A molecular marker tightly linked to the major QTL-qSN.C9 for number of grains per pod in rapeseed and its application

Abstract

The present invention belongs to the technical field of molecular biology and genetic breeding, and discloses a molecular marker closely linked to the major effect QTL qSN.C9 of the number of grains per pod in rapeseed and its application. The major effect QTL locus of the number of grains per pod located by 201 strains of the rapeseed DH population is qSN.C9 The peak SNP marker closely linked to it is seq‑new‑rs45691, located at base 47,898,234 of chromosome C09 of the Darmor V4.1 reference genome of rapeseed, which can explain 24.7% of the phenotypic variance on average, with an average additive effect of ‑2.31. The PARMS marker designed using this SNP was used to test the remaining DH lines, and it was found that it was easy to operate and had clear typing, and had a good selection effect on the number of grains per horn of rapeseed.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and genetic breeding, and particularly relates to a molecular marker tightly linked to a major effect QTL-qSN.C9 of the number of grains per pod of rapeseed and an application thereof. Background Art

[0002] Under the same planting density, the yield of rapeseed depends on the yield per plant, and the yield per plant is directly determined by the three components of the number of siliques per plant, the number of grains per pod, and the grain weight. Studies have shown that the number of siliques per plant has the highest correlation with yield but low heritability, while the grain weight has high heritability but low correlation with yield. The number of grains per pod of rapeseed is not only highly correlated with yield but also has high heritability, which shows that increasing the number of grains per pod is a very effective way to increase yield (Shi et al., 2015). The average number of grains per pod of rapeseed varieties bred in my country in recent years is only about 20 (Zhao Yongguo et al., 2015), which is far lower than the highest level of more than 40 grains per pod in germplasm resources (He Xiaoying et al., 2018), which shows that there is still a lot of room for the improvement of the number of grains per pod of rapeseed varieties. However, if the number of grains per pod of rapeseed varieties is to be greatly improved, in addition to conventional breeding, molecular breeding methods are also needed, which depends on the comprehensive analysis of its genetic basis and the further discovery and utilization of excellent alleles.

[0003] With the continuous development of molecular marker technology, its application in crops is becoming more and more extensive. Grodzicker et al. (1974) created the restriction fragment length polymorphism (RFLP) marker technology. RFLP is the first generation of molecular markers, which has the characteristics of abundant quantity, stable inheritance, specificity, good repeatability, and co-dominance. However, the amount of DNA required for this marker is relatively large; the operation procedure is cumbersome, time-consuming and labor-intensive, and the cycle is long; it is also necessary to use radioactive isotopes to label the probes. These factors limit the widespread use of RFLP markers. AFLP markers combine PCR and RFLP marker technologies and have been widely used in crop genetic diversity research, cytological research, variety purity identification and disease resistance research (Song Shunhua et al., 2006; Yuan Suxia, 2009; Wang Xue, 2004). However, AFLP markers also have some disadvantages: high cost, complex process, high technical difficulty; most markers are dominant markers; high requirements for DNA quality and restriction endonuclease quality. SSR markers, also known as microsatellite DNA markers, have been widely used in crop gene localization, molecular marker-assisted selection, DNA fingerprinting, variety purity identification, germplasm resource preservation and utilization, and genetic diversity analysis (Chen Yeli, 2010; Miao Tiyun, 2007; Jing Zange, 2010; Wang Dongmei, 2011). SSR markers have the advantages of abundant quantity, high polymorphism, simple operation, and low cost, but it is difficult to achieve high-throughput batch detection. In the past decade, with the continuous advancement of sequencing technology, it has become possible to develop molecular markers based on genome sequence information, such as SNP markers and InDel markers (Hyten et al., 2010). At present, whole genome selection breeding chips have only been tried in rice (Yu et al., 2014), and other crops such as rapeseed are still mainly based on molecular marker-assisted selection. At present, SNP detection methods are mainly divided into two categories: one is the traditional detection method based on gel electrophoresis, represented by single-strand conformation polymorphism (SSCP), denaturing gradient gel electrophoresis (DDGE), restriction amplification polymorphic sequence (CAPS), allele-specific PCR (AS-PCR), etc., and the other is the high-throughput and highly automated detection method represented by direct sequencing, DNA chips, denaturing high-performance liquid chromatography (DHPLC), mass spectrometry detection technology, high-resolution melting curve (HRM), etc. These two methods have their own advantages and disadvantages. At present, there are detection methods that combine the two, such as KASP (Lister et al., 2013) and PARMS (Lu et al., 2020), which are not only simple to operate and low-cost, but also can achieve high-throughput detection.

[0004] The number of grains per horn is a typical complex quantitative trait controlled by multiple genes, with a continuous phenotype and easily affected by environmental conditions. Using linkage mapping and association mapping methods, thousands of QTLs have been located in rapeseed, involving many important traits such as yield, plant type, quality and resistance (Hu et al., 2017). To date, more than 100 QTLs for the number of grains per horn have been located on 19 chromosomes of rapeseed (Radoev et al., 2008; Shi et al., 2009; Wang et al., 2010; Ding et al., 2012; Shi et al., 2013; Cai et al., 2014; Qi et al., 2014; Shi et al., 2015; Wang et al., 2010; Yang et al., 2016; Zhang et al., 2011; Zhang et al., 2012; Sun et al., 2020; Zhu et al., 2020), while a few major QTLs have been detected on chromosomes A1, A6, A7, A8, C1 and C9, such as qSN.A6 (Shi et al., 2015; Yang et al., 2016), qSN.A8 (Jiao et al., 2021) and qSS.C9 (Li et al., 2015).

[0005] The present invention uses rapeseed DH population to conduct multi-environment QTL positioning analysis on the number of grains per horn in rapeseed, aiming to find new major effect loci that have an improvement effect on the number of grains per horn in rapeseed, and based on this, develop practical high-throughput and low-cost molecular markers for selecting the number of grains per horn in rapeseed. Summary of the invention

[0006] The purpose of the present invention is to provide an application of a reagent for detecting bases at positions 47, 898, 234 on chromosome C09 of Brassica napus in the screening and breeding of the number of grains per horn of Brassica napus.

[0007] Another object of the present invention is to provide the use of primers for detecting bases 47, 898, 234 on chromosome C09 of Brassica napus in the screening and breeding of Brassica napus by the number of grains per horn.

[0008] The last object of the present invention is to provide a method for screening and breeding Brassica napus by the number of grains per horn.

[0009] In order to achieve the above object, the present invention adopts the following technical measures:

[0010] Obtaining the tightly linked PARMS markers for the major QTL for the number of seeds per horn in rapeseed:

[0011] (1) 3S1181 and 3S1235 were selected from the rapeseed-associated population constructed in our laboratory as parents for emasculation and hybridization. The hybrid F1 was subjected to microspore culture and colchicine doubling to obtain 360 DH lines.

[0012] (2) 201 DH lines were randomly selected from the above 360 ​​DH lines for genotyping analysis using the rapeseed 50K-SNP chip, and 31,920 SNP markers were obtained and statistically analyzed. SNP markers with missing or no polymorphism in parental genotypes, missing or high heterozygous frequency in population genotypes, and too low minor allele frequency were removed. The remaining high-quality SNP markers were imported into Join map 4.0 software for linkage mapping analysis, and a high-density genetic linkage map containing 2,111 bins (including 8,905 markers) was constructed.

[0013] (3) The above 360 ​​DH lines were planted in three environments: 2017 Jingzhou, 2017 Xiangyang, and 2017 Yangluo (codenamed 17JZ, 17XY, and 17YL), and 10 representative individual plants were harvested from each plot at maturity.

[0014] (4) Based on the above high-density genetic linkage map, the genotypes of 201 DH lines and the phenotypic data of grain number per horn, QTL positioning was performed using QTLCart2.5 software, and finally the major QTL locus -qSN.C9 was obtained on chromosome C09 of the rapeseed DarmorV4 reference genome. Its peak SNP marker seq-new-rs45691 was located at the 47,898,234th base (the base was T / A or C / G), which could be repeatedly detected in three environments.

[0015] (5) Sequences of 100 bp upstream and downstream of base 47, 898, and 234 of rapeseed C09 chromosome were extracted, and the PARMS detection primer sequences were obtained according to the primer design principles: qSN.C9F: TATTATCAAGAAATCTGCAACCATG; qSN.C9Rt: GAAGG TGACCAAGTTCATGCT TGTGAGTTGAGTCTCACAATTGTTT;qSN.C9Rc: GAAGGTCGGAGTCAACGGATT TGTGAGTTGAGTCTCACAATTGTTC.

[0016] The protection scope of the present invention includes:

[0017] Application of a reagent for detecting bases 47,898,234 on chromosome C09 of Brassica napus in the selection and breeding of Brassica napus seeds per pod.

[0018] The reagents described above are preferably primers.

[0019] The primers mentioned above are preferably the PARMS detection primers provided by the present invention.

[0020] A method for screening and breeding of Brassica napus by the number of grains per horn comprises detecting the 47,898,234th bases of the Brassica napus C09 chromosome by conventional schemes in the art, wherein the conventional schemes include but are not limited to: sequencing method, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PAR MS method, gene chip method, and mass spectrometry.

[0021] The version number of the Brassica napus genome used in the present invention is Darmor-bzh (Version 4.1) https: / / www.genescope.cns.fr / brassicanapus / .

[0022] Compared with the prior art, the present invention has the following advantages:

[0023] (1) The present invention obtained the major QTL locus qSN.C9 for the number of grains per horn of rapeseed, which can be detected repeatedly and can explain an average of 24.7% of the phenotypic variance. The average additive effect is -2.31, and the enhancing allele comes from the second parent 3S1235.

[0024] (2) The present invention obtains a PARMS marker tightly linked to qSN.C9, and the detection method thereof is simple and low-cost, and high-throughput screening can be performed on regions linked to the number of seeds per corner, thereby improving selection efficiency and accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Frequency distribution of the number of grains per horn phenotype of 201 DH lines of rapeseed in three environments. DETAILED DESCRIPTION

[0026] The technical solutions described in the present invention, unless otherwise specified, are all conventional techniques in the art; the reagents or materials described, unless otherwise specified, are all from commercial channels. The version number of the Brassica napus genome used in the present invention is Darmor-bzh (Version 4.1) https: / / www.genoscope.cns.fr / brassicanapus / .

[0027] Embodiment 1:

[0028] Obtaining the tightly linked SNP markers for the major QTL-qSN.C9 for the number of seeds per horn in rapeseed:

[0029] (1) 3S1181 and 3S1235 were selected as parents from the rapeseed association population constructed in our laboratory (Li et al., 2020) for emasculation and hybridization, and the hybrid F1 was cultured with microspores and doubled with colchicine to obtain 360 DH lines. 201 strains were randomly selected from the 360 ​​DH population lines, and the leaves were collected and the total DNA was extracted using the CTAB method. The genotype of each sample was analyzed using the rapeseed 50K-SNP chip (https: / / www.greenfafa.com / index.php?a=lists&catid=48), and 31,920 SNP markers were obtained and statistically analyzed. Markers with missing or no polymorphism in parental genotypes, high missing ratio or heterozygosity of population genotypes, and low minor allele frequency were filtered out.

[0030] (2) The remaining high-quality SNP markers were imported into Joinmap4.0 software for mapping, and a high-density genetic linkage map was obtained: it contained 19 linkage groups with a total length of 1715.7 cM; it included 2111 bins and 8905 SNP markers; the marker density was 3.37 bins and 14.2 SNP / Mb.

[0031] (3) 360 DH lines were planted in three environments (codenamed 17JZ, 17XY, and 17YL) in 2017 Jingzhou, 2017 Xiangyang, and 2017 Yangluo. At maturity, 10 representative plants were selected from each plot, harvested, and dried. All valid siliques on the main sequence were counted and threshed, and the SC-G automatic seed counting instrument was used to count and weigh the grains, and the average number of grains per silique was calculated. A statistical analysis of the number of grains per silique in the four environments of the above 201 DH lines was performed, and it was found that the number of grains per silique in each environment showed a large variation range and was normally distributed ( Figure 1 ), which can be directly used for subsequent QTL positioning.

[0032] (4) Based on the genotype, SNP marker genetic map and grain number per horn of the DH population, QTL linkage analysis was performed using QTLCart2.5 software. The major QTL locus qSN.C9 for grain number per horn was obtained on chromosome C09 (Table 1), which could be repeatedly detected in three environments. Its peak SNP marker seq-new-rs45691 was located at base 47,898,234 (T / A or C / G) of the DarmorV4.1 reference genome, which could explain an average of 24.7% of the phenotypic variance. The average additive effect was -2.31. The theoretical difference in grain number per horn between the two homozygous genotypes was 4.62.

[0033] Table 1. Information of the major QTL for number of grains per horn -qSN.C9

[0034] environment Genetic position (cM) LOD value Additive effect Contribution rate (%) 17JZ 72.21 8.4 -1.79 17.2 17XY 55.61 11.5 -1.82 24.2 17YL 68.81 10.4 -3.33 32.9

[0035] Embodiment 2:

[0036] Development of a PARMS marker tightly linked to kernel number per horn:

[0037] The linkage markers obtained in Example 1 are derived from the SNP chip, which only has the probe sequence information used for molecular hybridization. The rapeseed SNP chip can detect tens of thousands of sites at a time, but its operation is relatively cumbersome and requires special equipment. In addition, it is expensive to use the rapeseed SNP chip to detect a large number of intermediate breeding materials, so it is necessary to convert it into a simple and low-cost PCR amplification-based detection method, such as PARMS (Penta-primer Amplification Refractory Mutation System) marker. This marker system includes a pair of fluorescent universal primers (FAM and HEX as reporter fluorescence), a pair of SNP allele-specific primers and a reverse shared primer, which can quickly and easily perform SNP allele type detection.

[0038] (1) For the peak SNP marker seq-new-rs45691 that is closely linked to qSN.C9, extract the 100 bp sequence upstream and downstream of the 47,898,234th base of the rapeseed Darmor V4.1 reference genome C09 chromosome. According to the primer design principle, the PARMS marker detection primer sequence is obtained as follows:

[0039] qSN.C9F: TATTATCAAGAAATCTGCAACCATG;

[0040] qSN.C9Rt: GAAGGTGACCAAGTTCATGCT TGTGAGTTGAGTCTCACAATTGTTT;

[0041] qSN.C9Rc: GAAGGTCGGAGTCAACGGATT TGTGAGTTGAGTCTCACAATTGTTC.

[0042] (2) Using the genomic DNA of the rapeseed DH linkage population as a template, the above primers were used for fluorescence quantitative PCR amplification, and Tecan F200 was used to scan the FAM and HEX signals and output the results, which were finally converted into genotypes.

[0043] Using the above primers, the sequence amplified in 3S1181 is: TATTATCAAGAAATCTGCAACCATGGA AGCGAGAGACTT G AACAATTGTGAGACTCAACTCACA

[0044] The sequence amplified in 3S1235 is: TATTATCAAGAAATCTGCAACCATGGAAGCGAGAGACTT A AACAATTGTGAGACTCAACTCACA.

[0045] Example 3: Application of PARMS markers in the selection of rapeseed kernels per horn

[0046] Of the 360 ​​DH lines, 159 were left except for the 201 used for QTL mapping. Using the PA RMS marker qSN.C9 provided in Example 2, 101 materials with genotype AA / TT and 49 materials with genotype GG / CC were detected (Table 2). The difference in the number of grains per horn between the AA and GG genotypes reached a very significant level in all three environments, with a difference ranging from 4.16 to 5.63, and a mean of 4.72.

[0047] Table 2. Phenotypes of two genotypes of PARMS marker qSN.C9 in DH population with respect to number of grains per horn and number of grains per horn

[0048]

[0049]

[0050] The above results indicate that the prepared PARMS molecular marker qSN.C9 has a significant effect on the number of grains per horn of rapeseed and has a good screening effect.

Claims

1. Application of a reagent for detecting the genotype of base 47,898,234 of chromosome C09 of Brassica napus in selective breeding based on the number of grains per horn, wherein the version number of the genome of Brassica napus is Darmor-bzh Version 4.

1.

2. The use according to claim 1, wherein the reagent is a primer.

3. The use according to claim 2, wherein the primers are: qSN.C9F: TATTATCAAGAAATCTGCAACCATG; qSN.C9Rt: GAAGGTGACCAAGTTCATGCTTGTGAGTTGAGTCTCACAATTGTTT; qSN.C9Rc: GAAGGTCGGAGTCAACGGATTTGTGAGTTGAGTCTCACAATTGTTC.

4. A method for screening and breeding Brassica napus by the number of seeds per horn, the method comprising detecting bases 47, 898, 234 of chromosome C09 of Brassica napus, the method comprising: Sequencing method, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method or mass spectrometry method, and the version number of the Brassica napus genome is Darmor-bzh Version 4.1.

Images