Construction method and application of receptor for monitoring intracellular ATP content in real time

Abstract

The invention discloses a construction method and application of a receptor for monitoring intracellular ATP content in real time, and belongs to the technical field of biochemical detection. Mainly relates to a recombinant plasmid for monitoring intracellular ATP content, the recombinant plasmid contains hDndB and DN-luc, and the hDndB and the DN-luc are connected by an IRES sequence. According to the invention, hDndB and DN-luc are co-expressed, and independent translation is realized through an IRES linker, so that mutual influence of functions caused by formation of fusion proteins is avoided; the ATP content in the cells is positively correlated with the DN-luc content by utilizing the ATP content detection characteristic of hDndB, so that the ATP content in the cells is judged by detecting the dual-luciferase content of the cell supernatant.

Description

Technical Field

[0001] The invention belongs to the technical field of biochemical detection, and in particular relates to a construction method and application of a sensor for real-time monitoring of intracellular ATP content. Background Art

[0002] Adenosine triphosphate (ATP), chemical formula is C 10 H 16 N 5 O 13 P 3 , with a molecular weight of 507.18, is an unstable high-energy compound composed of 1 adenine molecule, 1 ribose molecule and 3 phosphate groups.

[0003] As the energy "currency" in cells, ATP is involved in almost all life activities of cells, including cell growth, replication, aging, carcinogenesis, and stress. In cellular energy metabolism, ATP is a product or raw material of energy metabolism, and the dynamic changes in its content directly reflect the direction of cell energy metabolism. In addition, in many cellular metabolic activities, many kinases are important regulatory enzymes for metabolic reactions. For example, in the GPCR signaling pathway, PKA is a key enzyme in the pathway. After activation, it promotes the transmission of the signaling pathway of the intracellular second messenger to the nucleus; and the cell directly upregulates or inhibits the activity of the kinase by adjusting the real-time ATP content in the cell, thereby achieving the regulation of the intracellular signaling pathway and other metabolic activities. In the field of medical research, there is also a need for real-time monitoring of intracellular ATP content. In the detection and treatment of diabetes, drug activation of AMPK is a major research direction, and the normal activity changes of AMPK in the cell are directly regulated by the dynamic changes of the intracellular AMP / ATP content. Therefore, the real-time content of ATP can be used as a direct proof of the efficacy of AMPK drugs. In addition, currently, including diabetes research, the means of detecting intracellular drug efficacy almost only include the expression level of the target protein or its transcript expression level, while the real-time ATP content in the cell can not only be used as an indicator of the cell state after the cell is treated with the drug, but also as a direct indicator of its efficacy in the development of drugs targeting cellular energy metabolism.

[0004] At present, there are many ways to detect ATP, such as the NADPH method and the luciferase method, and many ATP detection kits have been developed. Among them, the ATP detection kits of Biotech, Yeasen, MCE, Biosharp, and Thermofisher are based on the luciferase method. The principle is that ATP reacts with the substrate luciferin under the action of luciferase to produce fluorescence. When both luciferase and substrate luciferin are in excess, the fluorescence intensity is proportional to the ATP concentration within a certain concentration range, so the ATP concentration in the sample can be detected by measuring the fluorescence intensity. Some biotech companies, such as Biotech, use the NADPH method to make ATP detection kits. The principle is that HexoKinase catalyzes glucose and ATP to synthesize 6-phosphate glucose, and 6-phosphate glucose dehydrogenase further catalyzes the dehydrogenation of 6-phosphate glucose to generate NADPH. NADPH has a characteristic absorption peak at 340nm, and NADPH is proportional to the ATP content, which reflects the ATP content.

[0005] Currently, there are many ways to detect ATP, and many ATP detection kits have been developed. However, common detection kits on the market all require cell disruption, and different kits use a variety of different reagents in the process of cell disruption according to their different principles, which makes the operation more complicated and increases the possible variables in the experimental process. In addition, the above-mentioned kits all detect the ATP content in the cell disruption solution, which makes the test results and the intracellular ATP content have a time lag, which also affects the experimental accuracy. As the research in the biological field continues to deepen, the demand for a technology that can reflect the intracellular ATP content in real time will increase, but there is currently no detection method that can reflect the intracellular ATP content in real time. Summary of the invention

[0006] In order to solve the above technical problems, the purpose of the present invention is to provide a method for constructing a sensor for real-time monitoring of intracellular ATP content. The present invention does not require cell disruption, can detect intracellular ATP content in real time, has wide versatility, and is easy to operate; in addition, based on real-time detection, this technology can also provide real-time energy indicators for cell physiological state detection.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] The invention discloses a recombinant plasmid for monitoring intracellular ATP content, wherein the plasmid contains hDndB and DN-luc, and the expression of the two proteins is controlled by a common promoter.

[0009] The hDndB is obtained by codon optimization of DndB protein, and the optimized nucleotide sequence is shown in SEQ ID NO.1.

[0010] Furthermore, the DN-luc is a Gaussia secretory luciferase; the sequence of the DN-luc is shown in SEQ ID NO.2.

[0011] Furthermore, the hDndB and DN-luc are connected via an IRES sequence.

[0012] Furthermore, the IRES sequence is shown as SEQ ID NO.3.

[0013] The sequence after hDndB and DN-luc are connected via the IRES sequence is shown in SEQ ID NO.4.

[0014] The present invention also provides an application of a recombinant plasmid in preparing a product for monitoring intracellular ATP content.

[0015] Furthermore, the product is a test kit.

[0016] The method of using the product is: transfect the recombinant plasmid into cells for culture, and the intracellular ATP content can be measured 12-48 hours after transfection.

[0017] Furthermore, the transfection time is 24 hours.

[0018] Search for prokaryotic DndB and its promoter sequence, optimize the codons of DndB and name it hDndB. Because in prokaryotes, DndB can bind to its own promoter to inhibit its own transcription, and ATP can bind to DndB on the promoter, thereby relieving DndB's inhibition of its own transcription and allowing DndB protein to be expressed. When the ATP content is extremely low, DndB is in an inhibited state and the expression level is low. When the ATP content increases, the expression of DndB also increases, that is, the ATP content is positively correlated with the DndB protein content.

[0019] Construct hDndB and DN-luc co-expression plasmid. DN-luc is a secretable dual luciferase reporter gene. DN-luc and hDndB are connected together through the IRES sequence, so that hDndB and DN-luc become a common promoter but the proteins can function separately, that is, DN-luc and hDndB expression are proportional. By detecting the dual luciferase in the supernatant, the hDndB protein content, that is, the ATP content, can be known.

[0020] The above recombinant plasmid was transfected into 293T cells for verification. By detecting the ATP content and the dual-luciferase content, a standard curve between ATP and dual-luciferase was established.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] The present invention avoids the mutual influence of functions of the formed fusion proteins by co-expressing hDndB and DN-luc and realizing independent translation through an IRES linker; utilizes the ATP content detection characteristic of hDndB to make the intracellular ATP content positively correlated with the DN-luc content, thereby judging the intracellular ATP content by detecting the dual-luciferase content in the cell supernatant.

[0023] The present invention does not require cell disruption, can detect intracellular ATP content in real time, has wide versatility, and is easy to operate; in addition, based on real-time detection, this technology can also provide real-time energy indicators for cell physiological state detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a schematic diagram of the DNdBpro+hDndB-Flag-IRES-DN-Luc (hDndB-Luc) plasmid in Example 1;

[0025] Figure 2 Schematic diagram of the detection of hDndB and DN-luc in transfected cells in Example 2 (wherein, Figure a is a diagram showing the results of the determination of the DndB protein expression levels in different experimental groups, and Figure b is a diagram showing the results of the determination of the DN-luc fluorescence values ​​in different experimental groups);

[0026] Figure 3 This is a schematic diagram for verifying the positive correlation between hDndB expression level and intracellular ATP content in Example 2;

[0027] Figure 4 Schematic diagram for verifying the linear positive correlation between the dual-luciferase content in the supernatant of transfected cells and the intracellular ATP content in Example 2 (wherein, Figure a is a graph showing the results of the determination of the intracellular ATP content by the ATP detection kit, Figure b is a graph showing the results of the determination of the dual-luciferase value in the supernatant, and Figure c is a graph showing the linear relationship between the two);

[0028] Figure 5 The figure is a graph of real-time detection of ATP content by dual luciferase in the supernatant of transfected cells in Example 2 (wherein, Figure a is a graph showing the results of determination of intracellular ATP content under stimulation at different time periods, and Figure b is a graph showing the results of determination of dual luciferase values ​​in the supernatant under stimulation at different time periods); DETAILED DESCRIPTION

[0029] In order to better illustrate the present invention, the following embodiments are listed. Obviously, the described embodiments are only a part of the present invention, not all embodiments. Based on the embodiments in the present invention, other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention.

[0030] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0031] SEQ ID NO.1:

[0032]

[0033] SEQ ID NO.2:

[0034] ATGCTAGCCAAGCCCACCGAGAACAACGAGGACTTCAACATCGTGGCCGTGGCCAGCAACTTCGCCACCACCGACCTGGACGCCGACCGCGGCAAGCTGCCCGGCAAGAAGCTGCCCCTGGAGGTGCTGAAGGAGATGGAGGCCAACGCCCGCAAGGCCGGCTGCACCCGCGGCTGCCTGATCTGCCTGAGCCACATCAAGTGCACCCCCAAGATGAAGAAGTTCATCCCCGGCCGCTGCCACACCTACGAGGGCGACAAGGAGAGCGCCCAGGGCGGCATCGGCGAGGCCATCGTGGACATCCCCGAGATCCCCGGCTTCAAGGACCTGGAGCCTATGGAGCAGTTCATCGCCCAGGTGGACCTGTGCGTGGACTGCACCACCGGCTGCCTGAAGGGCCTGGCCAACGTGCAGTGCAGCGACCTGCTGAAGAAGTGGCTGCCCCAGCGCTGCGCCACCTTCGCCAGCAAGATCCAGGGCCAGGTGGACAAGATCAAGGGCGCCGGCGGCGACCTGTACAAGTAA;

[0035] SEQ ID NO.3:

[0036] CCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATAATAA;

[0037] SEQ ID NO.4:

[0038]

[0039] Example 1 Design of real-time cell energy sensor

[0040] 1. Confirmation of DndB and its promoter sequence

[0041] The DndB and promoter sequences of Streptomyces avermitilis MA-4680 (Gene ID: 41540015) were searched on NCBI, and then the codon comprehensive evaluation optimization design was performed based on parameters such as "GC content value, CIS element, repeat element, RNA splicing site, ribosome binding sequence, and minimum free energy of mRNA" and combined with computer language algorithms such as "maximizing coordination index, maximizing codon background index, and minimizing outlier index", and the final optimized sequence was obtained and named hDndB. The hDndB sequence is shown in SEQ ID NO.1.

[0042] 2. Synthesize hDndB sequence

[0043] The codon-optimized hDndB was synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0044] 3. Construction of hDndB and DN-luc co-expression plasmid

[0045] The hDndB obtained by codon optimization is connected to DN-luc through the IRSE sequence. The DN-luc sequence is shown in SEQ ID NO.2, the IRSE sequence is shown in SEQ ID NO.3, the sequence after the hDndB and DN-luc are connected through the IRES sequence is shown in SEQ ID NO.4, and the connection method is as shown in Figure 1 shown.

[0046] The specific method is as follows:

[0047] 3.1 Primer design

[0048] First, according to the HCMV Towne library and human EZH2 sequence found in genebank, PrimerPrimier 5.0 was used to design relevant PCR primers, and the designed primer sequences were synthesized by Guangzhou Qingke and Shenggong. The designed primer set sequence is shown in Table 1. The underline indicates the endonuclease site.

[0049] Table 1 Primer set sequence list

[0050]

[0051] 3.2 PCR reaction

[0052] The optimized synthesized hDndB, DN-luc and IRSE sequences were used as templates for PCR reaction. The PCR reaction was carried out in the reaction system and reaction conditions in Tables 2 and 3 below:

[0053] Table 2 PCR reaction system

[0054] Reaction system Volume (μl) 10×PCRBuffer 5 dNTPs 4 DNA template 0.5 Primer F (10 μM) 0.5 Primer R (10 μM) 0.5 rTaq 1 <![CDATA[ddH 2 The]]> 38.5 Overall reaction system 50

[0055] Table 3 PCR reaction conditions

[0056]

[0057] 3.3 Recovery of PCR product nucleic acid by gel electrophoresis

[0058] 3.3.1 Preparation of 1% agarose gel: Weigh 0.6g Agarose powder, add 60ml 1×TAE electrophoresis buffer, cover the bottle mouth slightly with weighing paper to prevent moisture evaporation; transfer to microwave and heat for 2-3min, and it is completely dissolved when there is no flocculent floating matter. When the gel solution is cooled to 50-60℃, add 0.6μl Gel-Red nucleic acid dye at a dilution of 1:10000, shake and mix well, quickly pour into the mold slot, insert a comb with the corresponding number of holes, and wait for room temperature to solidify for 30min. Before running the gel, carefully pull up the comb and transfer the gel to the electrophoresis tank filled with fresh 1×TAE electrophoresis buffer.

[0059] 3.3.2 Spotting: Take 2μl of PCR product and 2μl of 10× DNA Loading buffer, mix well and spot into the wells with a micropipette. At the same time, add a 2000bp or 5000bp DNA marker next to the sample to facilitate observation of the results.

[0060] 3.3.3 Electrophoresis and observation of results: Set the voltage to 100V for 30 minutes, paying attention to the placement of the positive and negative electrodes. After the electrophoresis is completed, use a gel imaging system to analyze and store the results.

[0061] 3.3.4 PCR product recovery

[0062] Use the Gel Extraction kit to recover DNA fragments. The steps are as follows:

[0063] (1) In a gel imaging instrument, turn on the UV light, quickly cut the gel block of the target band, transfer it to a 1.5 ml EP tube, peel and weigh it, add an equal volume of XP2 solution to the gel, and place it in a metal bath to melt at 55°C for 7 min. During this period, invert the sample every 2 min to mix it.

[0064] (2) After complete thawing, the sample was transferred to a recovery tube and centrifuged at 10,000 rpm for 1 min. The filtrate was discarded. 500 μl of XP2 solution was then added to the inner tube and the filtrate was discarded after centrifugation.

[0065] (3) Add 700 μl of SPW washing solution to the inner cannula, centrifuge at 12,000 rpm for 1 min, discard the filtrate, and repeat this step once.

[0066] (4) Idle the casing at 12000 rpm for 2 min to remove residual ethanol.

[0067] (5) Transfer the inner tube to a new EP tube and carefully drip 50 μl of ddH2O in the center of the membrane. 2 O, after standing at room temperature for 2 min, centrifuge at 12000 rpm for 1 min to obtain the target DNA.

[0068] (6) NanoDrop 2000 software was used to determine the concentration of the recovered target DNA and the samples were stored at -20°C.

[0069] 3.4 Using overlapping PCR technology, hDndB-F and DN-luc-R were used as upstream and downstream primers, and the amplified hDndB, IRSE and DN-Luc were used as templates for overlapping PCR reaction again. The reaction conditions were as shown in 3.1-3.2 above, and the connection product of hDndB-IRSE-DN-luc was amplified.

[0070] 3.5 Double restriction enzyme digestion of target gene and vector

[0071] Take 3.8 μl of the target gene recovery product and vector PGL3, and perform double restriction digestion with XhoⅠ and SacⅠ. The restriction digestion reaction system is as shown in Table 4:

[0072] Table 4 Enzyme digestion reaction system

[0073]

[0074]

[0075] The reaction system was placed in a 37°C incubator for double enzyme digestion, and the digestion time was 1 h.

[0076] After double enzyme digestion, the product was recovered and the concentration was determined in the manner described in 3.3 above.

[0077] 3.6 Ligation of target gene and vector

[0078] The enzyme ligation reaction of the recombinant plasmid was performed according to the concentration ratio of target gene: vector = 6:1-10:1. The enzyme ligation reaction system is as shown in Table 5:

[0079] Table 5 Enzyme-linked reaction system

[0080] system Volume (μl) T4DNALigase 1 10×T4buffer 1 PGL3 digestion products 1.5 hDndB-IRSE-DN-luc digestion product 6.5 Total 10

[0081] Ligation was carried out at 22°C for 2 h. After the reaction was complete, the transformation was ready.

[0082] 3.7 Transformation of recombinant plasmid

[0083] (1) In a clean bench, take out 50 μl of competent cells DH5α and thaw them on ice (freshly thawed cells have the highest transformation efficiency; avoid repeated thawing; avoid pipetting; be gentle throughout the operation). Add 1 / 10 of the plasmid or ligation product, mix gently, and place on ice for 30 min.

[0084] (2) After the ice bath, immediately transfer the competent cells to a 42°C constant temperature water bath for 90 seconds, then transfer the competent cells to ice for 2 minutes. Do not shake the centrifuge tube during this process.

[0085] (3) Add 700 μl of LB liquid culture medium without ampicillin A+ to a 1.5 ml EP tube, place in a constant temperature incubator at 37°C and 220 rpm, and shake for 45 min to revive the bacteria.

[0086] (4) After shaking, centrifuge at 5000 rpm for 7 min at room temperature, discard the remaining supernatant (about 100 μl), resuspend the cells, spread them on the LB solid culture plate containing A+, and spread them evenly with a spreading rod or glass beads.

[0087] (5) Place the plate in a constant temperature incubator, invert the plate after the coated liquid is absorbed, and incubate at 37°C for ≥13 h. Then, select a single clone and shake the bacteria. The shaken bacteria are sent for sequencing. If the sequencing is correct, the constructed plasmid hDndBpro+DndB-Flag-IRES-DN-Luc is obtained.

[0088] Example 2 Verification of Cellular ATP Real-time Energy Detection Sensor

[0089] 1. hDndB and DN-luc expression and content detection

[0090] 1.1 Cells and plasmids

[0091] 293T cells were purchased from the American Type Culture Collection (ATCC) and maintained by this laboratory. Plasmid hDndBpro+DndB-Flag-IRES-DN-Luc (named hDndB-Luc) carrying hDndB and DN-luc was constructed by the applicant.

[0092] 1.2 Reagents

[0093] DMEM culture medium was purchased from GIBCO; Lipo2000 was purchased from Invitrogen; Oligomycin A was purchased from Beyotime Biotechnology Co., Ltd.; and metformin hydrochloride was purchased from selleck.

[0094] 1.3 Experimental methods and results

[0095] Plasmid hDndB-Luc (1 μg) was transfected into 293T cells using Lipo2000.

[0096] Here’s how:

[0097] HEK-293T cells (1.5×10 5 ) or Hela cells (1.2×10 5 The cells were seeded in 12-well plates and transfection was started the next day when the cell confluence reached 60%-70%.

[0098] Dissolve the plasmid hDndB-Luc (1 μg) or empty vector expression plasmid in 100 μL culture medium (DMEM culture medium without dual antibodies and serum), and mix gently; add the transfection reagent to the above culture medium at a ratio of DNA: transfection reagent = 1:2, mix gently immediately, and incubate at room temperature for 15 minutes; add the above transfection reagent / DNA complex to the corresponding cell wells, shake gently and place in the incubator for culture; replace it with DMEM culture medium with dual antibodies and serum after 6 hours.

[0099] 24 hours after transfection, 4 mumol / L Oligomycin A was used as an ATP inhibitor and 1 ng / ml metformin hydrochloride was used as an ATP activator to detect the expression of hDndB and DN-luc in the transfected cells.

[0100] hDndB carries a Flag tag, and the protein expression of hDndB is detected by western blot. DN-luc can be secreted outside the cell and detected by collecting the cell supernatant and then reacting with the dual luciferase substrate coelenterazine.

[0101] The experimental results are as follows Figure 2 Shown: hDndB and DN-luc were expressed in transfected cells.

[0102] 2. hDndB expression level is positively correlated with ATP content

[0103] 2.1 Cells and plasmids

[0104] 293T cells were purchased from the American Type Culture Collection (ATCC) and maintained by this laboratory. Plasmid hDndB-Luc carrying hDndB and DN-luc was constructed by the applicant.

[0105] 2.2 Reagents

[0106] DMEM culture medium was purchased from GIBCO; Lipo2000 was purchased from Invitrogen; ATP detection kit was purchased from Beyotime Biotechnology Co., Ltd.; Gaussia luciferase reporter gene detection kit was purchased from Beyotime Biotechnology Co., Ltd.; and metformin hydrochloride was purchased from selleck.

[0107] 2.3 Experimental methods and results

[0108] Plasmid hDndB-Luc (1 μg) was transfected into 293T cells using Lipo2000. The transfection method was the same as 1.3 above.

[0109] 24 hours after transfection, metformin hydrochloride was used as an ATP activator, treated with 0, 2mM, 4mM, 6mM, 8mM, and 10mM for 1h, and incubated at 37°C for 24h; the ATP kit was used as a control to detect the expression level of hDndB in the transfected cells.

[0110] The experimental results are as follows Figure 3 The results showed that the hDndB expression level in transfected cells had a significant positive correlation with cell treatment and was consistent with the results of the ATP kit, that is, as the ATP content increased, the hDndB expression level increased.

[0111] 3. The dual luciferase in the supernatant of transfected cells is linearly positively correlated with the ATP content

[0112] 3.1 Cells and plasmids

[0113] 293T cells were purchased from the American Type Culture Collection (ATCC) and maintained by this laboratory. Plasmid hDndB-Luc containing hDndB and DN-luc was constructed by the applicant.

[0114] 3.2 Reagents

[0115] DMEM culture medium was purchased from GIBCO; Lipo2000 was purchased from Invitrogen; ATP detection kit was purchased from Beyotime Biotechnology Co., Ltd.; Gaussia luciferase reporter gene detection kit was purchased from Beyotime Biotechnology Co., Ltd.; Oligomycin A was purchased from Beyotime Biotechnology Co., Ltd., and metformin hydrochloride was purchased from selleck.

[0116] 3.3 Experimental methods and results

[0117] Plasmid hDndB-Luc (1 μg) was transfected into 293T cells using Lipo2000. The transfection method was the same as 1.3 above.

[0118] 24 hours after transfection, metformin hydrochloride was used as an ATP activator, treated with 0, 2mM, 4mM, 6mM, 8mM, and 10mM for 1h, and incubated at 37°C for 24h; the ATP kit was used as a control to detect the ATP content of the transfected cells, and the dual-luciferase content in the supernatant was also detected.

[0119] The experimental results are as follows Figure 4 It shows that in the cell supernatant of transfected cells, the content of dual luciferase and ATP content are linearly related. The linear equation is y=3438x+32287, and R 2 =0.9904, which has a very good correlation.

[0120] 4. Dual luciferase in the supernatant of transfected cells can detect intracellular ATP content in real time

[0121] 4.1 Cells and plasmids

[0122] 293T cells were purchased from the American Type Culture Collection (ATCC) and maintained by this laboratory. Plasmid hDndB-Luc containing hDndB and DN-luc was constructed by the applicant.

[0123] 4.2 Reagents

[0124] DMEM culture medium was purchased from GIBCO; Lipo2000 was purchased from Invitrogen; ATP detection kit was purchased from Beyotime Biotechnology Co., Ltd.; Gaussia luciferase reporter gene detection kit was purchased from Beyotime Biotechnology Co., Ltd.; and metformin hydrochloride was purchased from selleck.

[0125] 4.3 Experimental methods and results

[0126] Plasmid hDndB-Luc (1 μg) was transfected into 293T cells using Lipo2000. The transfection method was the same as 1.3 above.

[0127] 24 hours after transfection, metformin hydrochloride was used as an ATP activator, treated with 10mM for 1h, and incubated at 37℃ for 24h; then the cells and supernatants were taken for stimulation for 0, 2, 4, 8, and 10 hours respectively. The ATP kit was used as a control to detect the ATP content of the transfected cells and the dual luciferase content of the supernatant.

[0128] The experimental results are as follows Figure 5 It shows that in the cell supernatant of transfected cells, the dual luciferase content and the real-time ATP content conform to the above linear relationship.

[0129] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A recombinant plasmid for monitoring intracellular ATP content, characterized in that: The plasmid contains hDndB and DN-luc, and the expression is controlled by a common promoter.

2. The recombinant plasmid according to claim 1, characterized in that The hDndB is obtained by codon optimization of the DndB protein, and the optimized nucleotide sequence is shown in SEQ ID NO.

1.

3. The recombinant plasmid according to claim 1, characterized in that The DN-luc is a Gaussia secretory luciferase; the sequence of the DN-luc is shown in SEQ ID NO.

2.

4. The recombinant plasmid according to claim 1, characterized in that The hDndB and DN-luc are linked via an IRES sequence.

5. The recombinant plasmid according to claim 4, characterized in that The IRES sequence is shown as SEQ ID NO.

3.

6. The recombinant plasmid according to claim 4, characterized in that The sequence after hDndB and DN-luc are connected via the IRES sequence is shown in SEQ ID NO.

4.

7. Use of the recombinant plasmid according to any one of claims 1 to 6 in preparing a product for monitoring intracellular ATP content.

8. The use according to claim 7, characterized in that The product is a test kit.

9. The use according to claim 7, characterized in that The method for using the product is: transfecting the recombinant plasmid described in any one of claims 1 to 6 into cells for culturing, and measuring the intracellular ATP content 12 to 48 hours after transfection.

10. The use according to claim 9, characterized in that The transfection time is 24h.

Images