Primer probe group and kit for joint detection of mycoplasma genitalium, ureaplasma urealyticum and chlamydia trachomatis

Abstract

The invention discloses a primer probe group and a kit for joint detection of mycoplasma genitalium, ureaplasma urealyticum and chlamydia trachomatis, and belongs to the technical field of molecular biological detection. The primer probe group comprises a primer probe group A for directly detecting a mycoplasma genitalium mgpB gene, a primer probe group B for directly detecting a ureaplasma urealyticum ureB gene and a primer probe group C for directly detecting a chlamydia trachomatis ompA gene; the kit comprises a PCR (Polymerase Chain Reaction) reaction solution and the primer probe group. Nucleic acid extraction is not needed, the detection cost is greatly reduced, the experiment time is shortened, meanwhile, the specificity and accuracy are still guaranteed, meanwhile, the sensitivity is improved, and the method has wide application prospects in the fields of non-gonococcal genital tract infection main pathogen detection, infertility and prenatal and postnatal care screening and the like. And the kit has important significance on clinical diagnosis, early treatment and prevention of diseases, prevalence and the like.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biological detection, and specifically relates to a primer probe group and a kit for the joint detection of Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis. Background Art

[0002] Common sexually transmitted disease pathogens include viruses, bacteria, mycoplasma, chlamydia, etc. Among urogenital tract infections, non-gonococcal urinary tract infections are mainly caused by Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis.

[0003] Mycoplasma genitalium (MG) was first isolated from urethral specimens of patients with non-gonococcal urethritis in 1980. It belongs to the class Mollicutes and is a transmissible pathogen. It adheres to and invades epithelial cells through adhesion proteins on the cell membrane, induces inflammatory responses and damages host cells by producing nucleases and membrane lipoproteins, and can cause urethritis, cervicitis, and proctitis, and secondary pelvic inflammatory disease, prostatitis, epididymitis, and may even cause male infertility. It is closely related to premature birth, and asymptomatic infection is also common. In addition, MG can promote the infection and transmission of HIV.

[0004] Ureaplasma urealyticum belongs to the genus Ureaplasma of the class Mollicutes, the order Mycoplasma, and the family Mycoplasmataceae. It is a common mycoplasma in urogenital tract infections. It plays a persistent etiological role in vaginitis and urethritis in women of childbearing age and non-gonococcal urethritis in men. It can cause infertility, spontaneous abortion, congenital pneumonia in infants, chronic lung disease, neonatal meningitis, etc. It is currently known that Ureaplasma urealyticum includes two biotas and 14 serotypes: serotypes 1, 3, 6, and 14 belong to a biota group, namely Ureaplasma parvum Up, and serotypes 2, 4, 5, 7 to 13 belong to Ureaplasma urealyticum Uu.

[0005] The number of cases of genital tract infection with Chlamydia trachomatis (Ct) has exceeded that of gonococcal infection, ranking first among sexually transmitted diseases. In addition to urogenital tract inflammation, Ct can also cause a series of other clinical diseases, such as prostatitis, epididymitis, vaginitis, cervicitis, endometritis, pelvic inflammatory disease, etc., and even lead to ectopic pregnancy or tubal infertility in women. In addition, Ct infection is also a synergistic factor for human papillomavirus-induced cervical cancer and an important risk factor for HIV infection. Ct has a high incidence rate, a wide range of prevalence, and serious harm, which has attracted great attention from global public health. In order to reduce the disease burden of genital tract infection, the present invention designs non-specific primers and probes for Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis, respectively, to achieve multiple detection of non-gonococcal genital tract pathogen infection, infertility and eugenics screening, and provide better clinical auxiliary diagnosis for early detection and early treatment, which is of great significance for early treatment and prevention of diseases and epidemics.

[0006] In the prior art, the invention patent with publication number CN102888464A discloses a multiplex real-time PCR method that can simultaneously detect five pathogenic pathogens, including Chlamydia trachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum, Mycoplasma hominis, and Mycoplasma genitalium, and discloses the primer pairs and probes used therein, which are free of cross-contamination and interference, thereby ensuring the accuracy, reliability, specificity, sensitivity, and repeatability of the detection of the five pathogenic pathogens. In addition, the invention patent with publication number CN115896306A also discloses a detection kit that can simultaneously detect Chlamydia trachomatis, Neisseria gonorrhoeae, and Ureaplasma urealyticum, and adopts a multiplex real-time fluorescence PCR method, and multiple fluorescent markers can be used in the same reaction system to achieve simultaneous detection of multiple pathogens, and the method has strong specificity and high sensitivity, and can meet the needs of a detection method with strong specificity, high sensitivity, and simple and quick operation for Chlamydia trachomatis, Neisseria gonorrhoeae, and Ureaplasma urealyticum. It can be seen that the prior art does not disclose detection primers, probes and kits specifically for the combined use of three pathogens: Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis. Summary of the invention

[0007] The purpose of the present invention is to provide a primer probe set for the joint detection of Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis. The primer probe set is specially designed for specific conserved regions of different genes of Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis, and can efficiently and specifically detect Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis.

[0008] Another object of the present invention is to provide a kit for the joint detection of Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis. When the kit is used for detection, PCR detection can be achieved without nucleic acid extraction of the sample, thereby reducing the detection cost, simplifying the test operation, shortening the detection time, and ensuring high specificity and accuracy, and improving the sensitivity. Furthermore, the present invention can also be used for the gene detection of Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis in female cervical swabs / vaginal swabs and male urethral swabs.

[0009] The present invention is achieved through the following technical scheme: a primer probe group for the joint detection of Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis, comprising a primer probe group A for directly detecting the mgpB gene of Mycoplasma genitalium, a primer probe group B for directly detecting the ureB gene of Ureaplasma urealyticum, and a primer probe group C for directly detecting the ompA gene of Chlamydia trachomatis. The primer probe set A of the present invention is selected in the conserved region of the mgpB gene, that is, the upstream primer is selected in the 131st to 151st base region of the mgpB gene sequence, the probe is selected in the 155th to 172nd base region of the mgpB gene sequence, and the downstream primer is selected in the 175th to 199th base region of the mgpB gene sequence. Therefore, the primer probe set A includes: Primer MG-F: AGAARTACCTTGATGRTCAGC, Primer MG-R: CATATAAAGCTCTACCGTTGTTATC, Probe MG-P: ACTTTGCAATCAGAAGGT; The primer probe set B of the present invention is selected in the conserved region of the ureB gene, that is, the upstream primer is selected in the 50th to 70th base region of the ureB gene sequence, the probe is selected in the 104th to 131st base region of the ureB gene sequence, and the downstream primer is two complementary downstream primers designed for the 149th to 169th base region of the ureB gene sequence. Therefore, the primer probe set B includes: Primer Uu-F: CGTGTTCCGRCTAAATCAATA, Primer Uu-R.1: CGAAGACAAAGAACGTAAAGT, Primer Uu-R.2: TGAAGATAAAGAACGCAAAGT, Probe Uu-P: CGAATAGCAGTACCTGATGGAATATCGA; The primer probe set C of the present invention is selected in the conserved region of the ompA gene, that is, the upstream primer is selected in the 135th to 153rd base region of the ompA gene sequence, the probe is selected in the 155th to 175th base region on the ompA gene sequence, and the downstream primer is selected in the 199th to 218th base region of the ompA gene sequence. Therefore, the primer probe set C includes: Primer CT-F: AGATCCTTGCGATCCTTGC, Primer CT-R: ACACGGTCGAAAACAAAGTC, Probe CT-P: CCACTTGGTGTGACGCTATCAGCATG.

[0010] Also included is an internal standard primer probe set RP for monitoring the entire detection process.

[0011] The internal standard primer probe group RP includes: Primer RP-F: AGATTTGGACCTGCGAGC; Primer RP-R: GAGCGGCTGTCTCCACAAGT; Probe RP-P: TTCTGACCTGAAGGCTCTGCGCG.

[0012] A kit for the combined detection of Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis, comprising a PCR reaction solution and the above-mentioned primer probe set.

[0013] The PCR reaction solution comprises Taq DNA polymerase, UNG enzyme, dA / G / C / UTPs, magnesium ions, sodium chloride and Tris buffer.

[0014] Compared with the prior art, the present invention has the following advantages and beneficial effects: (1) The primer probe set A for directly detecting the mgpB gene of Mycoplasma genitalium in the present invention is selected in the conserved region of the gene (131-151aa, 155-172aa, 175-199aa), and the formation of hairpin structure, internal dimer of primer, dimer between primers and mismatch is avoided as much as possible, and non-specific binding with other viruses or human genes can be avoided.

[0015] (2) The primer probe set B used in the present invention for directly detecting the ureB gene of Ureaplasma urealyticum is selected in the conserved region of the gene (50-70aa, 104-131aa, 149-169aa) and can cover 14 serotypes, and can avoid the formation of hairpin structure, internal dimer of primer, dimer between primers and mismatch as much as possible, and can avoid non-specific binding to other viruses or human genes.

[0016] (3) The primer probe set C for detecting the ompA gene of Chlamydia trachomatis in the present invention is selected in the conserved region of the gene (135-153aa, 155-175aa, 199-218aa) and can cover all types of genital Chlamydia trachomatis (D, Da, E, F, G, H, I, Ia, J, Ja, K, L1, L2, L2a, L3), and avoids the formation of hairpin structure, internal dimer of primer, dimer between primers and mismatch as much as possible, and can avoid non-specific binding of other viruses or human genes.

[0017] (4) The primer probe set of the present invention can directly detect the target gene in the sample. Therefore, based on the design of the primer probe set, it can be used in a method of directly performing PCR amplification detection on a female cervical swab / vaginal swab or a male urethral swab without nucleic acid extraction.

[0018] (5) The primer probe set provided by the present invention not only improves the existing detection method, reduces the detection cost, shortens the test time, simplifies the operation steps, but also ensures specificity and accuracy while improving sensitivity.

[0019] In summary, the present invention designs specific primers and probes for Mycoplasma genitalium, Ureaplasma urealyticum, Chlamydia trachomatis and internal standard gene RP, respectively, and uses real-time fluorescence quantitative PCR technology to qualitatively detect Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis nucleic acid DNA in vitro. The detection kit samples of the present invention do not need to be extracted with nucleic acids, which greatly reduces the detection cost, shortens the experimental time, and improves the sensitivity while still ensuring specificity and accuracy. It has broad application prospects in the fields of non-gonococcal reproductive tract infection main pathogen detection, infertility and eugenics screening, and is of great significance to clinical diagnosis, early treatment and prevention of diseases, and epidemics. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 is the amplification curve of Mycoplasma genitalium in Example 2; Figure 2 is the amplification curve of Chlamydia trachomatis in Example 2; Figure 3 is the amplification curve of Ureaplasma urealyticum in Example 2; Figure 4 is the amplification curve of RP in Example 2; Figure 5 This is the amplification curve of Mycoplasma genitalium in the quadruple system in Example 3; Figure 6 This is the amplification curve of Chlamydia trachomatis in the quadruple system in Example 3; Figure 7 This is the amplification curve of Ureaplasma urealyticum in the quadruple system in Example 3; Figure 8 is the amplification curve of the quadruple system RP in Example 3; Fig. 9 This is the amplification curve for directly detecting Mycoplasma genitalium in Example 5; Fig.10 This is the amplification curve for detecting Mycoplasma genitalium after nucleic acid extraction in Example 5; Fig.11 This is the amplification curve for direct detection of Chlamydia trachomatis in Example 6; Fig.12 This is the amplification curve for detecting Chlamydia trachomatis after nucleic acid extraction in Example 6; Fig.13 This is the amplification curve for directly detecting Ureaplasma urealyticum in Example 7; Fig.14 This is the amplification curve for detecting Ureaplasma urealyticum after nucleic acid extraction in Example 7; Fig.15 This is the amplification curve for detecting Ureaplasma urealyticum using reagents from other manufacturers in Example 8; Fig.16 This is the amplification curve of detecting Ureaplasma urealyticum using the nucleic acid detection kit of Example 4 in Example 8. DETAILED DESCRIPTION

[0021] The invention objectives, technical solutions and beneficial effects of the present invention are further described in detail below.

[0022] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the claimed invention, and unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs.

[0023] The present invention aims to provide a primer probe set and a kit for the joint detection of Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis. The primer probe set is a series of primers and probe sets with high specificity and wide coverage designed for Mycoplasma genitalium, Ureaplasma urealyticum, Chlamydia trachomatis and internal standard gene RP respectively; the kit uses the primer probe set to perform real-time fluorescence quantitative PCR detection, and can achieve in vitro qualitative detection of Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis nucleic acid DNA without nucleic acid extraction, and has the characteristics of fast operation, low detection cost, high detection specificity, sensitivity and accuracy, and provides data support for the clinical diagnosis and evaluation of diseases such as non-gonococcal reproductive tract infection, infertility and eugenics.

[0024] Specifically, the primer probe group of the present invention includes a primer probe group A for directly detecting the mgpB gene of Mycoplasma genitalium, a primer probe group B for directly detecting the ureB gene of Ureaplasma urealyticum, a primer probe group C for directly detecting the ompA gene of Chlamydia trachomatis, and an internal standard primer probe group RP. Among them, primer probe group A includes primer MG-F, primer MG-R and detection probe MG-P, and its sequence information is shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively; primer probe group B covers all 14 serotypes of two biological groups of Ureaplasma urealyticum, including primer Uu-F, primer Uu-R.1, primer Uu-R.2 and detection probe Uu-P, and its sequence information is shown in SEQ ID NO: 4, SEQ ID NO: 5, SEQID NO: 6 and SEQ ID NO: 7, respectively; primer probe group C covers all reproductive serotypes (D, Da, E, F, G, H, I, Ia, J, Ja, K, L1, L2, L2a, L3), including primer CT-F, primer CT-R and detection probe CT-P, and its sequence information is shown in SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, respectively. NO: 10; the internal standard primer probe group RP is used to monitor the entire process, including primer RP-F, primer RP-R and detection probe RP-P, and its sequence information is shown in SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO: 13 respectively.

[0025] It should be noted that the internal standard primer probe group RP of the present invention is to detect the human gene RNaseP, which exists in large quantities in the human body. As long as it is a human sample, this gene should be detectable, and the detection of this gene is used to verify whether the entire amplification system is normal. If the test result is negative, it means that there is a problem in the amplification process, that is, Mycoplasma genitalium, Ureaplasma urealyticum or Chlamydia trachomatis is negative, which may also be a false negative result.

[0026] As an optional method, in all the primer probe sets for directly detecting Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis, the 5' end of the probe is labeled with a fluorescent group, the 3' end of the probe is labeled with a fluorescent quenching group or an MGB quenching group, and the probes for different target genes are respectively labeled with different fluorescent groups. It is convenient to use different fluorescent channels for detection. For example, in some specific embodiments, the fluorescent group can be selected from FAM, ROX, VIC, CY5 or HEX; the quenching group can be selected from BHQ1, BHQ2, BHQ3, MGB, and the excitation and emission bands of these groups are relatively separated and can be detected separately in one system.

[0027] In a specific embodiment, in all the primer probe sets mentioned above for directly detecting Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis, probe MG-P is labeled with FAM, probe Uu-P is labeled with CY5, probe CT-P is labeled with ROX, and probe RP-P is labeled with Vic.

[0028] Furthermore, the kit of the present invention contains, in addition to the above-mentioned primer probe set, a PCR reaction solution, a negative control and a positive control.

[0029] As an optional method, the PCR reaction solution usually contains Taq DNA polymerase, UNG enzyme, dA / G / C / UTPs, magnesium ions, sodium chloride, and Tris buffer; the negative control is a pseudovirus containing an internal standard RP gene fragment, which does not include Mycoplasma genitalium, Ureaplasma urealyticum, Chlamydia trachomatis, human genome sequence or similar sequence, and can be used to independently perform quality control on each amplification reaction to check whether the quality control kit itself and the experimental operation are normal, so as to exclude false negatives caused by kit failure or individual sample sampling and operation errors; the positive control is a pseudovirus containing the detection gene fragment.

[0030] Based on the design of the primer probe group described in the present invention, a kit containing the primer probe group, PCR reaction solution, negative control and positive control can be used in a PCR method for directly detecting Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis. The PCR method refers to fluorescent quantitative PCR (Flurogenic Quantitative Polymerase Chain Reaction, FQ-PCR), also known as real-time quantitative PCR (real-time quantitative PCR, RT-qPCR) or quantitative PCR (qPCR), which is a quantitative test technology. It uses fluorescent dyes or fluorescently labeled specific probes to mark and track PCR products to monitor the reaction in real time, obtain amplification curves, analyze the products using software suitable for it, and calculate the initial concentration of the nucleic acid template of the sample to be tested.

[0031] In the specific test, female cervical swab / vaginal swab or male urethral swab can be used as the test sample. The specific test steps are as follows: (1) Sample processing: Add 1-3 mL of saline (enzyme-free sterile water) to the swab sample, let it stand for 5 minutes to fully soak the swab head, vortex and shake for 2 minutes to fully remove the pathogens and cells on the swab into the liquid, and use it as the sample to be tested after instant centrifugation. If the sample is not tested immediately after processing, it can be stored at -70℃ for future use to avoid repeated freezing and thawing.

[0032] (2) Reagent preparation: Thaw the primer-probe set mixture in the kit at room temperature, shake and mix, and centrifuge briefly for use; thaw the nucleic acid amplification reaction solution at room temperature, shake and mix, and centrifuge briefly for use; prepare the reaction solution according to the number of samples to be tested according to the table below, set up negative controls and positive controls for each test, and when the number of samples to be tested is n, the number of reaction systems to be prepared is N = number of samples to be tested (n) + positive control (1) + negative control (1) + 1. The reaction system preparation is shown in Table 1 below.

[0033] Table 1 Kit Components Component addition volume Nucleic acid amplification reaction solution 17.5μl×N Primer probe mixture 2.5μl×N After mixing the prepared amplification reaction system, dispense it into PCR reaction tubes at a rate of 20 μl / reaction for later use.

[0034] (3) Sample addition: Add 5 μl of negative control, sample to be tested and positive control to the aliquoted system, and the total reaction volume is 25 μl. Close the PCR reaction tube cap tightly, centrifuge briefly at low speed and set aside.

[0035] (4) PCR amplification: Place the PCR tubes in the sample slot of the real-time fluorescence quantitative PCR instrument in order, and set the sample types such as the sample to be tested, negative control, positive control, etc. in turn, and set the sample name at the same time. Select the corresponding fluorescence channel to detect the target gene.

[0036] (5) Result analysis: After the reaction is completed, the results are automatically saved, and the amplification curves of the detection target and the internal standard are analyzed separately. According to the analyzed image, adjust the Start value, End value and Threshold value of the Baseline (taking ABI 7500 as an example, the user can adjust it according to the actual situation. The Start value can be set between 3 and 15, and the End value can be set between 5 and 20 to ensure that the baseline area of ​​all amplification curves is flat; the threshold line height of various fluorescence channels is set to △Rn=6000), click Analyze for analysis, and then record the qualitative results in the Plate window.

[0037] Furthermore, the Ct (Cycle-threshold) value can be obtained according to the fluorescence quantitative PCR amplification curve in the following steps.

[0038] a. Description of the characteristics of the amplification curve: The amplification curve is generally S-shaped and can be divided into a baseline phase, an exponential growth phase, a linear growth phase, and a plateau phase.

[0039] b. Baseline setting: According to the experimental situation, select a region with relatively stable fluorescence background value as the baseline setting range. It is recommended to select 5 to 22 cycles for the baseline.

[0040] c. Threshold setting: A value of ΔRn (corrected reporter fluorescence intensity), automatically determined by the software or manually set, used to determine the Ct value in experimental analysis. The threshold setting should be higher than the baseline and controlled within the exponential growth phase of the amplification curve, generally exceeding the highest point of the negative control amplification curve.

[0041] d. Ct value (Cycle-threshold): The intersection of the threshold line and the amplification curve determines the Ct value.

[0042] (6) Quality control: The effectiveness of the experiment was determined based on the Ct value and amplification curve morphology corresponding to the detection results of each fluorescent channel.

[0043] The present invention is further described in detail below in conjunction with examples, but the embodiments of the present invention are not limited thereto.

[0044] 1. Sample type: The samples tested in the following examples are from female cervical swabs / vaginal swabs or male urethral swabs.

[0045] 2. Sample collection: Collect samples according to the reproductive tract specimen collection method in the "Guidelines for Clinical Specimen Collection".

[0046] 3. Sample storage and transportation: The samples to be tested can be processed immediately. Specimens tested within 24 hours can be stored at 4°C. Specimens that cannot be tested within 24 hours should be stored at -70°C or below (if -70°C storage conditions are not available, the samples to be tested can be stored at -20°C for 30 days, and nucleic acid samples can be stored at -20±5°C for 30 days). Repeated freezing and thawing should be avoided. Samples should be transported in iced ice bottles or sealed foam boxes.

[0047] Example 1: Preparation of Reagents The following sequences were synthesized using a DNA synthesizer via the solid phase phosphoramidite triester method: Primer probe set A: contains primer MG-F, primer MG-R, and probe MG-P; Primer probe set B: contains primer Uu-F, primer Uu-R.1, primer Uu-R.2, probe Uu-P; Primer probe set C: contains primer CT-F, primer CT-R, and probe CT-P; Internal standard primer probe set RP: including primer RP-F, primer RP-R, probe RP-P; Among them, the probe MG-P is labeled with FAM, the probe RP-P is labeled with VIC, the probe Uu-P is labeled with CY5, and the probe CT-P is labeled with ROX.

[0048] Positive control: pseudovirus containing gene sequences of Mycoplasma genitalium (OK556696.1), Ureaplasma urealyticum (AF085733.2), and Chlamydia trachomatis (OP611864.1).

[0049] Negative control: pseudovirus containing the internal standard gene sequence (U77665.1).

[0050] PCR reaction solution (purchased from Hanhai New Enzyme Biotechnology Co., Ltd.): contains Taq DNA polymerase, UNG enzyme, dA / G / C / UTPs, magnesium ions, sodium chloride, and Tris.

[0051] Comparative Example 1: Primer Probe Set A' The primer probe set A' designed in this comparative example is used to directly detect the genitalium Mycoplasma mgpB gene, and is also selected in the conserved region of the mgpB gene, but the upstream primer is selected in the 90th to 118th base region of the mgpB gene sequence, as shown in SEQ ID NO: 14, the probe is selected in the 120th to 152nd base region on the mgpB gene sequence, as shown in SEQ ID NO: 15, and the downstream primer is selected in the 171st to 197th base region of the mgpB gene sequence, as shown in SEQ ID NO: 16. The primer probe set A' is as follows: Primer MG-F′: TAATGTTAGTGATGATAATCTCAAGTATC; Primer MG-R′: TATAAAGCTCTACCGTTGTTATCATAC; Probe MG-P': CAATGATGTTGAGAAATACCTTGATGATCAGCA.

[0052] Comparative Example 2: Primer Probe Set B' The primer probe set B' designed in this comparative example is used to directly detect the ureaplasma urealyticum ureB gene, and is also selected in the conserved region of the ureB gene, but the upstream primer is selected in the 38th to 59th base region of the ureB gene sequence, as shown in SEQ ID NO: 17, the probe is selected in the 71st to 94th base region on the ureB gene sequence, as shown in SEQ ID NO: 18, and the downstream primer is selected in the 108th to 128th base region of the ureB gene sequence, as shown in SEQ ID NO: 19. The primer probe set B' is as follows: Primer Uu-F′: CTTTGAGTTCTGCTTCCTCCTT; Primer Uu-3′: AAACCTTCCCACAGAATTCCG; Probe Uu-P': CTGTGGGGAATCCTGCTGAACCAA.

[0053] Comparative Example 3: Primer Probe Set C' The primer probe set C' designed in this comparative example is used to directly detect the ompA gene of Chlamydia trachomatis. It is also selected in the conserved region of the ompA gene, but the upstream primer is selected in the 24th to 45th base region of the ompA gene sequence, as shown in SEQ ID NO: 20, the probe is selected in the 81st to 105th base region on the ompA gene sequence, as shown in SEQ ID NO: 21, and the downstream primer is selected in the 108th to 128th base region of the ompA gene sequence, as shown in SEQ ID NO: 22. The primer probe set A' is as follows: Primer CT-F′: ATTAGTATTTGCCGCTTTGAGT; Primer CT-R′: AAACCTTCCCACAGAATTCCG; Probe CT-P': TCCTGCTGAACCAAGCCTTATGATC.

[0054] Example 2: Primer-probe single-plex verification The primers and probes of Mycoplasma genitalium, Ureaplasma urealyticum, Chlamydia trachomatis and RP genes involved in the above Example 1, Comparative Examples 1 to 3 were respectively prepared with PCR reaction solution to prepare amplification reaction solution (the final concentration of each upstream and downstream primer was 50-500nM, and the final concentration of the probe was 25-250nM), and Mycoplasma genitalium, Ureaplasma urealyticum, Chlamydia trachomatis and RP pseudovirus were respectively added as templates to the nucleic acid amplification reaction solution, and the final volume was 25μl. The PCR tube was placed in a real-time fluorescence quantitative PCR instrument, and PCR amplification was performed according to the following program: 50°C 2min, 95°C 2min, 95°C 15sec, 55°C 45sec, 45cycles.

[0055] The experimental results are as follows Figures 1 to 4 , as shown in Table 2.

[0056] Table 2

[0057] Depend on Figures 1 to 4 As can be seen from Table 2 above, when the primer-probe schemes for Mycoplasma genitalium, Ureaplasma urealyticum, and Chlamydia trachomatis of Example 1 and Comparative Examples 1 to 3 amplify the corresponding target pseudoviruses, the amplification curves of the gradient diluted templates are evenly spaced, and the fluorescence amount is in line with expectations. Although the Ct values ​​of the amplification curves of Comparative Examples 1 to 3 are slightly larger than those of Example 1, they can be combined into a multiple system for further evaluation after testing and verification.

[0058] Example 3: Quadruple Primer Probe Set Mix Four primer probe groups were combined into a quadruple system, wherein the primer probe group A, primer probe group B, primer probe group C, and internal standard primer probe group RP of Example 1 were synthesized into quadruple system I; the primer probe group A', primer probe group B', primer probe group C', and internal standard primer probe group RP of Comparative Examples 1 to 3 were synthesized into quadruple system II, and then different concentrations of Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis pseudoviruses were amplified respectively.

[0059] The experimental results are as follows Figures 5 to 8 , as shown in Table 3.

[0060] Table 3

[0061] Depend on Figures 5 to 8 It can be seen that after Mycoplasma genitalium, Ureaplasma urealyticum, Chlamydia trachomatis and internal standard primers and probes were combined into a quadruple primer-probe mixture in quadruple system I and quadruple system II, when Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis were amplified respectively under the condition of adding internal standard template, the linear shape of amplification curves and fluorescence increments of each target in quadruple system I were not significantly different from those of single-plex, indicating that when Mycoplasma genitalium, Ureaplasma urealyticum, Chlamydia trachomatis and internal standard RP primer-probe were combined into a quadruple mixture, there was no inhibitor interference between the targets, and the internal standard template had no effect or inhibition on the other three targets; in quadruple system II, the fluorescence increments of Ureaplasma urealyticum, Chlamydia trachomatis and internal standard were not much different, but the fluorescence increment of Mycoplasma genitalium decreased significantly by about 50%, which may be due to primer or mutual interference between primers, resulting in a decrease in fluorescence increment.

[0062] As can be seen from Table 3 above, in the quadruple system I, Mycoplasma genitalium, Ureaplasma urealyticum, Chlamydia trachomatis and the internal standard RP primer probe are combined into a quadruple amplification system, and the difference in Ct value between the single target amplification curve is ≤1. There is no mutual interference and inhibition between the targets in the quadruple system I. The four sets of primers and probes can be combined into a quadruple primer probe mixture for simultaneous detection of Mycoplasma genitalium, Ureaplasma urealyticum, and Chlamydia trachomatis nucleic acid; while in the quadruple system II, the difference in Ct value between Mycoplasma genitalium in Example 1 and Comparative Example 1 is still large, and combined with the fluorescence amount of the amplification curve, the quadruple system I has better amplification efficiency, so the quadruple system I is selected for subsequent research.

[0063] Example 4: Mycoplasma genitalium / Ureaplasma urealyticum / Chlamydia trachomatis nucleic acid detection kit Prepare the reagents according to the composition in Table 4 below.

[0064] Table 4 Component name Main Ingredients PCR reaction solution Taq DNA polymerase, UNG enzyme, dA / G / C / UTPs, magnesium ions, etc. PCR primers and probes Primers and probes for the Mycoplasma genitalium gene, Ureaplasma urealyticum gene and Chlamydia trachomatis gene from Example 1; internal standard RP gene primers and probes Positive Control Pseudoviruses containing fragments of Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis genes Negative control Pseudovirus containing internal standard RP gene fragment (1) Sample processing (conducted in the sample processing area) Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis pseudoviruses are diluted in a gradient manner using physiological saline, and the dilutions are the samples to be tested.

[0065] (2) Reagent preparation (performed in the reagent preparation area) Take out the nucleic acid amplification reaction solution and primer probe mixture from the kit, thaw at room temperature, shake and mix, and centrifuge briefly for later use. Prepare the reaction solution according to the number of samples to be tested according to the table below. It is recommended to set up negative and positive controls for each test. When the number of samples to be tested is n, the number of reaction systems to be prepared is N = number of samples to be tested (n) + positive control (1) + negative control (1) + 1. Prepare the reaction system as shown in Table 5 below.

[0066] Table 5 Kit Components Volume of components added (μl) Nucleic acid amplification reaction solution 17.5 μl×N Primer probe mixture 2.5 μl×N After mixing the prepared reaction system, dispense 20 μl into PCR reaction tubes and transfer to the sample processing area.

[0067] (3) Sample addition (performed in the sample processing area) Add 5 μl of negative control, sample to be tested and positive control to the aliquoted reaction system, and the total reaction volume is 25 μl. Cover the reaction tube tightly, centrifuge at low speed, and transfer to the detection area.

[0068] (4) PCR amplification (performed in the amplification and analysis area) The PCR amplification procedure is as follows: 50℃ 2min, 95℃ 2min, 95℃ 15sec, 55℃ 45sec 45cycles, Place the PCR tubes in the sample slot of the thermal amplification instrument in order, and set the sample types such as positive control, negative control, and sample to be tested in turn, and set the sample names at the same time. Select FAM, CY5, and ROX channels to detect Mycoplasma genitalium, Ureaplasma urealyticum, and Chlamydia trachomatis, respectively, and select the VIC channel to detect the internal standard gene RP. In the ABI 7500 instrument, both "Quencher Dye" and "Passive Reference" are set to None.

[0069] (5) Results analysis After the reaction is completed, the results are automatically saved, and the amplification curves of the detection target and the internal standard are analyzed separately. According to the analyzed image, adjust the Start value, End value and Threshold value of the Baseline (taking ABI 7500 as an example, the user can adjust it according to the actual situation. The Start value can be set between 3 and 15, and the End value can be set between 5 and 20 to ensure that the baseline area of ​​all amplification curves is flat; the threshold line height of the four fluorescence channels is set to △Rn=6000), click Analyze for analysis, and then record the qualitative results in the Plate window.

[0070] (6) Quality control (determination of experimental effectiveness) Each reference substance in the kit must meet the following requirements, as shown in Table 6 below, otherwise the experiment will be considered invalid.

[0071] Table 6

[0072] Positive judgment value: Through reference value research, it was determined that the Ct reference value of this kit for detecting the target gene is 38, and the reference value of the internal standard Ct is 38.

[0073] Further, under the premise that the experiment is valid, the test results are determined according to the following Tables 7 and 8, where Table 7 is used for the Ct value of each fluorescent channel and the positive and negative result judgment, and Table 8 is used for the result judgment.

[0074] Table 7

[0075] Table 8

[0076] Note: "+" indicates positive, "-" indicates negative; Example 5: Clinical sample testing (Mycoplasma genitalium) The nucleic acid detection kit of Example 4 was used to directly detect 5 clinical samples of Mycoplasma genitalium collected and to perform nucleic acid extraction and detection (using the nucleic acid extraction kit of Beijing Jijian Medical Technology Co., Ltd.) for comparison and verification. The test results are as follows Fig. 9 and Fig.10 shown.

[0077] Furthermore, the test results of 5 clinical samples of Mycoplasma genitalium after direct detection and nucleic acid extraction were analyzed, and their Ct values ​​are shown in Table 9.

[0078] Table 9

[0079] As shown in Table 9, the Ct values ​​of the results of direct detection of 5 clinical samples of Mycoplasma genitalium were all smaller than the Ct values ​​of the detection results after nucleic acid extraction, and the Ct values ​​of direct detection were about 0.5 to 1.9 smaller than the Ct values ​​of detection after nucleic acid extraction. The comparison results show that the detection sensitivity of direct detection using the nucleic acid detection kit of Example 4 is higher.

[0080] Example 6: Clinical sample detection (Chlamydia trachomatis) The nucleic acid detection kit of Example 4 was used to directly detect 6 clinical samples of Chlamydia trachomatis collected and to perform nucleic acid extraction and detection (using the nucleic acid extraction kit of Beijing Jijian Medical Technology Co., Ltd.) for comparison and verification. The test results are as follows Fig.11 and Fig.12 shown.

[0081] Furthermore, the test results of 6 clinical samples of Chlamydia trachomatis after direct detection and nucleic acid extraction were analyzed, and their Ct values ​​are shown in Table 10.

[0082] Table 10

[0083] As shown in Table 10 above, the Ct values ​​of the direct detection results of the 6 clinical samples of Chlamydia trachomatis are smaller than the Ct values ​​of the detection results after nucleic acid extraction, which are about 0.29 to 2.86 smaller. The comparison results show that the direct detection sensitivity of the nucleic acid detection kit of Example 4 is higher.

[0084] Example 7: Clinical sample testing (Ureaplasma urealyticum) The nucleic acid detection kit of Example 4 was used to directly detect 22 clinical samples of Ureaplasma urealyticum collected and to compare and verify the results after nucleic acid extraction (using the nucleic acid extraction kit of Beijing Jijian Medical Technology Co., Ltd.). The test results are as follows: Fig.13 and Fig.14 shown.

[0085] Furthermore, the test results of 22 Ureaplasma urealyticum clinical samples after direct detection and nucleic acid extraction were analyzed, and their Ct values ​​are shown in Table 11.

[0086] Table 11

[0087] As shown in Table 11, the Ct values ​​of the direct detection results of 14 clinical samples of Ureaplasma urealyticum are smaller than the Ct values ​​of the detection results after nucleic acid extraction, which are about 0.21 to 3.3 smaller. The direct detection and nucleic acid extraction of 8 negative samples are all negative, and the accuracy is consistent. The comparison results show that the direct detection using the nucleic acid detection kit of Example 4 has good accuracy and higher sensitivity.

[0088] Example 8: Comparison with reagents from other manufacturers The nucleic acid detection kit of Example 4 and the Ureaplasma urealyticum nucleic acid detection kit (fluorescence PCR method) (with its own extraction reagent) that has been registered and approved for marketing were used to detect 18 clinical samples. The test results are as follows: Fig.15 and Fig.16 shown.

[0089] Furthermore, the test results of 18 Ureaplasma urealyticum clinical samples directly tested and after nucleic acid extraction were analyzed, and their Ct values ​​are shown in Table 12.

[0090] Table 12

[0091] As shown in Table 12 above, the positive and negative consistency rate of the nucleic acid detection kit test results of Example 4 and the test results of the kit that has been registered and approved is 100%, and the Ct value of the nucleic acid detection kit test results of Example 4 is smaller than the Ct value of the test results of the reagents of other manufacturers, which is about 0.07 to 1.43 smaller. The comparison results show that the direct inspection using the nucleic acid detection kit of Example 4 has good accuracy and higher sensitivity.

[0092] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any form. Any simple modification or equivalent changes made to the above embodiments based on the technical essence of the present invention shall fall within the protection scope of the present invention.

Claims

1. A primer probe set for the joint detection of Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis, characterized in that: The invention comprises a primer probe set A for directly detecting the mgpB gene of Mycoplasma genitalium, a primer probe set B for directly detecting the ureB gene of Ureaplasma urealyticum, and a primer probe set C for directly detecting the ompA gene of Chlamydia trachomatis. The primer probe set A comprises: Primer MG-F: AGAARTACCTTGATGRTCAGC, Primer MG-R: CATATAAAGCTCTACCGTTGTTATC, Probe MG-P: ACTTTGCAATCAGAAGGT; The primer probe set B comprises: Primer Uu-F: CGTGTTCCGRCTAAATCAATA, Primer Uu-R.1: CGAAGACAAAGAACGTAAAGT, Primer Uu-R.2: TGAAGATAAAGAACGCAAAGT, Probe Uu-P: CGAATAGCAGTACCTGATGGAATATCGA; The primer probe group C comprises: Primer CT-F: AGATCCTTGCGATCCTTGC, Primer CT-R: ACACGGTCGAAAACAAAGTC, Probe CT-P: CCACTTGGTGTGACGCTATCAGCATG.

2. The primer probe set according to claim 1, characterized in that: Also included is an internal standard primer probe set RP for monitoring the entire detection process.

3. The primer probe set according to claim 2, characterized in that: The internal standard primer probe group RP includes: Primer RP-F: AGATTTGGACCTGCGAGC; Primer RP-R: GAGCGGCTGTCTCCACAAGT; Probe RP-P: TTCTGACCTGAAGGCTCTGCGCG.

4. A kit for the combined detection of Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis, characterized in that: The kit comprises a PCR reaction solution and the primer probe set according to any one of claims 1 to 3.

5. The kit according to claim 4, characterized in that: The PCR reaction solution comprises Taq DNA polymerase, UNG enzyme, dA / G / C / UTPs, magnesium ions, sodium chloride and Tris buffer.

Images