Gene LNC004268 and application thereof in regulation and control of proliferation of sheep myoblasts

Abstract

The invention provides a gene LNC004268 capable of regulating and controlling proliferation of sheep myoblasts and application of the gene LNC004268, and belongs to the technical field of functional genes. The nucleotide sequence of the gene LNC004268 for regulating and controlling the proliferation of the sheep myoblasts is as shown in SEQ ID NO: 1. According to the present invention, the influence on the expression of growth factors (CDK4 and CCND1) in sheep myoblasts and the growth and proliferation of the myoblasts is analyzed through the expression of the overexpression gene LNC004268 and the inhibition gene LNC004268, and the result shows that the gene LNC004268 can promote the growth and proliferation of the sheep myoblasts through negative regulation, can be used as the regulation element for regulating the sheep myoblasts, and can be used for preparing the sheep myoblasts. And a new means is provided for sheep molecular breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of functional genes, and specifically relates to a gene LNC_004268 and an application thereof in regulating the proliferation of sheep myoblasts. Background Art

[0002] Large-bodied sheep have always been the pursuit of the sheep breeding field. The body size of sheep is affected not only by bone development but also by muscle development. At present, a large number of studies have shown that long non-coding RNA (lncRNA) plays a delicate and complex regulatory role in animal muscle development. For example, in cattle, lncYYW promotes the proliferation of bovine myoblasts by upregulating growth hormone 1 (GH1), and lncRNA11007 promotes the proliferation of buffalo myoblasts. However, there are currently very few reports on the effect of lncRNA on the proliferation of sheep myoblasts, which undoubtedly hinders the progress of sheep molecular breeding. Summary of the invention

[0003] In view of this, the object of the present invention is to provide a gene LNC_004268, which affects the proliferation of sheep myoblasts and muscle development through negative regulation.

[0004] The present invention provides a gene LNC_004268, and the nucleotide sequence of the gene LNC_004268 is shown in SEQ ID NO:1.

[0005] The present invention provides the application of the gene LNC_004268 as a target in regulating the growth and development of sheep muscles.

[0006] The present invention provides an application of a reagent for regulating the expression of the gene LNC_00426 in the preparation of a product for influencing the proliferation of sheep myoblasts.

[0007] Preferably, the reagent comprises a recombinant vector containing the gene LNC_00426 or a recombinant vector interfering with the expression of the gene LNC_00426.

[0008] The present invention provides an agent for inhibiting the expression of the gene LNC_004268, comprising at least one of the following RNA or its gene-derived products: siRNA, shRNA and sgRNA targeting the gene LNC_004268.

[0009] Preferably, the gene-derived product includes at least one of the following products: an expression vector containing siRNA, a CRISPER-Cas gene editing system containing sgRNA, and a recombinant expression vector containing shRNA.

[0010] Preferably, the siRNA is obtained by hybridization of DNA fragments having nucleotide sequences as shown in SEQ ID NO: 10 and SEQ ID NO: 11.

[0011] The invention provides application of the reagent in promoting the proliferation of sheep myoblasts.

[0012] The present invention provides a method for promoting the growth and / or proliferation of sheep myoblasts, wherein a reagent for inhibiting the expression of the gene LNC_004268 is introduced into the sheep myoblasts.

[0013] Preferably, the reagent comprises at least one of the following RNA or its gene-derived products: siRNA, shRNA and sgRNA targeting gene LNC_004268. The gene-derived products comprise at least one of the following products: an expression vector comprising siRNA, a CRISPER-Cas gene editing system comprising sgRNA and a recombinant expression vector comprising shRNA.

[0014] The present invention provides a gene LNC_004268, the nucleotide sequence of which is shown in SEQ ID NO:1. The present invention performs transcriptome sequencing on small-tailed Han sheep and Sunite sheep in the same growth period, analyzes differentially expressed genes, obtains gene LNC_004268, verifies transcriptome data by RT-qPCR, and the results show that the verification result is consistent with the transcriptome data result. The present invention analyzes the effect of overexpression gene LNC_004268 and inhibition gene LNC_004268 on the expression of growth factors (CDK4 and CCND1) in sheep myoblasts by overexpression gene LNC_004268 and inhibition gene LNC_004268 expression, and the results show that overexpression gene LNC_004268 inhibits the expression of growth factors in sheep myoblasts, while inhibition gene LNC_004268 expression promotes the expression of growth factors in sheep myoblasts, indicating that gene LNC_004268 affects the expression of growth factors in myoblasts by negative adjustment. At the same time, the present invention also carried out the effects of overexpression gene LNC_004268 and inhibition gene LNC_004268 expression on myoblast growth and proliferation. The results showed that overexpression of LNC_004268 could inhibit the activity and cell proliferation of sheep myoblasts, whereas inhibition of LNC_004268 expression could promote the activity and cell proliferation of sheep myoblasts. It can be seen that the gene LNC_004268 provided by the present invention can promote the activity and proliferation of sheep myoblasts through negative regulation, and can be used as a regulatory element for regulating sheep myoblasts, providing a new means for sheep molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Figure RT-qPCR validation of transcriptome sequencing results;

[0016] Figure 2 The results of RT-qPCR detection of the effects of LNC_004268 overexpression and interference expression on growth factors in sheep myoblasts;

[0017] Figure 3 Western blot was used to detect the effects of LNC_004268 overexpression and interference expression on growth factors in sheep myoblasts;

[0018] Figure 4 The results of myoblast activity after inhibition of LNC_004268 were detected by CCK-8;

[0019] Figure 5 The results of CCK-8 detection of myoblast activity after overexpression of LNC_004268;

[0020] Figure 6 The results of using EdU cell proliferation detection kit to detect the effect of overexpression or interference expression of LNC_004268 on the proliferation of sheep myoblasts. DETAILED DESCRIPTION

[0021] The present invention provides a gene LNC_004268, whose nucleotide sequence is shown in SEQ ID NO: 1 (GGCG ).

[0022] In the present invention, the gene LNC_004268 is differentially expressed in different breeds of sheep. The results of the examples of the present invention show that the gene LNC_004268 is up-regulated in Small Tail Han sheep and down-regulated in Sunite sheep, which is the same as the trend of the carcass weight of sheep. The present invention uses RT-qPCR verification, and the results show that the gene LNC_004268 is highly expressed in Small Tail Han sheep relative to Sunite sheep, which is completely consistent with the transcriptome sequencing results.

[0023] In the present invention, in order to clarify the relationship between the gene LNC_004268 and sheep muscle development, the present invention explores the effect on myoblast growth by overexpressing the gene LNC_004268 and inhibiting the gene LNC_004268 in sheep myoblasts. Growth factors are shown to be negatively correlated with the expression level of the gene LNC_004268 at both the gene and protein levels. At the same time, the results of the myoblast activity and proliferation experiments also show that the activity and proliferation ability of myoblasts are negatively correlated with the expression level of the gene LNC_004268. Therefore, when the gene LNC_004268 is inhibited, it is beneficial to promote myoblast proliferation. Therefore, the gene LNC_004268 can be used to cultivate a new breed of high-yield meat-producing sheep.

[0024] In view of the fact that the expression level of gene LNC_004268 is negatively correlated with muscle cell growth and proliferation, the present invention provides the use of gene LNC_004268 as a knockout target in regulating sheep muscle development.

[0025] The present invention provides an application of a reagent for regulating the expression of the gene LNC_004268 in the preparation of a product for influencing the proliferation of sheep myoblasts.

[0026] In the present invention, the reagent preferably includes a recombinant vector containing gene LNC_004268 or a recombinant vector interfering with the expression of gene LNC_004268. The recombinant vector interfering with the expression of gene LNC_004268 contains siRNA having a nucleotide sequence as shown in SEQ ID NO:10. The recombinant vector containing gene LNC_004268 can inhibit the up-regulated expression of growth factor in myoblasts by negative regulation, inhibit the proliferation of myoblasts, and thus increase the meat production of sheep. The recombinant vector interfering with the expression of gene LNC_004268 inhibits the expression of gene LNC_004268 by siRNA, up-regulates the expression of myoblast growth factor, promotes the proliferation of myoblasts, and thus reduces the meat production of sheep.

[0027] The present invention provides an agent for inhibiting the expression of the gene LNC_004268, including siRNA, shRNA, sgRNA or gene-derived products thereof targeting the gene LNC_004268.

[0028] In the present invention, the gene-derived product includes an expression vector comprising siRNA, a CRISPER-Cas gene editing system comprising sgRNA, and a recombinant expression vector comprising shRNA. The present invention has no particular restrictions on the preparation method of the gene-derived product, and the construction method of the recombinant expression vector or CRISPER-Cas gene editing system known in the art can be used. In the embodiment of the present invention, siRNA is used as an example to illustrate the effect of the present invention on the growth and proliferation of myoblasts by inhibiting the expression of gene LNC_004268. The siRNA is obtained by hybridization of DNA fragments with nucleotide sequences such as SEQ ID NO: 10 and SEQ ID NO: 11.

[0029] The invention provides application of the reagent in promoting the proliferation of sheep myoblasts.

[0030] The invention provides a method for promoting the growth and / or proliferation of sheep myoblasts, wherein an agent for inhibiting the gene LNC_004268 or increasing the expression of the gene LNC_004268 is introduced into the sheep myoblasts.

[0031] In the present invention, the reagent for inhibiting the expression of the gene LNC_004268 is the same as the above technical solution and will not be described in detail here.

[0032] In the present invention, the method of introducing into sheep myoblasts preferably inhibits the expression of gene LNC_004268 or its protein in sheep by heritable and non-heritable means. The heritable means preferably comprises knocking out or knocking down gene LNC_004268 in sheep fertilized eggs, and obtaining sheep individuals through cultivation and development. The non-heritable means preferably comprises introducing the reagent into sheep cells by liposome transfection to downregulate the expression of LNC_004268.

[0033] The following is a detailed description of a gene LNC_004268 provided by the present invention and its application in regulating the proliferation of sheep myoblasts in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0034] Example 1

[0035] Screening and verification of gene LNC_004268 related to sheep muscle growth and development

[0036] 1. Experimental sample collection: Five small-tailed Han sheep (SNT) and five Sunite sheep (STH) aged 8 months old were selected under the same feeding conditions. The longissimus dorsi muscle was collected and RNA was extracted. The purity, concentration and integrity of the extracted RNA were tested.

[0037] 2. Transcriptome sequencing: The extracted RNA is randomly interrupted into short fragments, and the first cDNA chain is synthesized from the RNA fragments using reverse transcriptase and random hexamer primers. The second cDNA chain is then synthesized using DNA polymerase, RNase H and dNTPs. Finally, the ends of the cDNA are repaired using an end repair enzyme to give it a complete phosphorylated 3' end and 5' end. The adapter containing the sequence recognition site is connected to both ends of the cDNA, amplified by PCR, and the cDNA fragments of a specific size range are purified using gel electrophoresis or magnetic beads, and sequenced using the Illumina platform.

[0038] 3. Screening of differentially expressed genes: The sequencing results were quality controlled, the FPKM value was calculated using StringTie software, and differential expression analysis was performed using DESeq2. When the false discovery rate (FDR) was lower than 0.05 and the FC difference multiple was greater than or equal to 1, that is, lncRNAs that met the conditions (FDR < 0.05 and |log2FC| > 1) were identified as differentially expressed genes.

[0039] The transcriptome sequenced by Wuhan Fraser Gene Information Co., Ltd. screened out the differentially expressed gene LNC_004268 (SEQ ID NO: 1) related to sheep muscle growth and development.

[0040] Example 2

[0041] RT-qPCR validation of transcriptome sequencing results

[0042] Five 8-month-old Small-tail Han sheep (STH) and five Sunite sheep (SNT) were collected from the longissimus dorsi muscle and total RNA was extracted. The total RNA was used as a template for reverse transcription into a cDNA library. The reaction system included 4 μl of 5×All in one qRT SuperMix, 1 μl of EnzymeMix, 1 μg of template RNA, and 20 μl of RNase-free ddH2O. The reaction procedure was 50°C for 15 min and 85°C for 5 sec. Using cDNA as template, LNC_004268-F (AGCACGTCACCATCACTTT, SEQ ID NO: 2) and LNC_004268-R (GGTTAGGGCTCTGCACTTT, SEQ ID NO: 3) were used as primers to prepare the RT-qPCR reaction system, specifically 2×Taq ProUniversal SYBR qPCR MasterMix 10.0μl, F primer (10μM) 0.4μl, R primer (10μM) 0.4μl, cDNA 2μl, ddH2O 7.2μl. The internal reference gene was GAPDH, and the internal reference primers were GAPDH-F (GCAAGTTCCACGGCACAG, SEQ ID NO: 8) and GAPDH-R (TCAGCACCAGCATCACCC, SEQ ID NO: 9). The RT-qPCR reaction was performed using LightCycler 480II. The reaction procedure was 95°C pre-denaturation for 5 min; 95°C denaturation for 5 s, 60°C annealing for 30 s, for a total of 40 cycles. -ΔΔCt The relative expression of experimental data was calculated by t-test and P value was calculated.

[0043] Results Figure 1 . Figure 1 The results showed that the expression level of LNC_004268 in the longissimus dorsi muscle of Small-tail Han sheep was significantly higher than that in the longissimus dorsi muscle of Sunite sheep, which was consistent with the transcriptome sequencing results.

[0044] Example 3

[0045] Method for constructing LNC_004268 overexpression recombinant vector and interference vector

[0046] According to the sequence of LNC_004268, siRNA for interfering expression was designed, recorded as si-LNC_004268, and the sequence was CACGUCACCAUCACUUUCUTT (SEQ ID NO: 10), AGAAAGUGAUGGUGACGUGTT (SEQ ID NO: 11). si-LNC_004268 was used to construct an interference vector, which was specifically commissioned to Shanghai Jima Pharmaceutical Technology Co., Ltd. for synthesis.

[0047] BamHI and NotI restriction sites were added to both ends of the DNA fragment of LNC_004268, and cloned into the pcDNA3.1(+) vector by restriction digestion and ligation to obtain the pcDNA3.1-LNC_004268 overexpression vector, which was specifically commissioned to Shanghai Jima Pharmaceutical Technology Co., Ltd. for synthesis.

[0048] Example 4

[0049] LNC_004268 Cell transfection experiment of overexpression recombinant vector and interference vector

[0050] The pcDNA3.1-LNC_004268 overexpression vector and si-LNC_004268 interference vector were designed and synthesized according to the sequence of LNC_004268. Sheep myoblasts were cultured at 1×10 6 Cells were inoculated into 6-well plates at a density of 100 cells / well (3 replicates per group), and 2 mL of DMEM complete medium was added to each well. The cells were cultured overnight at 37°C, 5% CO2, and saturated humidity. Before transfection, the original cell culture medium was replaced with 1.5 mL of Opti-MEM and incubated at 37°C for 20 min. 242 μL of Opti-MEM and 8 μL of 500 ng / μL pcDNA3.1-LNC_004268 or si-LNC_004268 interference vector were mixed to make solution A. 242 μL of Opti-MEM and 8 μL of 2000 to form liquid B, liquid A and liquid B were mixed to form a transfection complex, incubated at room temperature for 20 minutes and then added to the cell culture plate to transfect sheep myoblasts. Cultured at 37 ° C, 5% CO2 saturated humidity, replaced with complete medium after 6 hours, and cells were collected after 48 hours. At the same time, a control group was set up, replacing pcDNA3.1-LNC_004268 with an empty pcDNA3.1 vector (denoted as pcDNA3.1-LNC_004268-NC), or replacing the si-LNC_004268 interference vector with an empty interference vector (denoted as si-LNC_004268-NC), and the other steps were the same.

[0051] Example 5

[0052] Detection of the effects of LNC_004268 overexpression or interference expression on growth factor expression in sheep myoblasts

[0053] 1. RT-qPCR detection

[0054] The total RNA of the four sheep myoblasts constructed in Example 3 was used as a template, and the RT-qPCR reaction system was prepared with CDK4-F (CAACGGAGGAGGTGCTGGAG, SEQ ID NO: 4) / CDK4-R (GAGCCTGACAACATTGGGATGC, SEQ ID NO: 5) and CCND1-F (TTGCTGCTTCCGCCTTGTATC, SEQ ID NO: 6) / CCND1-R (AACCATCCACTTGACACACTTCTC, SEQ ID NO: 7) primers as described in Example 1. The internal reference gene was GAPDH, and the internal reference primers were GAPDH-F (GCAAGTTCCACGGCACAG, SEQ ID NO: 8) and GAPDH-R (TCAGCACCAGCATCACCC, SEQ ID NO: 9). The RT-qPCR reaction was performed using LightCycler 480II. The reaction procedure was 95°C pre-denaturation for 5 min; 95°C denaturation for 5 s, 60°C annealing for 30 s, for a total of 40 cycles. -ΔΔCt The relative expression of experimental data was calculated by t-test and P value was calculated.

[0055] Results Figure 2 The expression of LNC_004268 was overexpressed or inhibited in cells, and the expression of growth factors was detected by RT-qPCR. The results showed that the expression levels of CDK4 and CCND1 after interfering with LNC_004268 were significantly higher than those after overexpressing LNC_004268.

[0056] 2. Protein extraction and Western blot detection

[0057] Use a total protein extraction kit to extract total cell protein. Collect the cultured muscle cells in a 1.5mL centrifuge tube, use a high-speed centrifuge at 4℃12000r / min for 30min, collect the supernatant, and discard the precipitate. Determine the BCA standard curve and calculate the protein concentration according to the instructions of the protein concentration determination kit (BCA). According to the protein volume: 5×SDSLoadingBuffer=4:1, mix the protein with 5×SDS Loading Buffer and boil it in a metal bath at 100℃ for 5min. Add 15μg of protein to each well in BeyoGel Plus PAGE precast gel (Tris-Gly, 10%, 10 wells), 80V, 20min; 120V, 60min, and stop when the bottom of the bromophenol blue gel is observed. After the electrophoresis is completed, use 180mA 90min electrophoresis conditions for transfer, and then use QuickBlock TMWestern blocking solution was used to block the cells on a shaker at room temperature for 2 hours. Then, different concentrations of primary antibodies (CCND1: proteintech, 26939-1-AP; CDK4: proteintech, 83994-3-RR) were added and blocked overnight at 4°C. Washing solution was used for 3 times, 5 minutes each time. After incubation with secondary antibodies at room temperature for 2 hours, ultra-sensitive ECL chemiluminescent reagent was used for color development, Odyssey CLX imaging system (Li-COR) was used for exposure, and the photos were taken and saved. Image J software was used to analyze the gray value of the bands, and the ratio of the gray value of the target protein to that of GAPDH was the relative expression level of the target protein.

[0058] Results Figure 3 The expression of LNC_004268 in cells was overexpressed or inhibited, and the expression of growth factor proteins was detected by Western blot. The results showed that the expression levels of CDK4 and CCND1 after interfering with LNC_004268 were significantly higher than those after overexpressing LNC_004268.

[0059] Example 6

[0060] Detection of myoblast cell viability and proliferation

[0061] 1. CCK-8 detection of myoblast cell viability

[0062] 2×10 per well 4 Sheep myoblasts were inoculated into 96-well plates at a density of 10 μL / 100 μL, with 5 replicates per group, and cultured for 24 h at 37 °C, 5% CO2, and saturated humidity. According to the instructions of the cell counting kit (CCK-8), 10 μL of CCK8 solution was added to each well after 0, 6, 12, 24, 48, and 72 h of cell growth after transfection of the relevant vectors, and the absorbance at 450 nm was measured using an ELISA reader after incubation in the incubator for 2 h, and then the proliferation rate of sheep myoblasts was calculated.

[0063] 2. EdU detection of myoblast proliferation

[0064] The proliferation of sheep myoblasts was detected using the EdU cell proliferation detection kit. 5Sheep myoblasts were inoculated into 12-well plates at a density of 1 / well, with 3 replicates per group, and cultured for 24 hours at 37°C, 5% CO2, and saturated humidity. According to the instructions of the EdU cell proliferation detection kit, the vector was transfected and cultured for 12 hours. After the cells were in normal state, an equal volume of EdU working solution (10μmol / L) preheated at 37°C was added and incubated for 3 hours. After EdU labeling of cells, the culture medium was removed, and 1mL of immunostaining fixative was added and fixed at room temperature for 15 minutes. Wash 3 times with washing solution, 5 minutes each time. Remove the washing solution, permeabilize each well with 1mL of immunostaining strong permeabilization solution, and incubate at room temperature for 15 minutes. Remove the permeabilization solution, add 1mL of washing solution and wash twice, 3 minutes each time. Incubate at room temperature for 20 minutes with blocking solution, and wash 3 times with washing solution, 2 minutes each time. Add 0.5mL of Click reaction solution to each well, incubate at room temperature in the dark for 30 minutes, and wash 3 times with washing solution, 5 minutes each time. Add 200 μL of Streptavidin-HRP working solution to each well and incubate at room temperature for 30 min. Wash with washing solution 3 times, 2 min each time. Observe under a fluorescence microscope and take photos for record.

[0065] Results Figures 4 to 6 The results of CCK-8 and EdU showed that the cell activity of myoblasts after inhibiting LNC_004268 was significantly higher than that after overexpressing LNC_004268.

[0066] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A gene LNC_004268, characterized in that The nucleotide sequence of the gene LNC_004268 is shown in SEQ ID NO:

1.

2. Use of the gene LNC_004268 described in claim 1 as a target in regulating sheep muscle growth and development.

3. Use of an agent for regulating the expression of the gene LNC_00426 according to claim 1 in the preparation of a product that affects the proliferation of sheep myoblasts.

4. The application according to claim 3, characterized in that: The reagent includes a recombinant vector containing the gene LNC_00426 or a recombinant vector interfering with the expression of the gene LNC_00426.

5. An agent for inhibiting the expression of the gene LNC_004268 according to claim 1, characterized in that: It includes at least one of the following RNA or its gene-derived products: siRNA, shRNA and sgRNA targeting gene LNC_004268.

6. The reagent according to claim 5, characterized in that The gene-derived products include at least one of the following products: an expression vector containing siRNA, a CRISPER-Cas gene editing system containing sgRNA, and a recombinant expression vector containing shRNA.

7. The reagent according to claim 5 or 6, characterized in that The siRNA is obtained by hybridization of DNA fragments with nucleotide sequences as shown in SEQ ID NO: 10 and SEQ ID NO:

11.

8. Use of the reagent according to any one of claims 5 to 7 in promoting the proliferation of sheep myoblasts.

9. A method for promoting the growth and / or proliferation of sheep myoblasts, characterized in that: The agent for inhibiting the expression of the gene LNC_004268 according to claim 1 is introduced into sheep myoblasts.

10. The method according to claim 9, characterized in that: The reagent includes at least one of the following RNA or its gene-derived product: siRNA, shRNA and sgRNA targeting gene LNC_004268; The gene-derived products include at least one of the following products: an expression vector containing siRNA, a CRISPER-Cas gene editing system containing sgRNA, and a recombinant expression vector containing shRNA.

Images