Biomolecular device array based on DNA skeleton and construction method and application thereof

Abstract

The invention discloses a biomolecular device array based on a DNA skeleton, a construction method of the biomolecular device array and application of the biomolecular device array in biomass-based electronic devices, logic circuits and information storage. The biomolecular device array based on the DNA skeleton comprises a conductive substrate, a conductive probe and a DNA-functional protein compound system which form a conductive loop, wherein the DNA-functional protein compound system is positioned between the conductive substrate and the conductive probe. The construction method comprises the following steps: designing and preparing DNA tile monomers, and assembling to obtain a DNA two-dimensional skeleton structure; mixing and assembling the functional protein and the DNA two-dimensional skeleton structure to obtain a DNA-functional protein compound system; incubating and fixing the DNA-functional protein compound system on a conductive substrate, and enabling a conductive probe to be in contact with the DNA-functional protein compound system to form a DNA-functional protein biomolecular knot loop system through connection, so as to obtain the biomolecular device array based on the DNA skeleton.

Description

Technical Field

[0001] The present invention relates to the field of bioelectronic devices, and in particular to a biomolecular device array based on a DNA skeleton, a construction method thereof, and applications in biomass-based electronic devices, logic circuits, and information storage. Background Art

[0002] In recent years, the field of biomolecular electronics has developed rapidly, and new bioelectronic devices represented by protein-based memristors have continued to emerge. However, in the process of practical application, problems such as difficulty in integration, insufficient functionality, and high thresholds for R&D and manufacturing have severely restricted the widespread application and sustainable development of biomolecular devices, becoming a bottleneck problem that restricts their progress from principle research to actual production and life. How to fully explore the structural, performance, and assembly advantages of bio-based materials compared to traditional electronic materials, and further develop new methods for manufacturing biomolecular devices, is one of the important challenges facing the current field of bioelectronics.

[0003] To construct memristor devices using biomolecules and realize their applications, it is necessary to achieve precise control of single functional primitives to understand and manipulate the electronic charge transfer process mediated by biomolecules; it is also necessary to achieve array integration of multiple functional primitives to meet the application requirements of large-scale parallel computing. In short, it is to solve the two key problems of "functionality" and "integration".

[0004] For the "functionality" of single-point regulation, current research mainly focuses on developing targeted regulation methods by precisely connecting biological molecules between two electrodes, measuring their current response under bias voltage, exploring their conductive characteristics and conducting systematic mechanism research. The construction of biological single-molecule circuits is the technical key to achieving single-point regulation. Conductive atomic force microscopy (cAFM) can accurately connect target molecules between conductive probes and conductive substrates. Its advantage is that it can simultaneously measure the electrical and mechanical properties of biological molecules, and the characterization results have high reproducibility. In addition, the study of the internal electrical transport mechanism of biological molecules is the theoretical basis for achieving single-point regulation. Current studies have found that biological molecules have fast and efficient long-distance electron transport characteristics and switchable multiple conductive pathways, showing the unique advantages of biomaterials. Existing research results have laid the technical foundation and theoretical feasibility of functional regulation of biological single-molecule devices, and have proved the structural and performance advantages of biomaterials for electronic devices. However, the study of the single electrical properties of a single molecule cannot meet the development needs of molecular devices towards practical applications. This puts forward new requirements for the assembly and integration technology of existing biomolecular devices.

[0005] Regarding the "integration" problem of array assembly, the solution of existing research is usually to make biomolecules into bulk materials, and then achieve multi-point connectivity in the same device by changing the connection and arrangement of the electrodes at both ends. However, the construction of these devices depends on sufficiently precise and accurate bottom / top electrodes, and is still limited by the current "top-down" micro-nano processing technology. Existing problems include unclear conduction mechanisms within bulk materials, leakage path problems in cross-arrays that lead to inaccurate device control, and the failure to take advantage of the size of mesoscopic materials, which limits the development of practical applications. Therefore, array integration of biomolecular devices remains a challenging technical direction.

[0006] Therefore, faced with the integration challenges of biomolecular devices, how to give full play to the unique advantages of biomaterials and explore new strategies for constructing bioelectronic devices with their characteristics remains a challenging topic. Summary of the invention

[0007] In view of the above-mentioned technical problems and deficiencies in the art, the present invention provides a biomolecular device array based on a DNA skeleton and a construction method and application thereof, which can solve the problems of precise regulation and array integration of biomolecular devices in the process of practical application.

[0008] The specific technical solutions are as follows:

[0009] In a first aspect, the present invention provides a biomolecular device array based on a DNA backbone, comprising a conductive substrate forming a conductive loop, a conductive probe, and a DNA-functional protein complex system, wherein the DNA-functional protein complex system is located between the conductive substrate and the conductive probe.

[0010] The material of the conductive substrate can be selected from Au, Si or HOPG (Highly Oriented Pyrolytic Graphite) and the like.

[0011] In some embodiments, the conductive probe may be connected to and controlled by a (conductive) atomic force microscope.

[0012] The functional protein in the DNA-functional protein complex system may be one or more combinations. For example, the functional protein may include at least one of STV (streptavidin), ferritin, etc. Among them, the ferritin may be specifically exemplified by human H-chain ferritin (HuHF), etc.

[0013] In some embodiments, the DNA-functional protein complex system may be a DNA-STV complex system, a DNA-ferritin complex system or a DNA-STV-ferritin complex system.

[0014] The DNA-functional protein complex system includes a DNA two-dimensional skeleton structure formed by assembling DNA tile monomers and a functional protein connected to the DNA two-dimensional skeleton structure. The DNA tile monomer can be assembled from a designed DNA single strand. As the smallest repetitive unit, the DNA tile can be connected to each other through the principle of complementary pairing of sticky end bases to form a DNA two-dimensional skeleton structure. The functional protein is connected to the DNA two-dimensional skeleton structure through a bioconjugate molecule. The bioconjugate molecule is modified on one or more DNA single strands constituting the DNA tile. When the functional protein includes STV, as an example, when the DNA-functional protein complex system is a DNA-STV complex system, the bioconjugate molecule includes biotin, and biotin can be modified on a certain (e.g., middle position) T base of the DNA tile monomer. When the functional protein includes ferritin, as another example, the DNA-functional protein complex system is a DNA-ferritin complex system, and the bioconjugate molecule includes 4-(N-maleimidomethyl)cyclohexanecarboxylic acid N-hydroxysuccinimide ester (SMCC). At this time, the DNA tile monomer may contain at least one DNA single strand modified with a thiol molecule (the DNA single strand may be located in the middle position of the DNA tile monomer), and SMCC is combined with the thiol group. Furthermore, the thiol molecule may be located at one end of the DNA single strand, such as the 3' end. When the functional protein includes STV and ferritin, as another example, the DNA-functional protein complex system is a DNA-STV-ferritin complex system, the bioconjugate molecule includes biotin and SMCC, and the DNA tile monomer contains at least one DNA single strand modified with a thiol molecule (the DNA single strand may be located in the middle position of the DNA tile monomer), SMCC binds to the thiol group, and biotin is modified on a certain T base (for example, in the middle position) in the DNA tile monomer. Furthermore, the thiol molecule may be located at one end of the DNA single strand, such as the 3' end.

[0015] In a second aspect, the present invention provides a method for constructing a biomolecule device array based on a DNA backbone as described in the first aspect, comprising the steps of:

[0016] (1) Design and prepare DNA tile monomers and assemble them to obtain a two-dimensional DNA backbone structure;

[0017] (2) mixing and assembling the functional protein with the DNA two-dimensional skeleton structure to obtain a DNA-functional protein complex system;

[0018] (3) Incubating and fixing the DNA-functional protein complex system on a conductive substrate, contacting the DNA-functional protein complex system with a conductive probe to connect and form a DNA-functional protein biomolecule junction loop system, thereby obtaining the biomolecule device array based on the DNA skeleton.

[0019] In step (1), the DNA tile monomers can be assembled from the designed DNA single strands.

[0020] In step (1), as the smallest repetitive unit, DNA tiles can be connected to each other through the principle of complementary base pairing at the sticky ends to form a DNA two-dimensional skeleton structure.

[0021] In step (1), the DNA two-dimensional backbone structure can be prepared by a programmed annealing process in a thermal cycler.

[0022] In some embodiments, in step (1), the DNA tile monomer contains at least one single-stranded DNA modified with a bioconjugate molecule to allow the DNA tile monomer to be connected to the functional protein.

[0023] In some embodiments, in step (1), the conductive substrate is a gold substrate, and the DNA tile monomer contains at least one DNA single strand modified with a thiol molecule to allow the DNA tile monomer to be connected to the gold substrate. Furthermore, the thiol molecule can be located at one end of the DNA single strand, such as the 3' end.

[0024] In step (2), the functional protein and the DNA two-dimensional skeleton structure can be connected and assembled through bio-coupling agent molecules to obtain a DNA-functional protein complex system.

[0025] In step (2), the bioconjugate molecule can be selected according to the surface properties of the functional protein, pre-modified on the DNA single strand of the DNA tile monomer, and connect the functional protein with the DNA two-dimensional backbone structure during the mixing process of the functional protein and the DNA two-dimensional backbone structure.

[0026] In a third aspect, the present invention provides the application of the DNA-based biomolecular device array described in the first aspect in biomass-based electronic devices, logic circuits or information storage. Furthermore, the DNA-based biomolecular device array can be used for memristors.

[0027] In a fourth aspect, as a general inventive concept, the present invention provides a method for accurately exploring or regulating the electrical properties of a DNA-functional protein complex system circuit by constructing a biomolecular device array based on a DNA backbone, comprising the steps of:

[0028] 1) Design and prepare DNA tile monomers and assemble them to obtain a two-dimensional DNA backbone structure;

[0029] 2) Mixing and assembling the functional protein with the DNA two-dimensional skeleton structure to obtain a DNA-functional protein complex system;

[0030] 3) incubating and fixing the DNA-functional protein complex system on a conductive substrate, and controlling a conductive probe to contact the DNA-functional protein complex system by an atomic force microscope to connect and form a DNA-functional protein biomolecule junction loop system;

[0031] 4) Accurately explore or regulate the electrical properties of the circuit of the DNA-functional protein complex system by adjusting the hardware and / or software parameters of the atomic force microscope.

[0032] The method described in the fourth aspect can refer to the construction method described in the second aspect to further select or optimize the technical solution.

[0033] In addition, in step 4), the setting of fine parameters of the corresponding hardware of the atomic force microscope can independently adjust the bias range and value in the loop, the pulse voltage value and frequency, the probe's needle height and needle duration.

[0034] In step 4), the relevant parameters of the circuit system can also be precisely controlled, and the current response of the system when constant bias, cyclic bias, and pulse voltage are applied can be recorded, and the current response data of functional proteins at different sites in the DNA-functional protein complex system array can be statistically analyzed.

[0035] Compared with the prior art, the present invention has the following beneficial effects:

[0036] The present invention takes the DNA two-dimensional skeleton-functional protein assembly as the core, uses a conductive atomic force microscope to form a molecular device circuit, and flexibly adjusts the structure of the DNA tiles and functional proteins in the device core to achieve the precise construction of biomolecular junction arrays with different electrical characteristics, and further realizes its application in biomass-based electronic devices, logic circuits and information storage.

[0037] The present invention can achieve high-density integration of protein functional elements, has good biocompatibility, diverse structural modifiability and flexible array controllability, and can realize basic electrical characterization of device behavior and further development and application of functional devices.

[0038] Specifically:

[0039] 1. The present invention does not require complicated micro-nano processing technology. Based on the "bottom-up" assembly idea, another biological material DNA is used as the skeleton material. Nano networks of different formations can be flexibly constructed through DNA origami.

[0040] 2. The present invention utilizes the precise restriction of the position and orientation of proteins by the DNA backbone. By adjusting the position of the probe, different protein molecular junctions in the same state can be quickly established, and a large amount of relevant data of the system can be widely collected for statistical analysis.

[0041] 3. The present invention introduces DNA between the protein and the electrode. By controlling the modified structure of the DNA, the coupling strength between the DNA-protein and the electrode can be controlled, thereby affecting the electrical properties of the system.

[0042] 4. The present invention is different from the traditional method of arranging protein arrays using crossed metal electrodes. The use of DNA flexible skeleton to connect proteins can ensure that the system still retains the characteristics of flexible materials, and the assembly can adapt to different roughness and substrate material surfaces. Using atomic force microscopy as a loop architecture, the effects of contact force and bias voltage can be observed simultaneously, and the regulatory effect of contact force on electrical properties in flexible materials such as proteins can be analyzed in parallel. In addition, by precisely adjusting the position of the probe, the length of the conductive path in the flexible system can be controlled, which can directly answer the characteristics of the system's conductivity changing with the path length, a problem that has received widespread attention in the field of molecular electronics. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 Schematic diagram of a process for constructing / precisely exploring or regulating a biomolecular device array based on a DNA backbone.

[0044] Figure 2 Figure 2 shows the morphological characterization results of a DNA two-dimensional skeleton structure (a) and the morphological characterization results of a DNA-STV system (b).

[0045] Figure 3 Figure 2 shows the IV curve superposition density map of the DNA-STV system (a), the conductivity distribution map of the DNA-STV system under different AFM probe contact forces (b), the current response of the DNA-STV system under bias voltages of 0.5 V and 1 V, and the frequency distribution map of the current value (c).

[0046] Figure 4 Comparison of IV curves at different positions in the DNA-ferritin system (a), current response of the DNA-ferritin system under cyclic bias (b), and current response of the DNA-ferritin system under pulse voltage (c). DETAILED DESCRIPTION

[0047] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0048] A biomolecular device array based on a DNA skeleton comprises a conductive substrate, a conductive probe and a DNA-functional protein complex system forming a conductive loop, wherein the DNA-functional protein complex system is located between the conductive substrate and the conductive probe.

[0049] A method for constructing / precisely exploring or regulating the above-mentioned DNA-based biomolecular device array is shown in Figure 1 , specifically including the steps:

[0050] (I) Preparation of DNA backbone structure: Single-stranded DNA is mixed in TE buffer containing 1 mM EDTA (ethylenediaminetetraacetic acid) and 10 mM Tris (tris(hydroxymethyl)aminomethane), and the mixture is programmed to cool from 95°C to 4°C using a thermal cycler, so that the single-stranded DNA is assembled into DNA tiles through the principle of complementary base pairing, and the sticky ends of the DNA tiles are interconnected to form a two-dimensional network backbone.

[0051] The DNA tile structure is the smallest repeating unit of the two-dimensional network. The edges of the tile structure contain sticky ends to allow the tiles to connect to each other through the principle of complementary base pairing.

[0052] The DNA tile structure contains at least one single-stranded DNA modified with a biological coupling agent molecule, so as to allow the DNA tile structure to form a covalent connection with the functional protein through the coupling agent.

[0053] When the conductive substrate is a gold substrate, the DNA tile structure contains at least one single-stranded DNA modified with a thiol molecule, allowing the DNA tile structure to form a covalent bond with the gold substrate, which is beneficial to enhancing the coupling effect with the substrate material and changing the electron transport characteristics in the circuit.

[0054] (II) Connecting the functional protein to the DNA backbone system obtained in step (I): adding 1-1.5 times the molar amount of the functional protein molecule to the DNA backbone buffer system, and promoting the functional protein to bind to the DNA backbone through the biocoupling agent under the coupling reaction conditions corresponding to the biocoupling agent modified on the DNA backbone.

[0055] The bioconjugate molecules are selected according to the surface properties of the target functional protein and are pre-modified at specific positions on specific DNA single strands, so that they can form specific bonds with the protein during the mixing process of the DNA and protein system.

[0056] As one example, the bioconjugate molecule includes biotin, and the DNA tile monomer contains a single-stranded DNA modified with biotin. The biotin is modified on the T base in the middle position of the DNA tile monomer, and excess streptavidin (STV) is added at a molar ratio of biotin: streptavidin (STV) = 1:1.2 to assemble a DNA-STV complex array network.

[0057] As another example, the bioconjugate molecule includes 4-(N-maleimidomethyl)cyclohexanecarboxylic acid N-hydroxysuccinimide ester (SMCC), the DNA tile monomer contains a DNA single strand with a modification group that can be reduced to form a thiol group, the modification group can expose the thiol end after reduction, and SMCC can be combined with the thiol end of the DNA single strand. SMCC is a heterobifunctional cross-linking agent with amine and thiol reactivity, which can connect the thiol end of DNA and the primary amine on the surface of ferritin at both ends of the molecule to assemble into a DNA-ferritin complex array network.

[0058] (III) Using atomic force microscopy to construct a biomolecular device circuit: Incubate the DNA-functional protein complex system on a conductive substrate, and contact the upper surface of the system with a conductive probe to form a circuit. Apply a specific range of bias voltage to the biological system, and record the corresponding current intensity signal in the atomic force microscope configuration software. Adjust the fine parameters of the corresponding atomic force microscope hardware to obtain the corresponding electrical characterization under different circuit characteristics.

[0059] The conductive substrate material may be independently selected from Au, Si or HOPG.

[0060] The fine parameter settings of the corresponding hardware of the atomic force microscope can independently adjust the bias voltage range and value in the circuit, the pulse voltage value and frequency, the probe's needle insertion height and needle insertion time, etc.

[0061] According to the above-mentioned DNA-based biomolecular device array, any one or more combinations of the following specific operations and applications can be performed:

[0062] A DNA-protein molecular junction with a substrate and a probe as two electrodes at both ends was constructed using a conductive atomic force microscope in contact mode. The bias value was adjusted from the substrate side through a console, and the current jump phenomenon was observed under different bias conditions to determine the multi-channel electrical transport properties in the biological system.

[0063] Adjust the position of the probe to establish different molecular junctions, perform mathematical statistical analysis on the electrical signals of the molecular junctions at different positions, and reveal the highest frequency device behavior of the system;

[0064] By controlling variables to compare the device behaviors of different electrode materials, different DNA-electrode coupling effects, different DNA structures and different protein systems, we can comprehensively obtain the influence of various variables in the system on the electrical transport performance of the system, and further analyze the electron transfer mechanism in the system;

[0065] By applying voltage pulses to the system containing memristive functional proteins and recording the current response of the system, the memristive performance of the proteins at each site in the array can be characterized and applied. The bias value is adjusted from the substrate side through the console to make the memristive proteins in different conductance states, and the electrostatic force scanning technology is used to characterize the electrical characteristics of the proteins at each site from the image and apply them.

[0066] Example 1: Construction of DNA-STV array system

[0067] Referring to the above introduction, a class of representative DNA tile structures was designed and constructed, such as Figure 1 . The DNA tile is composed of 9 single-stranded DNA strands. The edges of the tile have unpaired bases as sticky ends, so that the tiles can be connected to each other through complementary base pairing and assembled into a two-dimensional network framework after annealing. The DNA sequence was designed with reference to the 1st to 9th sequences in "DNA-Templated Self-Assembly of Protein Arrays and Highly Conductive Nanowires", Hao Yan, Science, 2003, 301, 1882, DOI: 10.1126 / science.1089389. In order to enhance the interaction between the sticky end bases and the subsequent connection between proteins and substrates, four sequences (S2, S5, S7, S9) were modified during the design process. The specific sequences are as follows (5'-3'):

[0068] S1:GGATAGCGCCTGATCGGAACGCCTACGATGGACACGCCGAC C (SEQ ID NO: 1);

[0069] S2:GAGCGCAACCTGCCTGGCAAGACTCCAGAGGACTACTCATC (SEQ ID NO: 2);

[0070] S3:GACTGAGCCCTGCTAGGATCGACTTCACTGGACCGTTCTACC (SEQ ID NO: 3);

[0071] S4: GTTTGGCTTCCTGTACGGCAGAACTCCGTTGGACGAACACTCC (SEQ ID NO: 4);

[0072] S5: TGTTCGTGGCGCT-(CH2)6-SS-(CH2)6-OH (SEQ ID NO: 5);

[0073] S6: GGCGTGTGGTTGC (SEQ ID NO: 6);

[0074] S7:ATCCGATGAGTAGTGGGCTCAGTCGGAG (SEQ ID NO: 7);

[0075] S8:GCTCGGTAGAACGGTGGAAGCCAACGGTC (SEQ ID NO: 8);

[0076] S9:AGGCACCATCGTAGGTTTTCGTTCCGATCACCAACGGAGTT / iBiodT / TTTCTGCCGTACACCAGTGAAGTTTTTCGATCCTAGCACCTCTGGAGTTTTTCTTGCC (SEQ ID NO: 9). / iBiodT / refers to a biotin-modified T base.

[0077] DNA single-stranded structure (powder state) and streptavidin protein (derived from Streptomyces, product number A610492-0001) were purchased from Sangon Biotechnology (Shanghai) Co., Ltd. The centrifuge tube containing DNA powder was placed in a small centrifuge and centrifuged at 5000r for 3min. After centrifugation, ultrapure water was injected into the tube to obtain a DNA single-stranded solution with a concentration of 10μM. The nine groups of DNA single-stranded solutions were fully mixed on a vortex instrument. TE buffer concentrate with a concentration of 25 times and 1M MgCl2 solution were prepared. Take a clean 200μL centrifuge tube, add nine groups of DNA single-stranded solutions, 25X TE buffer, 1M MgCl2 solution, and ultrapure water until the concentration of each DNA single-strand in the mixed solution is 1.6μM, Tris is 10mM, EDTA is 1mM, pH 8.0, and MgCl2 concentration is 12.5mM. Next, the mixture was divided into 100 μL microcentrifuge tubes and placed in PCR for programmed cooling. The specific annealing procedure is:

[0078] Incubate at 95°C for 5 min;

[0079] 90℃ to 40℃, decrease one degree every 30 minutes;

[0080] 40℃ to 20℃, decrease by one degree every 1.5 hours;

[0081] Store at 4°C.

[0082] The final obtained DNA two-dimensional assembly structure was mixed with streptavidin solution at a molar ratio of 1:1.2, reacted at room temperature for 2 hours, and stored at 4°C overnight to fully ensure that the biotin molecules modified on the DNA-S9 single strand can bind to streptavidin (STV). The final DNA-STV assembly solution was ultrafiltered through a 100K Da ultrafiltration tube. The specific ultrafiltration process is:

[0083] Take 200 μL of the DNA-STV assembly solution and place it in an ultrafiltration tube. Take another ultrafiltration tube of the same type and add 200 μL of pure water to balance.

[0084] Centrifuge at 10000r for 5min, add 200μL 1X TE buffer and pure water to the inner tubes of the two ultrafiltration tubes respectively;

[0085] Centrifuge at 10000r for 10min, add 200μL 1X TE buffer and pure water to the inner tubes of the two ultrafiltration tubes respectively, and repeat 5 times;

[0086] After the last centrifugation, the solution in the inner tube was transferred and fixed to 1.6 μM with 1X TE buffer to obtain the purified DNA-STV assembly solution for subsequent characterization.

[0087] The morphology of the DNA two-dimensional assembly structure and the DNA-STV assembly solution was characterized by atomic force microscopy (AFM) (Asylum Research Cypher ES). The characterization process was carried out in the tapping mode of the liquid phase module, the probe model used was Olympus BL-AC40TS, and the substrate was freshly peeled mica. The characterization results are shown in Figure 2 As shown in the AFM image, the DNA double helix structure can be clearly seen, the DNA backbone structure is a clear two-dimensional network, and STV is successfully assembled on the pre-set biotin modification site.

[0088] The above implementation cases prove that the DNA-protein system construction strategy is feasible and can obtain a good assembly conformation.

[0089] Example 2: Characterization of electrical properties of DNA-STV system

[0090] The DNA-STV assembly can be obtained by referring to the specific method described in Example 1. The assembly solution is incubated on the conductive substrate HOPG, and a high-precision molecular circuit system is constructed using an atomic force microscope. A bias voltage is applied to the system from one side of the HOPG substrate, and the current response of the system is observed by the AFM monitoring software. The specific implementation steps are as follows:

[0091] Take 2 μL of DNA-STV assembly solution and drop it on the surface of the freshly peeled conductive substrate HOPG, add 50 μL incubation buffer (containing 10 mM Tris, 1 mM EDTA, 10 mM MgCl2, 50 mM NaCl), and let it stand for adsorption in a humid environment for 30 minutes. Use an ear-cleaning bulb to gently blow away the droplets on the HOPG surface. Add 50 μL of ultrapure water in situ to wash away the buffer salt ions remaining on the surface, and use an ear-cleaning bulb to gently blow away the droplets on the HOPG surface again, and repeat the washing operation twice. Let the HOPG substrate stand and dry in the shade to obtain a HOPG substrate system with DNA-STV assembly adsorbed on the surface.

[0092] Place the DNA-STV-HOPG sample on the AFM sample stage and connect the sample to the controller through a wire. Take the C-AFM Holder and place the conductive probe, model AC240TM-R3. Lower the probe to the surface of the sample by operating the piezoelectric ceramic, and adjust the Setpoint value of the system to control the actual height of the probe. In the gas phase contact mode, control the probe to contact the upper surface of the sample to form an STV-DNA molecular junction loop with the probe and HOPG as electrodes at both ends.

[0093] First, adjust the Setpoint value to 0.02, corresponding to a contact force of 2nN between the probe and the STV surface. Apply a cyclic bias of 0V-3V-0V-(-3V) to the molecular junction and record the corresponding IV curve. Since this system contains multiple STV sites, the needle can be placed at STV sites at different locations to record the IV curve at each site. The IV curves of 100 sites are superimposed and density analyzed to obtain statistical analysis results, such as Figure 3 a. The most likely current response characteristics of the STV-DNA molecular junction system can be determined through intuitive color classification. Extracting the average value and fitting the tunneling model can determine that the most likely conduction mechanism of the system is the FN tunneling mechanism.

[0094] Next, the contact force between the probe and the STV surface can be changed by adjusting the Setpoint value. Setpoint values ​​of 0.1, 0.2, 0.3, and 0.4 V correspond to probe contact forces of 10, 20, 30, and 40 nN, respectively. Under different contact forces, the conductivity characteristics of the system are different, such as Figure 3 b. The electrical characteristics of the system can be determined by analyzing the position and height of the conductivity peak in the system. By comparison, it can be found that the flexible biomolecule junction will be significantly affected under the pressure of the probe: a larger contact force will make the system's conductivity higher, and the electron transport mechanism inside the system will change significantly.

[0095] In addition, the bias writing time can be increased under the lowest contact force to observe the change of the current in the system over time under the same bias condition. The results are as follows: Figure 3 c. Obvious current jumps can be observed in the figure, which represents the different conductive pathways excited in the STV-DNA molecular junction under the bias condition. By analyzing the frequency distribution of the current values, it is possible to determine the various conductivity states in the system. This multi-path feature reflects the unique electrical properties of protein conductors and lays the structural foundation for protein motifs as electrical switching elements.

[0096] The above implementation cases prove that this scheme can obtain a variety of electrical properties of DNA-protein systems, and has advantages in multi-point statistical analysis and precise control of electrode positions, which is beneficial to the study of the electrical behavior of biomass-based devices.

[0097] Example 3: Construction of DNA-ferritin system and characterization of memristive properties

[0098] A DNA-ferritin coupling system was designed and constructed. By encapsulating a certain amount of iron ions inside ferritin, the redox process of iron ions can be used to give ferritin obvious memristor response characteristics. Ferritin is precisely positioned using a DNA two-dimensional skeleton to construct a biomass-based memristor array system for related applications. The specific implementation steps are as follows:

[0099] Referring to the introduction above, a type of DNA tile structure assembled from a single DNA strand was designed and constructed. DNA tiles can be connected to each other through complementary base pairing and assembled into a two-dimensional network framework after annealing. The DNA sequence was designed with reference to the sequence in Approaching the Limit: Can One DNA Strand Assemble into Defined Nanostructures, Cheng Tian, ​​Langmuir, 2014, 30, 5859, DOI: 10.1021 / la402326b. The sequence was modified to meet the needs of subsequent connection of proteins and substrates. The specific sequence is as follows (5'-3'):

[0100] TGGACCGATTGATAAGACTTCAGGCCGAAGTGGTCCACTTATCA ATC-(CH2)6-SS-(CH2)6-OH (SEQ ID NO: 10)

[0101] DNA single-stranded structure (powder state) was purchased from Sangon Biotech (Shanghai) Co., Ltd. Place the centrifuge tube containing DNA powder in a small centrifuge and centrifuge at 5000r for 3 minutes. After centrifugation, inject ultrapure water into the tube to obtain a DNA single-stranded solution with a concentration of 10μM. Vortex the DNA single-stranded solution. Prepare 25 times the concentration of TE buffer concentrate and 1M MgCl2 solution. Take a clean 200μL centrifuge tube, add DNA single-stranded solution, 25X PBS buffer, 1M MgCl2 solution, and ultrapure water respectively until the concentration of each DNA single-strand in the mixed solution is 3μM, 1X PBS buffer contains NaCl 136.89mM, KCl2.67mM, Na2HPO4 8.1mM, KH2PO4 1.76mM, EDTA 1mM, pH 7.4, and MgCl2 concentration is 20mM. Next, the mixture was divided into 100 μL microcentrifuge tubes and placed in PCR for programmed cooling. The specific annealing procedure is:

[0102] Incubate at 95°C for 5 min;

[0103] 90℃ to 60℃, decrease one degree every 25 minutes;

[0104] 60℃ to 22℃, decrease by one degree every hour;

[0105] Store at 4°C.

[0106] Tri(2-carboxyethyl)phosphine (TCEP) was added to the DNA two-dimensional assembly structure obtained in the above step at a molar ratio of 1:150 to reduce the disulfide bonds in the modified groups of the DNA to expose the thiol termini. The reaction was carried out at room temperature for 2 hours and then used.

[0107] To obtain ferritin biological samples, human H-chain ferritin (HuHF) was used as the target protein. Single subunits of different mutants were obtained by gene cloning and mutation techniques, and the assembly of subunits to complete spherical structures was completed in a buffer system containing a specific iron ion concentration. First, the cDNA encoding the full-length amino acid sequence of HuHF was cloned into the pET-3a vector, and the rHuHF cDNA was mutated using the rapid site-directed mutagenesis technique. The target gene was amplified by PCR and then inserted into Escherichia coli competent cells, from which penicillin-resistant colonies were selected, and the plasmid was extracted and sequenced to confirm the site-directed mutation. The target product was purified from the cell lysate by ion exchange column and dialyzed with buffer to exclude NaCl. The purity was confirmed by polyacrylamide gel electrophoresis (SDS-PAGE), and the product concentration was determined by Lowry method using bovine serum albumin as the standard. Subsequently, the concentrations of iron ions and sodium ions in the buffer solvent were adjusted to complete the assembly process of subunits to complete spherical proteins until a large amount of obvious reddish-brown precipitates visible to the naked eye were produced.

[0108] 4-(N-maleimidomethyl)cyclohexanecarboxylic acid-N-succinimidyl ester (Sulfo-SMCC) bioconjugate was added to the ferritin purification solution at a molar ratio of 1:500, reacted at room temperature for 2 hours, and then ultrafiltered through a 30K Da ultrafiltration tube. The specific ultrafiltration process is:

[0109] Place 200 μL of the ferritin-SMCC mixed solution in an ultrafiltration tube, and take another ultrafiltration tube of the same type and add 200 μL of pure water for balance;

[0110] Centrifuge at 10000r for 5min, add 200μL 1X PBS buffer and pure water to the inner tubes of the two ultrafiltration tubes respectively;

[0111] Centrifuge at 10000r for 10min, add 200μL 1X PBS buffer and pure water to the inner tubes of the two ultrafiltration tubes respectively, and repeat 9 times;

[0112] After the last centrifugation, the solution in the inner tube was transferred and the volume was adjusted to 3 μM with 1X PBS buffer to obtain the purified ferritin-SMCC solution.

[0113] The TCEP-reduced DNA two-dimensional assembly structure was mixed with the ferritin-SMCC solution at a molar ratio of 1:1.5, reacted at room temperature for 4 hours, and stored at 4°C overnight to fully ensure that the modified thiol molecules on the DNA single strand can bind to the maleimide group of SMCC. Finally, the DNA-SMCC-ferritin assembly solution was obtained.

[0114] Take 1.5 μL of DNA-SMCC-ferritin assembly solution and drop it onto the surface of the freshly peeled conductive substrate HOPG, add 50 μL of incubation buffer (containing 1X PBS, 10 mM MgCl2, 50 mM NaCl), and let it stand for adsorption in a humid environment for 30 minutes. Gently blow away the droplets on the HOPG surface with an ear-washing bulb. Add 50 μL of ultrapure water in situ to wash away the buffer salt ions remaining on the surface, and gently blow away the droplets on the HOPG surface with an ear-washing bulb again, and repeat the washing operation twice. Let the HOPG substrate stand and dry in the shade to obtain a HOPG substrate system with DNA-SMCC-ferritin assembly adsorbed on the surface.

[0115] Place the DNA-SMCC-ferritin-HOPG sample on the AFM sample stage and connect the sample to the controller through a wire. Take the Holder of the C-AFM and place a conductive probe, model AC240TM-R3. Lower the probe to the surface of the sample by operating the piezoelectric ceramic, and adjust the Setpoint value of the system to control the actual height of the probe. In the gas phase contact mode, control the probe to contact the upper surface of the sample to form a DNA-ferritin molecular junction loop with the probe and HOPG as electrodes at both ends. Adjust the Setpoint value to 0.02, corresponding to a contact force of 2nN between the probe and the ferritin surface. Apply a bias of -3V to 3V to the molecular junction, and insert the needle at different positions of the ferritin site to record the corresponding IV curve to prove the consistency of the electrical signals at each point ( Figure 4 a). Adjust the bias voltage to 0V-3V-0V-(-3V) cyclic bias and record the corresponding IV curve to characterize the memristive performance of ferritin ( Figure 4 b). In addition, a voltage pulse of 2V and 0.2s can be applied to the system, with each 5s as a cycle, and the current response under three cycles can be recorded to characterize the device application direction of the ferritin internal synapse ( Figure 4 c).

[0116] The above implementation cases prove that this scheme can be used to construct circuit arrays of functional proteins, build molecular-level circuits through AFM, and precisely control each point in the array, thereby developing future applications of synaptic-like memristor arrays.

[0117] In addition, it should be understood that after reading the above description of the present invention, those skilled in the art may make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A biomolecular device array based on a DNA backbone, characterized in that: The invention comprises a conductive substrate, a conductive probe and a DNA-functional protein complex system which form a conductive loop, wherein the DNA-functional protein complex system is located between the conductive substrate and the conductive probe.

2. The biomolecular device array based on a DNA backbone according to claim 1, characterized in that: The material of the conductive substrate is selected from Au, Si or HOPG; and / or, The conductive probe is connected to the atomic force microscope and is controlled by the atomic force microscope.

3. The biomolecular device array based on DNA backbone according to claim 1, characterized in that: The functional protein includes at least one of STV and ferritin; and / or, The DNA-functional protein complex system is a DNA-STV complex system, a DNA-ferritin complex system or a DNA-STV-ferritin complex system.

4. The method for constructing a biomolecular device array based on a DNA backbone according to any one of claims 1 to 3, characterized in that: Includes steps: (1) Design and prepare DNA tile monomers and assemble them to obtain a two-dimensional DNA backbone structure; (2) mixing and assembling the functional protein with the DNA two-dimensional skeleton structure to obtain a DNA-functional protein complex system; (3) Incubating and fixing the DNA-functional protein complex system on a conductive substrate, contacting the DNA-functional protein complex system with a conductive probe to connect and form a DNA-functional protein biomolecule junction loop system, thereby obtaining the biomolecule device array based on the DNA skeleton.

5. The construction method according to claim 4, characterized in that: In step (1): DNA tile monomers are assembled from designed single DNA strands; As the smallest repetitive unit, DNA tiles are connected to each other through the principle of complementary base pairing at the sticky ends to form a two-dimensional DNA backbone structure; The two-dimensional DNA backbone structure was prepared by a programmed annealing process in a thermal cycler; The DNA tile monomer contains at least one single DNA strand modified with a bioconjugate molecule, so as to allow the DNA tile monomer to be connected to a functional protein; The conductive substrate is a gold substrate, and the DNA tile monomer contains at least one DNA single strand modified with a thiol molecule, so as to allow the DNA tile monomer to be connected to the gold substrate.

6. The construction method according to claim 4, characterized in that: In step (2): The functional protein and the DNA two-dimensional skeleton structure are connected and assembled through bio-coupling agent molecules to obtain a DNA-functional protein complex system; The bioconjugate molecule is selected according to the surface properties of the functional protein, and is pre-modified on the DNA single strand of the DNA tile monomer, and connects the functional protein with the DNA two-dimensional backbone structure during the mixing process of the functional protein and the DNA two-dimensional backbone structure.

7. Use of the DNA backbone-based biomolecular device array according to any one of claims 1 to 3 in biomass-based electronic devices, logic circuits or information storage.

8. The use according to claim 7, characterized in that: The DNA backbone-based biomolecular device array is used for memristors.

9. A method for accurately exploring or regulating the electrical properties of a DNA-functional protein complex system circuit by constructing a DNA-based biomolecular device array, characterized in that: Includes steps: 1) Design and prepare DNA tile monomers and assemble them to obtain a two-dimensional DNA backbone structure; 2) Mixing and assembling the functional protein with the DNA two-dimensional skeleton structure to obtain a DNA-functional protein complex system; 3) incubating and fixing the DNA-functional protein complex system on a conductive substrate, and controlling a conductive probe to contact the DNA-functional protein complex system by an atomic force microscope to connect and form a DNA-functional protein biomolecule junction loop system; 4) Accurately explore or regulate the electrical properties of the circuit of the DNA-functional protein complex system by adjusting the hardware and / or software parameters of the atomic force microscope.

10. The method according to claim 9, characterized in that In step 4): The fine parameters of the corresponding hardware of the atomic force microscope can be set to independently adjust the bias range and value in the circuit, the value and frequency of the pulse voltage, the height and duration of the probe; Accurately control the relevant parameters of the circuit system, record the current response of the system when constant bias, cyclic bias, and pulse voltage are applied, and perform statistical analysis on the current response data of functional proteins at different sites in the DNA-functional protein complex system array.

Images