less than 10 nt, preferably less than 5 nt, more preferably less than 2 nt; The target sequence is single-stranded DNA, double-stranded DNA, single-stranded RNA or double-stranded RNA; Preferably, the suitable site is located between the substrate recognition region and the catalytic region; Preferably, the multi-component DNAzyme is the cleavage of TJ11-3-A as described in claim 3; or the cleavage of an enzyme based on TJ11-3-A, preferably the cleavage of TJ11-3, the suitable site is the C70 (5'→3') site with TJ11-3 as the reference sequence, and the cleavage is that C70 is located in the R part or the L part; Preferably, the target sequence is a conserved sequence (30 nt) target sequence of different gene segments (A, E, N, F) of the SARS-Cov-2 virus, and the two corresponding parts of the target sequence and the corresponding multi-component DNAzyme are:

7. Use of the multi-component DNAzyme according to claim 6 in preparing a kit for nucleic acid detection such as DNA and RNA or pathogen detection or disease diagnosis.

8. A signal amplifier comprising the enzyme according to any one of claims 2 to 4 and a coupled biological recognition element such as an antibody and an aptamer; Preferably, the signal amplifier is used in an organic solvent system.

9. A kit comprising the enzyme according to any one of claims 2 to 4, or the multi-component DNAzyme according to claim 6, or the signal amplifier according to claim 8.

Images