Application of Rice Gene NL3 in Regulating Rice Leaf Shape

Abstract

The present invention relates to the field of plant genetic engineering, and specifically provides a rice gene <h2 style=";text-align:left;direction:ltr">NL3 Application in regulating rice leaf shape. <h2 style=";text-align:left;direction:ltr"> NL3 The nucleotide sequence of the gene is shown in SEQ ID NO.1; the rice gene <h2 style=";text-align:left;direction:ltr"> NL3 By regulating the development of leaf vascular bundles, the morphological development of leaves is affected. The present invention is applied in production practice, helps to shape the ideal rice plant type, increases the yield of crops, and has important application value.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering and relates to the application of rice gene NL3 in regulating rice leaf shape. Background Art

[0002] Rice is one of the most important food crops in the world and the main source of energy for more than half of the world's population. In recent years, with global warming, various adversities such as high temperature and drought have seriously harmed rice production. In addition, the continuous reduction of cultivated land area and population increase caused by urbanization have also put forward higher requirements for rice production. The key to solving the problem of food security is to increase the total yield of crops per unit area, but rice production has not made phased progress in recent years. Therefore, how to further increase rice production is the focus of everyone's attention.

[0003] Leaves are important nutritional organs of rice, and their main physiological function is photosynthesis. The size of leaves and leaf weight per unit area will affect leaf photosynthesis and yield. In addition to directly affecting photosynthesis, rice leaves also affect rice yield in other ways. The size of rice leaves can affect the absorption and transport of nitrogen, regulate the source-sink relationship, and affect rice yield. The compactness of leaves is an important leaf morphological feature. The leaf inclination is the angle between the main stem and the leaves, which determines the compactness of the plant. Upright leaves can reduce mutual shading of plants, increase the light-receiving area of ​​leaves, and increase rice yield. Therefore, improving leaf morphology to improve the utilization rate of light energy in the group is an effective measure to achieve increased rice yield.

[0004] Nowadays, with the rapid development of molecular biology and the widespread application of mutant research technology, scientists have used rice mutants and various groups to isolate and clone many leaf shape regulatory genes, and have made some progress in the study of rice leaf morphological development and molecular regulatory mechanisms. So far, multiple leaf shape-related genes have been located in rice, and nearly 40 genes related to rice leaf width traits, nearly 20 genes related to rice leaf length traits, more than 60 leaf inclination regulatory genes, and more than 30 genes controlling rice leaf curling have been successfully cloned. Different studies have revealed that the regulatory mechanisms of different leaf morphologies are not the same, mainly revealing the important role of the development of different types of cells and changes in cell division and elongation in leaf morphology.

[0005] Among them, bulliform cells, also known as motor cells, exist specifically on the adaxial surface of leaves and are arranged in several vertical rows. They are large cells with thin pericentric walls and high vacuolation. Among the cloned rice leaf curling regulatory genes, most genes directly or indirectly affect the development of bulliform cells and cause leaf curling. miRNA165 / 166 regulates the establishment of leaf adaxial-abaxial polarity by acting on members of the HD-ZIP gene family. The miRNA166 knockout strains show leaves curling toward the adaxial surface, smaller bulliform cells, abnormal development of thick-walled cells and other cell structural changes. OsHOX32 / OsHB4 belongs to the HD-ZIP class III family. Overexpression of OsHB4 can produce a rice curling phenotype. Further studies have shown that this leaf curling may be caused by a reduction in the number of bulliform cells. ROC5 and ROC8 are both members of the HD-ZIP IV gene family and have transcriptional activation activity. The two can directly interact to form a transcriptional repression complex to regulate the expression of the downstream ACL1 gene, affecting the development of bulliform cells. Mutations in ROC5 or ROC8 will cause leaf curling. DNRL1 encodes a DAHP synth II superfamily protein. The size of the vascular bundles in the leaf tissue of dnrl1 is reduced, and the reduction of bulliform cells is manifested as narrow curled leaves. REL2 encodes a protein containing a DUF domain to regulate bulliform cell development and auxin synthesis and transport. rel2 is manifested as an increase in the number of bulliform cells but a decrease in size, resulting in leaf curling. SLL2 regulates the development of leaf bulliform cells, and also affects the size and number of bulliform cells, changes the bulliform cell area, and affects the degree of leaf curling.

[0006] Unlike bullae, the width of leaves is mainly affected by the development of vascular bundles. Osa-miR319a and Osa-miR319b are members of the rice miRNA319 gene family. Overexpression of Osa-miR319a and Osa-MiR319b in rice can produce wider leaves. Cell anatomical structure shows that this is mainly caused by the increase in the number of small vascular bundles. NAL11 encodes a heat shock protein. The mutant shows a narrowed leaf phenotype caused by a significant reduction in the number of small vascular bundles in the leaves. RML1 can affect the number and size of leaf vascular tissues by regulating ribosome synthesis. rml1 shows shorter and narrower flag leaves. The snf1 mutant shows narrower and shorter flag leaves. Further research revealed that the reduction in the number of longitudinal veins in the leaves and the shortening of the length of epidermal cells are the causes of the changes in leaf morphology. NAL7 / OsCOW1 encodes a flavin monooxygenase and belongs to the YUCCA gene family. The nal7 mutant shows a decrease in leaf width, which is caused by affecting the synthesis of auxin, resulting in a reduction in the number of vascular bundles.

[0007] Hormone signals can regulate gene expression, affect corresponding cell proliferation or elongation, and affect leaf morphology. XIAO directly affects BR signals to regulate the rate of cell proliferation and differentiation, resulting in the reduction of organs including leaves. The longitudinal length of leaf cells and the number of longitudinal cells directly determine the length of leaves. Previous studies revealed that the differentiation of rice leaf length mainly comes from changes in genes related to GA synthesis pathways through comparative analysis of cultivated rice and Aus rice, and confirmed this conclusion through functional verification of key GA pathway genes SLA and OsGRF7 / 8. Silencing SLA can relieve its inhibition of downstream OsGRF7 / 8, promote GA synthesis and cell division, and increase rice leaf length. DGL1 encodes a katanin protein responsible for cutting microtubules, regulating the expression of GA synthesis genes, affecting cell elongation and regulating rice leaf length. As an auxin response factor, OsARF19 affects cell division and regulates leaf length by participating in the circulation and signal transduction of auxin.

[0008] In summary, leaf shape is an important agronomic trait of rice and an important component of the ideal plant type. It plays an important role in variety improvement and molecular design-assisted breeding. It is of great significance to discover the genes that regulate leaf shape in rice and explore their mechanism of action in regulating rice leaf shape. Summary of the invention

[0009] The invention provides application of rice NL3 gene in regulating rice leaf shape, and provides basis for breeding of rice varieties with narrow leaves.

[0010] The specific technical solutions are as follows:

[0011] The present invention provides an application of rice NL3 gene in regulating rice leaf shape, wherein the nucleotide sequence of the NL3 gene is SEQ ID NO.1, and the amino acid sequence of the protein encoded by the NL3 gene is shown in SEQ ID NO.3; the application approach is to make rice leaves narrower by knocking out the NL3 gene.

[0012] Furthermore, the application approach is to reduce the number of small vascular bundles in rice leaves by knocking out the NL3 gene, thereby narrowing the rice leaves.

[0013] Furthermore, the knocking out of the NL3 gene to narrow the rice leaves comprises the following steps:

[0014] (1) Designing a dual target site of the NL3 gene and constructing a gene knockout vector, wherein the dual target site of the NL3 gene is a dual target site located in the coding region of the NL3 gene, sg1: AGTGCCTTGTTCGCGCGCAG and sg2: TGCATCCTGGGTGACAAAT;

[0015] (2) constructing an Agrobacterium genetically engineered bacterium containing the knockout vector described in step (1);

[0016] (3) Transforming rice plants with the genetically engineered Agrobacterium described in step (2) to obtain a homozygous mutant strain that does not contain T-DNA and has stable inheritance.

[0017] Furthermore, in step (1), the gene knockout vector is constructed as follows:

[0018] a1 Design primer pairs for the dual target sites sg1 and sg2 of the NL3 gene, NL3-R1F / NL3-R1R and NL3-R2F / NL3-R2R, respectively, denature the primer pair NL3-R1F / NL3-R1R and the primer pair NL3-R2F / NL3-R2R at 95°C to prepare target dimers NL3-R1 and NL3-R2;

[0019] a2: Connect the NL3-R1 and NL3-R2 fragments obtained in a1 to the plasmids respectively to obtain a recombinant vector for gene knockout;

[0020] a3. The recombinant vector obtained in step a2 is transferred into competent cells to obtain Escherichia coli containing the recombinant vector, i.e., the gene knockout vector.

[0021] Furthermore, the base sequence of NL3-R1F is CAGAGTGCCTTGTTCGCGCGCAG; the base sequence of NL3-R1R is AACCTGCGCGCGAACAAGGCACT; the base sequence of NL3-R2F is CAGTGCATCCTGGGTGACAAAT; and the base sequence of NL3-R2R is AACATTTGTCACCCAGGATGCA.

[0022] Beneficial effects of the present invention:

[0023] The present invention provides a new gene NL3 cloned from a rice narrow leaf mutant. By knocking out the NL3 gene, rice leaves can be narrowed. The functional protein encoded by the gene affects the width of the leaves by regulating the development of vascular bundles. The present invention provides new gene resources and theoretical guidance for rice plant type improvement and molecular design breeding, helps to shape the ideal rice plant type, and improves the yield of crops, and has important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is the phenotype of the rice narrow leaf mutant nl3;

[0025] Figure 2 This is the preliminary location map of the leaf shape control gene NL3 on rice chromosome 3;

[0026] Figure 3 This is the fine-scale mapping of the NL3 gene, a leaf shape control gene;

[0027] Figure 4 is the plasmid map of the complementation vector pCAMBIA1300-NL3;

[0028] Figure 5 This is the NL3 transgenic complementary plant and leaf width phenotype in the functional complementation experiment;

[0029] Figure 6 This is the phenotype of the Nipponbare rice plant after the NL3 gene was knocked out. DETAILED DESCRIPTION

[0030] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0031] Example 1: (Map-based cloning)

[0032] 1. Rice material

[0033] The narrow leaf mutant (nl3) of rice (Oryza sativa L.) was obtained by treating the japonica rice variety (Japonica) "Nipponbare" with a 1% concentration of a chemical mutagen (ethyl methane sulphonate, EMS) and then screening a large number of mutants with stable phenotypes. Figure 1 shown.

[0034] 2. Analyze and position groups

[0035] In order to precisely isolate the gene controlling this trait, the homozygous nl3 mutant was hybridized with the indica rice variety Shuangkezao to further expand the population, and the F1 generation was self-pollinated to obtain a larger F2 population. The F2 generation population had a total of 5123 plants, of which 3657 had normal leaves and 1466 had mutant narrow leaf phenotypes. These 1466 narrow leaf mutants were selected as the fine positioning population. About 1 gram of young leaves were taken from each plant at the tillering stage to extract total DNA.

[0036] 3. Localization of NL3 gene by SSR and STS markers

[0037] The modified CTAB method was used to extract genomic DNA from rice leaves for gene localization. Take 1-2 cm rice leaves, cut them into pieces and put them into a 2.0 ml eppendorf centrifuge tube, add 1 steel ball, 700 μl extraction solution, place them in a TissueLyser IIsystem tissue grinder, grind for 2-3 minutes, keep in a 65°C constant temperature water bath for 40-60 minutes, then extract with chloroform, draw out the supernatant, add an equal amount of frozen isopropanol, centrifuge, wash with 70% alcohol, dry and add 150 μl ultrapure water as DNA sample. Use 2-3 μl DNA sample for each PCR reaction.

[0038] Preliminary positioning of NL3 gene: 40 narrow-leaf plants were selected from the F2 population of nl3 and Shuangkezao for SSR analysis. According to the published molecular genetic maps of japonica and indica rice, SSR primers that were approximately evenly distributed on each chromosome were selected for PCR amplification using the PTC-200 gradient thermal cycler of MJ Research. The total volume of PCR amplification reaction was 20 μl, including 50mmol / L KCl, 10mmol / L Tris-Cl (pH9.0), 1.5mmol / L MgCl2, 200 μmol / L dNTP, 50-100ng genomic DNA, 1 unit Taq polymerase and 0.1μmol / L primers, and the rest was distilled water. The amplification program was 94℃ pre-denaturation for 4min, and then entered the cycle amplification: 94℃ denaturation for 30s, the annealing temperature of each primer is shown in Table 1, annealing time 30s, 72℃ extension for 30s, 40 cycles; 72℃ extension for 10min. The polymorphism of PCR products was detected by 5% agarose gel electrophoresis and ethidium bromide (EB) staining. NL3 was initially located between markers B3-12 and B3-14 on chromosome 3.

[0039] Fine positioning of the NL3 gene: In order to isolate the gene NL3 that controls the narrow leaves and further expand the population, a total of 1466 narrow-leaved individuals were selected from the F2 population of the combination of nl3 and Shuangkezao. Molecular markers were further designed based on the initial positioning, and several new molecular markers were developed through sequence comparison analysis of the indica rice variety 9311 and the japonica rice variety Nipponbare (Table 1).

[0040] PCR amplification was performed using the MJResearch PTC-200 gradient thermal cycler, in which the total volume of the PCR amplification reaction was 20 μl, including 50mmol / L KCl, 10mmol / L Tris-Cl (pH9.0), 1.5mmol / L MgCl2, 200 µmol / L dNTP, 50-100ng of genomic DNA, 1 unit of Taq polymerase and 0.1µmol / L primers, and the rest was distilled water. The amplification program was 94℃ pre-denaturation for 5min, followed by cyclic amplification: 94℃ denaturation for 45s, primer annealing temperatures as shown in Table 1, annealing time 50s, 72℃ extension for 50s, 35-39 cycles; 72℃ extension for 10min. The polymorphism of the PCR products was detected by 4%-5% agarose gel electrophoresis separation and ethidium bromide (EB) staining. Finally, the NL3 gene was precisely located within the physical distance of 35.9Kb between the molecular markers NL8 and NL9. The molecular marker sequences for preliminary and fine positioning are shown in Table 1.

[0041] Table 1. Molecular marker sequences used for gene localization

[0042]

[0043] Note: ** is used for preliminary positioning marks; * is used for fine positioning marks.

[0044] 4. NL3 gene prediction, acquisition of full-length cDNA gene and prediction of function:

[0045] According to the results of fine mapping, according to the prediction of the Rice Genome Annotation Project (https: / / rice.uga.edu), within the range of 35.9 kb, it was found that there were 6 open reading frames (ORFs) in this interval. After sequencing analysis of these ORFs, it was found that there was a single base substitution (from C to A) in the exon of the fifth ORF (LOC_Os03g33520), causing the amino acid it encoded to change from alanine to aspartic acid ( Figure 3 ), we speculated that LOC_Os03g33520 is the candidate gene of NL3. The database showed that the gene encodes an EXO70 subunit, contains 1 exon and 0 introns, and the full length of CDS is 1671bp (SEQ ID NO. 2).

[0046] The nucleotide sequence of the rice narrow leaf gene NL3 is SEQ ID NO. 1, and the protein encoded by the gene has an amino acid sequence shown in SEQ ID NO. 3. The "*" in SEQ ID NO. 3 indicates a termination codon (TAG).

[0047] Example 2: Verification of NL3 gene functional complementation

[0048] A 4815 bp genomic DNA fragment was amplified by PCR, including 2032 bp of the ATG upstream promoter region of the NL3 gene, 1671 bp of the coding region, and 1112 bp of the downstream sequence after the terminator. The primer sequences were 5'- aattcgagctcggtaccACCGCTATTGTCGTCATTGTC-3' and 5'- ctagaggatccccgggtaccCCAATAACTCCCAAAGCTCAAC-3'. The fragment was ligated to the pCAMBIA1300 vector to obtain the transformation vector pCAMBIA1300-NL3.

[0049] Then, callus tissue induced by mature embryos of mutant nl3 was cultured in induction medium for 2 weeks, and then vigorously growing callus was selected as the recipient of transformation. Rice callus was infected with EHA105 strain containing plasmid pCAMBIA1300-NL3, and after co-cultured in the dark and 25°C for 3 days, it was cultured in light on a screening medium containing 50 mg / L Hygromycin for about 14 days. The pre-differentiated callus was transferred to differentiation medium and cultured under light conditions. Resistant transgenic plants were obtained in about one month. The plants were identified and continuously observed, and it was found that the leaves of the plants had restored their normal morphology. Compared with the mutants at the same growth stage, the narrowed leaf phenotype was restored. Therefore, we believe that the NL3 gene is the leaf shape regulatory gene NL3 that regulates the narrow leaves of the mutant nl3 (see Figure 5 ).

[0050] Example 3: NL3 gene knockout verification (method for improving rice leaf shape)

[0051] The knockout vector VK005 stored in our laboratory was used to construct the knockout vector. The specific steps are:

[0052] The dual target sites of the NL3 gene were designed and a gene knockout vector was constructed. The dual target sites of the NL3 gene were two pairs of target sites located in the coding region of the NL3 gene, sg1: AGTGCCTTGTTCGCGCGCAG and sg2: TGCATCCTGGGTGACAAAT; primer pairs of the dual target sites sg1 and sg2 of the NL3 gene were designed, NL3-R1F (base sequence: CAGAGTGCCTTGTTCGCGCGCAG) / NL3-R1R (base sequence: AACCTGCGCGCGAACAAGGCACT) and NL3-R2F (base sequence: CAGTGCATCCTGGGTGACAAAT) / NL3-R2R (base sequence: AACATTTG TCACCCAGGATGCA), denatured at 95°C using primer pair NL3-R1F / NL3-R1R and primer pair NL3-R2F / NL3-R2R to prepare target dimers NL3-R1 and NL3-R2; the VK005 vector digested with BSPQI was ligated with the corresponding linker to connect the obtained NL3-R1 and NL3-R2 fragments to the plasmid, respectively, to obtain recombinant vectors for gene knockout; the obtained recombinant vectors were transformed into Escherichia coli DH5α, positive plasmids were identified by colony PCR, and the genetic transformation vector VK005-NL3-R1 containing the NL3-R1 target and the genetic transformation vector VK005-NL3-R2 containing the NL3-R2 target were obtained by sequencing the positive plasmids.

[0053] The two plasmids were then transferred into the Agrobacterium tumefaciens strain EHA105 by electroporation and co-infected with rice. Callus tissue induced from mature embryos of the japonica rice variety "Nipponbare" was cultured in the induction medium for 2 weeks, and then the vigorously growing calli were selected for transformation. Rice calli were co-infected with the EHA105 strain containing plasmids VK005-NL3-R1 and VK005-NL3-R2. After co-culture in the dark and 25°C for 3 days, they were cultured in the light for about 14 days on a screening medium containing 50 mg / LHygromycin. The pre-differentiated calli were transferred to the differentiation medium and cultured under light conditions. Resistant transgenic plants were obtained in about a month. The plants were identified and continuously observed, and it was found that the knockout plants produced a leaf narrowing phenotype similar to that of the mutant (see Figure 5 ), the knockout plants are plants that do not contain T-DNA and have the same homozygous mutation.

[0054] The present invention is described in detail above. Definitions of Terms Related to the Present Invention Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which the present invention belongs.

[0055] The term "protein" is used interchangeably herein to refer to a polymer of amino acid residues. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally encoded amino acids. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked via covalent peptide bonds.

[0056] The term "transformation" refers to a process by which a heterologous DNA sequence is introduced into a host cell or organism.

[0057] The term "expression" refers to the transcription and / or translation of an endogenous gene or a transgene in a plant cell.

[0058] For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principle of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departing from the disclosed scope in the application, and the changes made with conventional techniques known in the art.

Claims

1. Rice NL3 The application of the gene in regulating rice leaf shape is characterized in that: Said NL3 The nucleotide sequence of the gene is SEQ ID NO. 1, NL3 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No. 3; the application method is to knock out NL3 Gene that makes rice leaves narrower.

2. The use according to claim 1, characterized in that The application approach is to knock out NL3 Gene, reducing the number of small vascular bundles in rice leaves, thereby making the rice leaves narrower.

3. The use according to claim 1, characterized in that: The knockout NL3 Gene, making rice leaves narrower, involves the following steps: (1) Design NL3 The double target sites of the gene are used to construct a gene knockout vector. NL3 The dual target site of the gene is located at NL3 Dual target sites in the coding region of the gene, sg1: AGTGCCTTGTTCGCGCGCAG and sg2: TGCATCCTGGGTGACAAAT; (2) constructing an Agrobacterium genetically engineered bacterium containing the knockout vector described in step (1); (3) Transforming rice plants with the genetically engineered Agrobacterium described in step (2) to obtain a homozygous mutant strain that does not contain T-DNA and has stable inheritance.

4. The use according to claim 3, characterized in that: In step (1), the gene knockout vector is constructed as follows: a1 respectively designed NL3 The primer pairs for the dual target sites sg1 and sg2 of the gene, NL3-R1F, NL3-R1R and NL3-R2F, NL3-R2R, were denatured at 95°C using primer pair NL3-R1F, NL3-R1R and primer pair NL3-R2F, NL3-R2R to prepare target dimers NL3-R1 and NL3-R2; Among them, the base sequence of NL3-R1F is CAGAGTGCCTTGTTCGCGCGCAG; the base sequence of NL3-R1R is AACCTGCGCGCGAACAAGGCACT; the base sequence of NL3-R2F is CAGTGCATCCTGGGTGACAAAT; the base sequence of NL3-R2R is AACATTTGTCACCCAGGATGCA; a2: Connect the NL3-R1 and NL3-R2 fragments obtained in a1 to the plasmids respectively to obtain a recombinant vector for gene knockout; a3. The recombinant vector obtained in step a2 is transferred into competent cells to obtain Escherichia coli containing the recombinant vector, i.e., the gene knockout vector.

Images