RAA primer, probe primer and detection method for detecting streptococcus suis based on fluorescent RAA technology

Abstract

The invention discloses an RAA primer, a probe primer and a detection method for detecting streptococcus suis based on a fluorescent RAA technology, and the RAA primer comprises an upstream primer and a downstream primer which have nucleotide sequences as shown in SEQ ID NO.3 and SEQ ID NO.9, and further comprises a probe primer with a nucleotide sequence as shown in SEQ ID NO.12. The invention further provides an RAA fluorescent reaction system, the concentration of the probe primer is 10 mu M, and the volume ratio of the probe primer in the system is 4%. The reaction system provided by the invention can be used for detecting the streptococcus suis, can also be used for researching etiology characteristics of the streptococcus suis, and also has an application value in prevention and detection of streptococcus suis infection.

Description

Technical Field

[0001] The invention relates to the technical field of biological detection, and in particular to a primer, a probe and a detection method for detecting Streptococcus suis based on the fluorescent RAA technology. Background Art

[0002] Streptococcus suis is an important animal pathogen that primarily affects pigs and can cause a range of serious diseases, including meningitis, sepsis, and arthritis. The pathogen not only causes significant economic losses to the pig industry, but can also infect humans, causing serious health problems, especially in high-risk populations with pig contact. Even in healthy pigs, S. suis may have the ability to cause disease, which poses a potential risk to the healthy breeding of pigs, workers in related industries, and consumers of pork products. Since the first recorded case of S. suis infection in pigs in Europe in the 1950s and the first human infection in Denmark in the 1960s, outbreaks of zoonotic S. suis infection have been reported many times around the world. S. suis is widely distributed in nature and exists in multiple serotypes. It is currently known that 15 serotypes of S. suis can cause disease in pigs, and 12 serotypes are pathogenic to humans, posing a serious threat to the pig farming industry and public health safety.

[0003] Accurate and timely detection is essential for the effective control of Streptococcus suis infection. In pig farming, in order to isolate, identify and diagnose Streptococcus suis early, molecular biological methods such as microbial isolation and culture or PCR are traditionally used. However, as a facultative anaerobic bacterium, the culture process of Streptococcus suis is complicated and time-consuming, usually taking 4 to 7 days, and the bacteria have high nutritional requirements. In addition, it is difficult to grow on ordinary culture media and is easily contaminated by other bacteria such as Proteus, Light Green Aerobic Bacteria, and Acinetobacter, which increases the difficulty of obtaining pure culture. In contrast, although the PCR method is based on specific primers for in vitro DNA amplification of target genes and has high sensitivity, it has strict temperature control and requires the support of professional equipment. Both methods have certain limitations in the on-site rapid detection of Streptococcus suis. Therefore, the development of a new technology that can quickly and accurately detect Streptococcus suis is of great significance for maintaining public health safety and promoting the economic development of the pig farming industry.

[0004] Recombinase-mediated isothermal nucleic acid amplification (RAA) technology uses recombinase, single-stranded binding protein, DNA polymerase and other enzymes to perform nucleic acid amplification under isothermal conditions (usually in the range of 37-42°C). RAA technology has shown broad application prospects in many fields such as food safety, animal disease detection, environmental monitoring, and clinical diagnosis due to its isothermal amplification, rapid results, high sensitivity, high specificity, and simple operation. The recN gene is an important genetic marker of Streptococcus suis. Studies have shown that the recN gene varies greatly in different Streptococci, and is present and conserved in Streptococcus suis, making it suitable as a target gene for identifying Streptococcus suis.

[0005] The purpose of this study is to establish a rapid and sensitive detection method for Streptococcus suis based on the fluorescent RAA technology and the recN gene. By optimizing the reaction conditions and detection process, an effective tool is provided for the early detection and monitoring of Streptococcus suis, thereby providing support for the prevention and control of the spread of this pathogen. Summary of the invention

[0006] The purpose of the present invention is to provide a primer, a probe and a detection method for detecting Streptococcus suis based on the fluorescence RAA technology, so as to solve the problem of rapid and accurate detection of Streptococcus suis.

[0007] In order to achieve the above object, the present invention provides a RAA primer for detecting Streptococcus suis, wherein the RAA primer comprises an upstream primer and a downstream primer, wherein the nucleotide sequences of the upstream and downstream primers are shown in SEQ ID NO.3 and SEQ ID NO.9.

[0008] The present invention also provides a primer composition for detecting Streptococcus suis based on the fluorescent RAA technology, the primer composition comprising a probe primer and the above-mentioned RAA primer, wherein the nucleotide sequence of the probe primer is shown in SEQ ID NO. 12. The probe primer is based on the original nucleotide sequence as shown in SEQ ID NO. 11, a fluorescent group i6FAM is marked at the 31st base T at the 5' end of the sequence, the base A at the 33rd base is replaced with a tetrahydrofuran residue (THF), a quenching group iBHQ1 is marked at the 34th base T, and C3 Spacer is modified at the 3' end of the sequence.

[0009] The present invention also provides a kit for detecting Streptococcus suis based on the fluorescent RAA technology, and the kit comprises the above-mentioned probe primer and RAA primer.

[0010] The primer composition or kit provided by the present invention can be used in any of the following, including: detection of Streptococcus suis, research on the pathogenic characteristics of Streptococcus suis, prevention and detection of Streptococcus suis infection.

[0011] The present invention also provides a detection method for detecting Streptococcus suis based on fluorescent RAA technology, and the detection is performed through a RAA reaction system. The nucleotide sequences of RAA primers in the RAA reaction system are shown in SEQ ID NO.3 and SEQ ID NO.9, and the nucleotide sequence of the probe primer is shown in SEQ ID NO.12.

[0012] Preferably, the concentration of the probe primer in the above reaction system is 10 μM, and the amount used is 4% of the total volume.

[0013] The present invention has the following advantages:

[0014] The present invention is based on fluorescent RAA technology, and according to the important genetic marker gene recN of Streptococcus suis, develops a RAA primer and a probe primer for specifically detecting the recN gene, and optimizes to obtain a highly specific and accurate Streptococcus suis detection method. The primers and the reaction system provided by the present invention can specifically detect various types of Streptococcus suis, and have a higher accuracy rate than ordinary PCR, effectively avoiding the occurrence of false positives, and can obtain accurate detection results within 30 minutes. Moreover, the specificity is high, and there will be no cross-reaction with other types of bacteria in the sample. The present invention has application potential in the detection of Streptococcus suis and environmental detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The electrophoresis results of the detection of Streptococcus suis by different RAA primer combinations developed in the present invention.

[0016] Figure 2 This is the result of exploring the optimal dosage of the probe developed in the present invention.

[0017] Figure 3 This is the sensitivity test result of the RAA reaction system provided by the present invention.

[0018] Figure 4 This is the specific detection result of the RAA reaction system provided by the present invention. DETAILED DESCRIPTION

[0019] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0020] Note: The experimental methods in the following examples are conventional methods unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0021] Experimental Example 1 Development and screening of RAA primers

[0022] The sequence of the recN gene of Streptococcus suis was downloaded from NCBI (https: / / www.ncbi.nlm.nih.gov / ), and the GenBank accession number is AB724061. The standard strain of Streptococcus suis BNCC357698 (ATCC43765) was purchased from the Beina Microbial and Cell Resource Collection and activated and preserved.

[0023] According to the RAA primer design principle, 10 RAA primers were developed for the sequences of two conserved regions of the recN gene of Streptococcus suis. The specific sequences are shown in Table 1 below. All primers were synthesized at Shanghai Sangon Biotechnology Co., Ltd.

[0024] Table 1 Main primer information

[0025]

[0026] The designed primers were combined into 9 groups of RAA primers, namely, primer combinations of F1+R1, F2+R2, F3+R3, F4+R4, F2+R3, F2+R4, F3+R2, F3+R5, and F3+R6. The 9 primer combinations were used to perform conventional amplification detection on the standard strain of Streptococcus suis BNCC357698 according to the conventional RAA detection kit, and the amplification products were subjected to electrophoresis. The results are as follows Figure 1 As shown. Among them, Figure 1 The a in the figure contains the amplification results of 4 sets of primers. Figure 1 The b in the figure contains the amplification results of 5 sets of primers, and the marker in the figure is the marker of DL2000.

[0027] The results showed that when the primer pair was F3+R5, the band was the brightest compared with the other 8 primer combinations under the same reaction conditions, so this primer set was used as the best RAA primer for subsequent experiments.

[0028] Experimental Example 2 Design and optimal dosage of RAA fluorescent probe

[0029] According to the amplification product of primer pair F3+R5, a fluorescent RAA probe was designed. The original nucleotide sequence corresponding to the designed probe is shown in SEQ ID NO.11, and the specific sequence is 5'-ATATTCATGGTCAACATGACCAGGAAGAATTGATGAAATCCCAGCACC A-3'. The 31st base T of the sequence was labeled with a fluorescent group i6FAM, the 33rd base A was replaced with a tetrahydrofuran residue (THF), the 34th base T was labeled with a quenching group iBHQ1, and finally the 3' end of the sequence was modified with C3 Spacer. The final probe sequence is shown in SEQ ID NO.12, which is as follows:

[0030] ATATTCATGGTCAACATGACCAGGAAGAAT / i6FAMdT / G / idSp / / iBHQ1dT / GAAATCCCAGCACCA.

[0031] Exploration of the optimal amount of probe

[0032] In order to obtain the best reaction conditions, the amount of probe was optimized. The probe (concentration of 10 μM) was prepared into reaction systems with the amounts of 0.2 μL, 0.4 μL, and 0.6 μL, respectively. The specific system is shown in Table 2 below. The centrifuge tubes of different reaction systems were placed in the qPCR instrument, and the reaction program was set to 37°C and 20 min. The amplified product was used for subsequent detection of the standard strain.

[0033] Table 2 RAA reaction system

[0034]

[0035] The amplification results with different probe dosages are shown in Figure 2 As shown, the results showed that the probe had higher efficiency when used in amounts of 0.4 μL and 0.6 μL, and the efficiency was slightly higher when the probe was used in an amount of 0.4 μL than when it was used in an amount of 0.6 μL. When the probe was used in an amount of 0.2 μL, its fluorescence intensity was found to be weak after the reaction. Therefore, a final probe concentration of 0.4 μL was selected as the optimal amount.

[0036] Experimental Example 3: Experimental study on sensitivity and specificity of RAA reaction

[0037] 1. Sensitivity study

[0038] The standard strain was used as a template to dilute the concentration system from 1×10 7 CFU / mL diluted to 1×10 1CFU / mL, according to the system and results in Experimental Example 2, RAA fluorescence reaction detection was performed on templates of different concentrations. Referring to the instructions of the kit, when the CT value was ≤36, the test result was positive.

[0039] The sensitivity test results of the reaction system are as follows: Figure 3 As shown in the figure, N / A means that the threshold line is not reached, NC means the control without template DNA, and the value in the figure indicates the cycle number when the reaction reaches the threshold. It can be seen that the detection limit of this reaction system is 1×10 1 CFU / mL.

[0040] 2. Specificity study

[0041] In order to verify the specificity of the reaction system, the standard strain of Streptococcus suis BNCC357698 and other streptococci closely related to Streptococcus suis and strains frequently colonized in pig nasal swabs were selected for testing. The included strains are shown in Table 3.

[0042] Table 3 Strain information

[0043]

[0044] Referring to the above reaction system, the strains in Table 3 were used as different templates for RAA amplification specificity detection. The results are as follows Figure 4 As shown, N / A means that the threshold line is not reached; NC means the control without template DNA, and the value in the figure indicates the number of cycles when the reaction reaches the threshold. The results show that this method can distinguish closely related streptococci from other common bacteria in the pig nasal cavity, and can be used for the detection of multiple serotypes of streptococci in pigs, without cross-reaction with other strains including Staphylococcus aureus, and has good specificity.

[0045] Comparative Application Examples

[0046] This comparative application example compares the Streptococcus suis detection method based on the fluorescent RAA with the common PCR detection method, wherein the primers used in the common PCR are gdh-F (SEQ ID NO.13): GTTGAGCCTGAGCGTATCATC; gdh-R (SEQ ID NO.14): CCAGTCAAGACACCTGCATC, and the amplification product is 425bp. Specifically, 150 mixed bacterial samples preserved by the laboratory were tested for Streptococcus suis, the amplification results were sequenced and tested, and the results were statistically analyzed. It was found that the amplification detection performed by the common PCR method had false positives, with a compliance rate of 92.9%, and the compliance rate of the fluorescent RAA detection method established in this study was 100.0%.

[0047] In summary, the present invention provides a detection primer and probe suitable for Streptococcus suis. The fluorescent RAA detection method for detecting Streptococcus suis by using the primer and probe effectively avoids the occurrence of false positives, and has the advantages of high accuracy, rapidity and high efficiency, and has application potential in the detection of Streptococcus suis. At the same time, the detection primer and probe can be used as a primer combination to develop a kit for detecting Streptococcus suis based on the fluorescent RAA technology, which can be applied to the study of the pathogenic characteristics of Streptococcus suis, and through the detection of Streptococcus suis in the environment and test samples, it is helpful for the prevention and detection of Streptococcus suis infection, and has potential application value.

[0048] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be appreciated that the above description should not be considered as a limitation of the present invention. After reading the above content, it will be apparent to those skilled in the art that various modifications and substitutions of the present invention will occur. Therefore, the protection scope of the present invention should be limited by the appended claims.

Claims

1. A RAA primer for detecting Streptococcus suis, characterized in that: The RAA primers include an upstream primer and a downstream primer, and the nucleotide sequences of the upstream and downstream primers are shown in SEQ ID NO.3 and SEQ ID NO.

9.

2. A primer composition for detecting Streptococcus suis based on fluorescent RAA technology, characterized in that: The primer composition comprises a probe primer and the RAA primer according to claim 1, and the nucleotide sequence of the probe primer is shown in SEQ ID NO.

12.

3. The primer composition according to claim 2, characterized in that The probe primer is based on the original nucleotide sequence as shown in SEQ ID NO.11, with a fluorescent group i6FAM labeled at the 31st base T at the 5' end of the sequence, the base A at the 33rd base is replaced with a tetrahydrofuran residue, and a quenching group iBHQ1 is labeled at the 34th base T, and C3 Spacer modification is performed at the 3' end of the sequence.

4. A kit for detecting Streptococcus suis based on fluorescent RAA technology, characterized in that: The kit comprises the primer composition of claim 3.

5. Use of the primer composition according to claim 3 or the kit according to claim 4 in any of the following; (1) Detection of Streptococcus suis; (2) Research on the etiological characteristics of Streptococcus suis; (3) Prevention and detection of Streptococcus suis infection.

6. A method for detecting Streptococcus suis based on fluorescent RAA technology, characterized in that: The detection is performed by using a RAA reaction system, wherein the nucleotide sequences of the RAA primers in the RAA reaction system are shown as SEQ ID NO.3 and SEQ ID NO.9, and the nucleotide sequence of the probe primer is shown as SEQ ID NO.

12.

7. The detection method according to claim 6, characterized in that: The concentration of the probe primer was 10 μM.

8. The detection method according to claim 7, characterized in that: The amount of the probe primer used in the system is 4% of the total volume.

Images