Electroporation buffer solution applied to exosome electroporation

Abstract

The invention belongs to the technical field of biology, and provides an electroporation buffer solution applied to exosome electroporation, the pH value is 6.8-9.8, the osmotic pressure is 80-320 mosm, water is used as a solvent, and the electroporation buffer solution comprises the following components: 15-25% w / v of iodixanol, 1.035-1.265 mM of KH2PO4, 22.5-27.5 mM of KCl, 0.18-0.22 mM of EDTA-2Na and 18-22 mM of HEPES. The electroporation buffer solution provided by the invention can improve the loading efficiency of the load and reduce damage to an exosome membrane structure and internal bioactive molecules in an electroporation process. The electroporation buffer solution can effectively reduce aggregation and fusion phenomena of exosomes after electroporation, and improves the stability and integrity of the exosomes. The electroporation buffer solution provided by the invention can improve the application degree of the exosome as a targeting drug delivery system.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to an electroporation buffer. Background Art

[0002] The disclosure of this background information is intended to enhance understanding of the general background of the invention and should not necessarily be taken as an acknowledgment or any form of suggestion that this information constitutes the prior art already known to a person skilled in the art.

[0003] Small interfering RNA (siRNA) is a powerful gene silencing tool that can specifically degrade the mRNA of the target gene, thereby regulating gene expression. However, siRNA has poor stability in the body, is easily degraded by nucleases, and has low cellular uptake efficiency. The success of RNAi therapy depends largely on siRNA vectors and delivery methods. Currently, the development of a suitable siRNA delivery system remains the main bottleneck of RNAi therapy.

[0004] Exosomes, as nanoscale vesicles secreted by cells, play a key role in intercellular communication. They can carry a variety of bioactive molecules, such as proteins, nucleic acids, etc., and have good biocompatibility and targeting. Since exosomes are produced by endogenous cells themselves and have the intrinsic ability to transport RNA in vivo, they become promising delivery carriers for siRNA. Loading siRNA into exosomes can improve its stability and cellular uptake efficiency, enhance its gene silencing effect, and provide new strategies for gene therapy and related disease research. The membrane of exosomes is a lipid bilayer structure with a certain hydrophobicity, while siRNA is a nucleic acid molecule with a negative charge. Without other auxiliary conditions, it is difficult for siRNA to spontaneously penetrate the exosome membrane and enter its interior.

[0005] Electroporation is a commonly used physical method for introducing exogenous molecules into cells or extracellular vesicles (such as exosomes). The principle is to apply a high-intensity electric field in a short period of time to reversibly electroporate the cell membrane or exosome membrane to form temporary pores, thereby allowing exogenous molecules to enter. In the process of loading exosomes with nucleic acid molecules such as siRNA, electroporation technology has certain advantages. It can achieve loading relatively quickly and can control the loading amount to a certain extent. However, there are still some problems with the current electroporation method, which limits its effect in exosome research and application. The membrane structure of exosomes is similar to that of cells, but it is more delicate and fragile. Parameters such as the electric field intensity and pulse time during electroporation need to be precisely controlled, otherwise it is easy to cause irreversible damage to the exosome membrane, resulting in structural destruction and loss of function of the exosomes. During the electroporation process, exosomes are prone to aggregation and fusion. This is because the electric field can change the charge distribution on the surface of the exosomes, so that they attract each other and aggregate together. Aggregated exosomes not only affect the uniformity of electroporation, resulting in the inability of some exosomes to effectively load siRNA, but may also form larger aggregates that are difficult to be taken up by cells or to function normally in the body circulation.

[0006] In the current scientific research and experimental fields, there is still no electroporation fluid specifically for exosomes. This situation is like a gully across the road of related research, which has brought many difficulties to the advancement of exosome-related experiments. When researchers perform exosome electroporation operations, they can only choose from existing general electroporation fluids, such as PBS, HEPES buffer, etc., but these electroporation fluids cannot meet the special needs of exosomes well. They cannot accurately adapt to the unique membrane structure and internal components of exosomes, resulting in the stability and integrity of exosomes being difficult to ensure during the electroporation process. On the other hand, the lack of specific electroporation fluids makes it difficult to improve the efficiency of electroporation, and the accuracy and repeatability of the data are also greatly reduced. This not only hinders the in-depth exploration of the functions and application potential of exosomes, but also slows down the progress of cutting-edge research such as exosome-based treatment methods and diagnostic technologies, seriously restricting the vigorous development of the exosome research field.

[0007] When used for exosome electroporation, the existing electroporation solution cannot provide a good buffer environment for siRNA, resulting in degradation or reduced activity of siRNA during the electroporation process. For example, patent application CN 114181974 A discloses a low-conductivity, low-osmotic pressure electroporation buffer and its application, including NaCl and sucrose, with a pH adjusted to 1-2. According to the applicant's previous test results and the research of Cheng et al. (Cheng Y, Zeng Q, Han Q, Xia W. Effect of pH, temperature and freezing-thawing on quantity changes and cellular uptake of exosomes. Protein Cell. 2019 Apr;10(4):295-299), this pH has a significant destructive effect on the stability of exosomes. In addition, the ionic strength, osmotic pressure and other parameters of the electroporation solution do not match the physiological environment of the exosomes, which may also affect the effect of electroporation and the subsequent function of the exosomes. Therefore, developing an ideal electroporation solution specifically suitable for exosome electroporation is one of the keys to solving the current bottleneck problem. Summary of the invention

[0008] In view of the problems that the current electroporation buffer (electroporation solution) for exosomes has low electroporation efficiency and poor stabilization effect on exosomes, the present invention provides an electroporation buffer for exosome electroporation, which has a high electroporation rate and good stabilization effect on exosomes.

[0009] Another object of the present invention is to provide a use of the above-mentioned electroporation buffer in the preparation of engineered exosomes.

[0010] To achieve the above purpose, the present invention adopts the following technical solution.

[0011] An electroporation buffer for exosomes, with a pH of 6.8-9.8, an osmotic pressure of 80-320mosm, water as a solvent, and comprising the following components: Iodixanol 15-25% w / v, KH2PO4 1.035-1.265mM, KCl 22.5-27.5mM, EDTA-2Na 0.18-0.22mM, HEPES 18-22 mM.

[0012] Preferably, the electroporation buffer for exosomes comprises the following components: Iodixanol 21% w / v, KH2PO4 1.15 mM, KCl 25 mM, EDTA-2Na 0.2 mM, HEPES 20 mM; Iodixanol 19% w / v, KH2PO4 1.05 mM, KCl 23 mM, EDTA-2Na 0.18 mM, HEPES 18 mM; Iodixanol 20% w / v, KH2PO4 1.15 mM, KCl 25 mM, EDTA-2Na 0.2 mM, HEPES 19 mM; or, Iodixanol 22% w / v, KH2PO4 1.25 mM, KCl 27 mM, EDTA-2Na 0.22 mM, HEPES 22 mM.

[0013] The above buffers may also contain trace components for adjusting pH, such as NaOH, KOH or HCl.

[0014] The preparation method of the electroporation buffer for exosomes can be obtained by conventional methods in the art, such as adding all the components into water to dissolve into a solution, and finally adjusting the pH and osmotic pressure; or, preparing the components into a stock solution and mixing them according to proportions, and finally adjusting the pH and osmotic pressure.

[0015] Preferably, the method comprises the following steps: (1) adding KH2PO4 and KCl to the iodixanol solution to obtain a solution, and then adding EDTA-2Na mother solution and HEPES mother solution to obtain a mixed solution; (2) Adjust the pH and osmotic pressure of the mixed solution to the required values.

[0016] A use of the electroporation buffer in preparing engineered exosomes, wherein the engineered exosomes are loaded with exogenous substances.

[0017] A method for preparing engineered exosomes comprises the following steps: (1) Mixing the exosome suspension, electroporation buffer, and loading solution to obtain a mixed solution; (2) The mixed solution is electroporated, mixed with exosome preservation solution after electroporation and placed on ice; (3) Purify the exosome suspension after electroporation to obtain engineered exosomes.

[0018] The cargo is selected from nucleic acids, polypeptides, and small molecule chemicals.

[0019] The nucleic acid may be DNA or RNA, and may also contain artificially synthesized nucleotide analogs and / or modified nucleotides; polypeptides with a molecular weight of less than 100 kDa or less than 90 kDa; and small molecule chemical agents with a molecular weight of no more than 1000.

[0020] Preferably, the loading substance is siRNA, shRNA, miRNA, nerve growth factor, 5-fluorouracil (5-FU), or paclitaxel.

[0021] The concentration of the exosomes in the mixed solution is (1-5)×10 11 / mL.

[0022] The volume percentage of the electroporation buffer in the mixed solution is not less than 70%. In order to prevent the current from being too large, the resistance of the mixed solution is adjusted to be no more than 100 ohms. When the resistance is too low, the volume ratio of the buffer is reduced; when the resistance is too large, the volume ratio of the buffer is increased.

[0023] Preferably, the mode of electroporation is decay+square (positive and negative alternating decay square wave + exponential wave dynamic decay), and the specific parameters are: perforation pulse voltage (Pp V): 150V-360V, perforation pulse on time (Pp on): 6ms, perforation pulse off time (Pp off): 10ms 50ms, electroporation pulse cycle (Pp cycle): 4-10; driving pulse decay wave voltage (PdV): 15V-25V, driving pulse decay wave on time (Pd on): 50ms, pulse interval (Pulse Gap): 50ms, decay times: 5-10, decay square wave (Decay): 40%.

[0024] In step (3), the exosome suspension can be purified by ultrafiltration or centrifugation.

[0025] An engineered exosome obtained by the above method.

[0026] The mechanism of the present invention is as follows: The electroporation buffer (electroporation solution) provided by the present invention can optimize the electric field distribution and energy transfer during the electroporation process, so that the exosome membrane is electroporated more evenly, thereby improving the loading efficiency of the load. Under the same electroporation conditions, the use of the new electroporation solution can increase the loading efficiency of siRNA by more than 16 times compared with the existing method, thereby improving the efficiency and repeatability of the siRNA experiment. By optimizing the composition and properties of the electroporation solution, a buffer system closer to its physiological environment is provided for the exosomes, reducing the damage to the exosome membrane structure and internal bioactive molecules during the electroporation process. The electroporation solution can effectively reduce the aggregation and fusion of exosomes after electroporation, and improve the stability and integrity of the exosomes. Among them, the added iodixanol can help maintain a suitable osmotic pressure. As an extracellular vesicle, the membrane structure of the exosome is relatively fragile. If the external osmotic pressure is too high, the water in the exosomes will seep out, causing the exosomes to shrink; conversely, if the external osmotic pressure is too low, the exosomes may absorb too much water and rupture. The presence of iodixanol can make the osmotic pressure of the electroporation solution close to the osmotic pressure inside the exosomes, ensuring that the exosomes will not rupture or deform due to changes in osmotic pressure. In addition, the electroporation process generates an electric field, which may cause changes in ion distribution in the solution and local temperature increases. As a non-ionic isotonic contrast agent, iodixanol has a relatively stable chemical structure. It can reduce the conductivity fluctuations caused by ion migration and electric field changes during electroporation. The added EDTA can effectively protect the stability of RNA during electroporation and prevent its degradation. At the same time, the parameters such as the ionic strength and pH value of the electroporation solution are optimized to provide a suitable environment for RNA, maintain its structural and functional integrity, and increase the effective loading capacity of RNA and subsequent biological activity. When the composition changes or the concentration exceeds the set concentration, it will lead to a decrease in the uptake of the cargo by the exosomes, damage to the membrane structure of the exosomes after electroporation, or aggregation and fusion after electroporation.

[0027] The present invention has the following advantages: The electroporation buffer provided by the present invention can improve the loading efficiency of the load and reduce the damage to the exosome membrane structure and internal bioactive molecules during the electroporation process. The electroporation buffer can effectively reduce the aggregation and fusion of exosomes after electroporation, and improve the stability and integrity of exosomes. The electroporation buffer can provide a suitable environment for RNA, maintain the integrity of its structure and function, and can also effectively protect the stability of RNA during the electroporation process to prevent its degradation. The electroporation buffer provided by the present invention can improve the application of exosomes as a targeted drug delivery system. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 is the standard curve of siRNA; Figure 2 is the Cy5 positive rate of different exosome flow cytometry detection; Figure 3 These are electron microscopic images of different exosomes; Figure 4 is the gene silencing effect of different exosomes; Figure 5 is the uptake of different exosomes by neural stem cells; Figure 6 is the loading amount of 5-FU by different exosomes; Figure 7 is the loading amount of miR-124-3p by different exosomes. DETAILED DESCRIPTION

[0029] The present invention will be further described below in conjunction with embodiments and drawings, but the present invention is not limited by the following embodiments.

[0030] Example 1 Preparation of electroporation buffer (electroporation solution) for exosomes Prepare the ingredients according to the recipe in the table below: Prepare as follows: (1) Calculate 60% (w / v) OptiPrep according to the formula TM The amount of separation solution (Sigma, D1556), KH2PO4 (Sinopharm, 10017618), and KCl (Sinopharm, 10016318) was added to the volumetric flask, and then OptiPrep TM Separation liquid, KH2PO4, KCl, each addition must be completely dissolved and mixed; (2) Calculate the amount of 0.5M EDTA-2Na (pH 8.0, Solarbio, E1170) stock solution and 1M HEPES (Sigma, H0887) stock solution according to the formula, and then add them to the volumetric flask in step (1); (3) Add ultrapure water to the volumetric flask. When the pH of the solution is close to the mark, measure the pH value and adjust the pH value to the required value by adding 1M HCl or 1M NaOH dropwise. Measure the osmotic pressure of the solution and adjust the pH value by adding or reducing OptiPrep TM Adjust to the osmotic pressure that meets the standard, then filter through a 0.22 μm filter membrane, and store at 4°C after aliquoting.

[0031] Example 2 Preparation of exosomes carrying siRNA 1. Preparation of Exosomes Resuscitated human embryonic kidney cells HEK293T were inoculated into cell culture dishes at a density of 5000 cells / cm² and cultured in DMEM medium containing 10% fetal bovine serum at 37°C and 5% CO2. When the confluence reached 75%, the cell culture supernatant was collected. The supernatant was first centrifuged at 3500g for 20 minutes to remove large impurities, and then filtered through a 0.22μm filter to remove small impurities. Then differential centrifugation was performed: (1) Removal of cell debris: 16500 rcf / min (11700 rpm), 30 min, retaining the supernatant; (2) Exosome precipitation: 120000 rcf / min (13500 rpm), 70 min, leaving the precipitate; (3) Washing exosome precipitate: 120000 rcf / min (13500 rpm), 70 min, leaving the precipitate; The exosomes were resuspended in an appropriate amount of PBS and centrifuged at 3000 g for 5 min to remove impurities such as protein polymers to obtain the exosome suspension, which was stored at -80°C.

[0032] 2. Exosomes loaded with siRNA Commercially synthesized siRNA modified with a Cy5 group at the 5' end (S: UGA CCU CAA CUA CAU GGU UTT; AS: AACCAU GUA GUU GAG GUC ATT) was dissolved in RNase-free water to prepare a stock solution with a concentration of 20 μM. After thorough mixing, the stock solution was divided and stored at -20°C in the dark. The exosome and siRNA stock solutions were mixed at 10 9 Add 400 pmol siRNA and 50 μL electroporation solution (Formula 1) to each exosome particle and add the mixture to the pre-cooled electroporation cup. The volume ratio of electroporation solution in the mixture is 80%. For electroporation, the parameters were set as follows: perforation pulse voltage setting Pp V: 150 V, perforation pulse on time Pp on: 6 ms, perforation pulse off time Pp off: 50 ms, electroporation pulse cycle Pp cycle: 7; drive pulse decay wave voltage setting Pd V: 15 V, drive pulse decay wave on time Pd on: 50 ms, pulse interval Pulse Gap: 50 ms, decay number Number: 6, pulse decay rate square wave Decay: 40%.

[0033] Immediately after electroporation, 100 μL of exosome preservation solution (6% w / v albumin + 12% v / v DMSO + 82% v / v PBS) was added to the electroporation cup, and the mixture was transferred to the pre-loaded exosome preservation solution after being gently pipetted 4-5 times. The mixture was placed on ice for 30 min. Unloaded exogenous molecules were then removed through a 100 KDa ultrafiltration membrane (0.5 mL 100 KD ultrafiltration centrifuge tube Amicon Ultra, Millipore), and the mixture was centrifuged at 3000 g for 30 s for 5 times to obtain engineered exosomes 1.

[0034] Engineered exosomes 2 were prepared according to the above method using electroporation buffer without iodixanol as a control.

[0035] 3. siRNA loading amount Prepare a series of standard solutions (0-50 nM) of the Cy5-modified siRNA in 2, and read the fluorescence intensity value of each standard well on a microplate reader with an excitation wavelength of 649 nm and an emission wavelength of 670 nm. Then, plot a concentration-fluorescence intensity standard curve with the siRNA concentration as the horizontal axis and the fluorescence intensity value as the vertical axis, and fit the regression equation ( Figure 1 ); The same fluorescence detection was performed on engineered exosomes 1 and 2, and the obtained fluorescence intensity values ​​were substituted into the regression equation to calculate the content of siRNA in the sample to be tested. The measurement was repeated three times in parallel.

[0036] Table 1 Concentration of siRNA in different engineered exosomes From the data in Table 1, it can be seen that the content of siRNA in exosome 1 after electroporation with electroporation buffer without adding iodixanol is only 8.7 pmol, and exosome 2 after electroporation with electroporation buffer adding iodixanol contains 140 pmol siRNA, which significantly increases the siRNA content, which is 16.15 times the content of exosome 1.

[0037] 4. siRNA loading rate The positive rate of Cy5 detected by nanoflow cytometry represents the loading rate of siRNA in engineered exosomes. Before the experiment, the instrument was calibrated using standard fluorescent microspheres. The two groups of engineered exosomes were diluted 100 times and then tested on the machine.

[0038] The results are as follows Figure 2 As shown, the proportion of Cy5-positive exosomes in the exosomes after electroporation with the electroporation buffer without iodixanol was only 32.4%, while the proportion of Cy5-positive exosomes in the exosomes after electroporation with the electroporation buffer with iodixanol was as high as 80%, which significantly improved the siRNA loading rate.

[0039] 5. Membrane integrity The two groups of engineered exosomes were observed by electron microscopy. Figure 3 As shown in the figure, the morphology of the two groups of exosomes remained basically unchanged, but the electron micrograph of exosome 2 showed that some exosomes had membrane damage (as indicated by the red arrows), while no obvious membrane changes were observed in exosome 1. This indicates that the addition of iodixanol to the electroporation buffer can effectively reduce the damage to the exosome membrane structure during the electroporation process, effectively reduce the damage of exosomes after electroporation, and improve the stability and integrity of exosomes.

[0040] 6. Gene silencing effect HEK293T cells were plated at 8000 cells / cm 2 Inoculate into 6-well plates and culture as follows: a. Control group (Control): cultured for two days, during which the medium was changed normally; b. siRNA group (siRNA): 24 hours after the cells were plated and adhered to the wall, 100 pmol siRNA was added without changing the medium; c. Normal exosome group (Exo): 1×10 10 exosomes; d. Engineered exosomes group 1 (Exo-1): 1×10 10 Engineered exosomes 1; e. Engineered exosomes group 2 (Exo-2): 1×10 10 Engineered exosomes 2; After adding different experimental materials, continue culturing for 24 hours, discard the original culture medium, wash with PBS, digest the cells and then lyse them, extract RNA, perform concentration measurement, reverse transcription and qPCR, and detect the expression level of the target gene (GAPDH).

[0041] The results are as follows Figure 4 As shown in the figure, siRNA cannot directly enter cells to exert its function. After being electroporated and loaded with exosomes, it can be delivered to cells to exert the function of gene silencing. The Exosome group also did not show an effective effect in reducing the target gene. In contrast, both the engineered exosome group 1 (Exo-1) and the engineered exosome group 2 (Exo-2) showed the ability to reduce the expression of the GAPDH gene. Among them, Exo-1 reduced the expression of the GAPDH gene more significantly, indicating that the exosomes produced by different electroporation buffers during the electroporation process differ in the efficiency of reducing gene expression, and the effect of Exo-1 is significantly better than that of Exo-2 (P < 0.001).

[0042] Example 3 Preparation of exosomes carrying polypeptides 1. Preparation of Exosomes Resuscitated umbilical cord mesenchymal stem cells (MSCs) were inoculated into cell culture dishes at a density of 8000 cells / cm² and cultured in DMEM medium containing 10% fetal bovine serum at 37°C and 5% CO2. When the confluence reached 75%, the cell culture supernatant was collected. The supernatant was first centrifuged at 3500g for 20 minutes to remove large impurities, and then filtered through a 0.22μm filter membrane to remove small impurities. Then tangential flow ultrafiltration was performed: The pre-filtered supernatant was passed through a tangential flow filtration system (Spectrum, KR2i) to allow the liquid to flow tangentially across the filter (300 kDa) surface under a certain transmembrane pressure. Exosomes are retained by the filter due to their size and properties, while small molecules, salt ions and other impurities flow out with the filtrate. The flow rate was adjusted to 1600 ml / min, the inlet pressure was 5-8 psi, the volume was concentrated 10-20 times, and the concentrate was collected and centrifuged at 3000 g for 15 minutes.

[0043] After tangential flow concentration, the exosome sample is transferred to an ultrafiltration device (100 kD). Start the ultrafiltration device and set the pressure to 1-3 psi for 30-60 minutes. During the ultrafiltration process, the small molecular impurities (such as free proteins, salt ions, etc.) in the exosome solution are driven by pressure to pass through the ultrafiltration membrane, while the exosomes are retained on the concentrated side of the ultrafiltration membrane.

[0044] The ultrafiltered exosomes were washed with PBS buffer to remove residual impurities. The buffer was added to the ultrafiltration device and PBS was passed through the ultrafiltration membrane at a low pressure (0.5-1psi). The washing process was repeated 2-3 times, and the liquid that passed through the ultrafiltration membrane was collected and discarded after each washing.

[0045] After ultrafiltration and washing, pour out the exosome solution on the concentrated side of the ultrafiltration membrane or use a pipette to collect it into a clean centrifuge tube. The collected exosomes can be packaged as needed and stored in a -80℃ refrigerator.

[0046] 2. Exosomes loaded with peptides Synthesize nerve growth factor (NGF) peptide (GEFSVCDSVSVWVGDKTTATDIK, 3.4KDa) labeled with FITC fluorescence. 1mg NGF peptide is prepared into 1mg / mL protein solution using 1mL 5% DMSO in PBS as solvent.

[0047] The exosomes and protein solution were mixed at 10 9 Add 400 ng of peptide and 50 μL of electroporation solution (Formula 2) to each exosome particle and add the mixture to the pre-cooled electroporation cup. Electroporation was performed using the parameters Pp V: 360 V, Pp on: 6 ms, Pp off: 10 ms; Pd V: 25 V, Pd on: 50 ms, Pd off: 50 ms, cycle: 10; Immediately after the electroporation, 100 μL of exosome preservation solution (6% w / v albumin + 12% v / v DMSO + 82% v / v PBS) was added to the electroporation cup, and the mixture was gently pipetted 4-5 times before being transferred to the pre-loaded exosome preservation solution. The mixture was placed on ice for 30 min, and then the unloaded exogenous molecules were removed by 100 KDa ultrafiltration membrane method, and the mixture was centrifuged at 3000 g for 30 s for 5 times to obtain engineered exosome 3.

[0048] Engineered exosomes 4 were prepared according to the above method, using electroporation buffer without iodixanol as a control.

[0049] The prepared engineered exosomes were added to neural stem cells (NSCs) for cell uptake experiments. 1×10 9 The engineered exosomes 3 and 4 were taken up by cells for 24 hours and then the following operations were performed: 1) Washing: discard the cell culture medium and wash 2-3 times with PBS (to remove the serum components in the culture medium); 2) Fixation: Slowly drip 4% PFA fixative into the wells along the well wall at a rate of 0.5 mL / well and fix for 30 minutes; 3) Washing: Aspirate and discard PFA, and wash with DPBS three times, aspirating as much solution as possible in the last wash; 4) Permeabilization: Use 0.5% TritonX-100 at 0.2 mL / pore for 15 min; 5) Washing: Wash the confocal dish 3 times with PBS, 10 min each time; 6) Labeling filamentous actin: Take 200 μL of the prepared rhodamine-phalloidin working solution (200 nM), cover the cells in the dish, and incubate at room temperature (4°C-37°C) in the dark for 30 minutes; 8) Washing: Wash the confocal dish 3 times with PBS, 10 min each time; 9) Nuclear staining: Use 200 μL DAPI solution (concentration 100 nM) to counterstain the cell nucleus for about 30 seconds; 10) Washing: Wash the cells 3 times with PBS, 10 min each time; 11) Take photos using a confocal microscope.

[0050] like Figure 5As shown, FITC (green) is only displayed in the uptake experiment of engineered exosome 3, indicating that after engineered exosome 3 is loaded with NGF polypeptide, NGF is delivered to nerve cells, improving the therapeutic effect of the drug. Engineered exosome 4 does not have a good loading effect.

[0051] Example 4 Preparation of exosomes carrying small molecule drugs 1. Preparation of Exosomes Resuscitated macrophage RAW264.7 cells were inoculated into cell culture dishes at a density of 10,000 cells / cm² and cultured in high-glucose DMEM medium containing 10% fetal bovine serum at 37°C and 5% CO2. When the confluence reached 75%, the cell culture supernatant was collected. The supernatant was first centrifuged at 3500g for 20 minutes to remove large impurities, and then filtered through a 0.22μm filter to remove small impurities. Then differential centrifugation was performed: (1) Removal of cell debris: 16500 rcf / min (11700 rpm), 30 min, retaining the supernatant; (2) Exosome precipitation: 120000 rcf / min (13500 rpm), 70 min, leaving the precipitate; (3) Washing exosome precipitate: 120000 rcf / min (13500 rpm), 70 min, leaving the precipitate; The exosomes were resuspended in an appropriate amount of PBS to obtain an exosome suspension, which was stored at -80°C.

[0052] 2. Exosomes loaded with 5-fluorouracil (5-FU) Dissolve 10 mg of 5-fluorouracil (5-FU) in 1.5375 mL of DMSO to make a 50 mM stock solution. Note: If stored at -80°C, use within 6 months. If stored at -20°C, use within 1 month.

[0053] Exosomes and 5-fluorouracil (5-FU) solution were mixed at 10 9 Add 500 nmol 5-FU and 50 μL electroporation solution (Formula 3) to each exosome particle and add the mixture to the pre-cooled electroporation cup. For electroporation, the parameters were set as follows: Pp V: 220 V, Pp on: 6 ms, Pp off: 50 ms; Pd V: 15 V, Pd on: 50 ms, Pd off: 50 ms, cycle: 6; Immediately after the electroporation, 100 μL of exosome preservation solution (6% w / v albumin + 12% v / v DMSO + 82% v / v PBS) was added to the electroporation cup, and the mixture was gently pipetted 4-5 times and then transferred to the pre-loaded exosome preservation solution. The mixture was placed on ice for 30 min. Unloaded exogenous molecules were then removed by 100 KDa ultrafiltration membrane method, and centrifuged at 3000 g for 30 s for 5 times. Engineered exosomes 5 were obtained.

[0054] Engineered exosomes 6 were prepared according to the above method using electroporation buffer without iodixanol as a control.

[0055] The absorbance was detected by an ELISA instrument. The detection method was as follows: 50 mM 5-FU was used to prepare a series of standards of different concentrations, such as 0.1nM, 1nM, 10nM, 0.1μM, 1μM, 10μM, 0.1mM, 1mM plus a blank point as standard curve samples. The samples were detected with an excitation light of 265nm in a Tecan ELISA instrument to draw a standard curve. Engineered exosomes 5 and 6 were taken for detection, substituted into the standard curve for calculation, and the content of 5-FU was calculated based on the relationship between absorbance and concentration. As shown in the figure, the electroporation buffer containing iodixanol can significantly improve the efficiency of exosome loading with 5-FU. After the buffer was improved, the loading amount of 5-FU increased by 2.71 times.

[0056] Example 5 Preparation of exosomes carrying miRNA 1. Preparation of Exosomes HEK293T cells were revived and inoculated into a cell culture dish at a density of 10,000 cells / cm². DMEM medium containing 10% fetal bovine serum was used for culture at 37°C and 5% CO2. When the confluency reached 75%, the cell culture supernatant was collected. The supernatant was first centrifuged at 3500g for 20 minutes to remove large impurities, and then filtered through a 0.22μm filter to remove small impurities. Then differential centrifugation was performed: (1) Removal of cell debris: 16500 rcf / min (11700 rpm), 30 min, retaining the supernatant; (2) Exosome precipitation: 120000 rcf / min (13500 rpm), 70 min, leaving the precipitate; (3) Washing exosome precipitate: 120000 rcf / min (13500 rpm), 70 min, leaving the precipitate; The exosomes were resuspended in an appropriate amount of PBS and centrifuged at 3000 g for 5 min to remove impurities such as protein polymers to obtain the exosome suspension, which was stored at -80°C.

[0057] 2. Exosomes loaded with miR-124-3p Commercially synthesized miR-124-3p (UAAGGCACGCGGUGAAUGCCAA) was dissolved in RNase-free water to prepare a stock solution with a concentration of 20 μM. After thorough mixing, the stock solution was stored in aliquots at -20°C. The exosome and miR-124-3p stock solutions were mixed at a ratio of 109 exosome particles plus 400 pmol miRNA and 50 μL electroporation solution (Formula 4) and added to the pre-cooled electroporation cup; For electroporation, the parameters were set as follows: Pp V: 300 V, Pp on: 6 ms, Pp off: 10 ms; Pd V: 25 V, Pd on: 50 ms, Pd off: 50 ms, cycle: 5; Immediately after electroporation, add 100 μL of exosome preservation solution (6% w / v albumin + 12% v / v DMSO + 82% v / v PBS) into the electroporation cup, gently pipette 4-5 times and transfer to the pre-loaded exosome preservation solution, and let stand on ice for 30 minutes; then remove unloaded exogenous molecules through a 100 KDa ultrafiltration membrane method, centrifuge at 3000 g for 30 seconds, and centrifuge 5 times to obtain engineered exosomes7.

[0058] Engineered exosomes were prepared as described above using electroporation buffer without iodixanol as a control 8.

[0059] The total RNA of engineered exosomes 7 and 8 was extracted by Trizol method, and 400 pmol of miRNA was used as the control group. The first strand of microRNA was reverse transcribed by All-in-one-miRNA qRT-PCR, and the reverse transcription product was diluted 10 times. Real-time PCR detection was performed with U6 as the internal reference. miR-124-3p (HmiRQP0074), U6 (HmiRQP9001) and downstream universal primers (Cat. No. P01011A) were purchased from Guangzhou Funeng Company. Figure 7 As shown, Exo-7 loaded significantly more miR-124-3p than Exo-8, indicating that the optimization of electrotransfer buffer has a significant effect on the electrotransfer loading of miRNA.

[0060] The above is only an embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various changes and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included in the scope of the claims of the present application.

Claims

1. An electroporation buffer for exosomes, using water as solvent, characterized in that: The pH is 6.8-9.8, the osmotic pressure is 80-320mosm, and the ingredients include: Iodixanol 15-25% w / v, KH2PO4 1.035-1.265mM, KCl 22.5-27.5mM, EDTA-2Na 0.18-0.22mM, HEPES 18-22 mM.

2. The electroporation buffer for exosomes according to claim 1, characterized in that The exosome electroporation buffer comprises the following components: Iodixanol 21% w / v, KH2PO4 1.15 mM, KCl 25 mM, EDTA-2Na 0.2 mM, HEPES 20 mM; Iodixanol 19% w / v, KH2PO4 1.05 mM, KCl 23 mM, EDTA-2Na 0.18 mM, HEPES 18 mM; Iodixanol 20% w / v, KH2PO4 1.15 mM, KCl 25 mM, EDTA-2Na 0.2 mM, HEPES 19 mM; or, Iodixanol 22% w / v, KH2PO4 1.25 mM, KCl 27 mM, EDTA-2Na 0.22 mM, HEPES 22 mM; The exosome electroporation buffer further comprises trace components for adjusting pH, such as NaOH, KOH or HCl.

3. The electroporation buffer for exosomes according to claim 1, characterized in that The method for preparing the electroporation buffer for exosomes comprises the following steps: (1) adding KH2PO4 and KCl to the iodixanol solution to obtain a solution, and then adding EDTA-2Na mother solution and HEPES mother solution to obtain a mixed solution; (2) Adjust the pH and osmotic pressure of the mixed solution to the required values.

4. Use of the electroporation buffer for exosomes as described in any one of claims 1 to 3 in the preparation of engineered exosomes.

5. A method for preparing engineered exosomes, characterized in that: The following steps are involved: (1) mixing an exosome suspension, an electroporation buffer for exosomes according to any one of claims 1 to 3, and a loading solution to obtain a mixed solution; (2) The mixed solution is electroporated, mixed with exosome preservation solution after electroporation and placed on ice; (3) Purify the exosome suspension after electroporation to obtain engineered exosomes.

6. The preparation method according to claim 5, characterized in that: The cargo is selected from nucleic acids, polypeptides, and small molecule chemicals; The concentration of the exosomes in the mixed solution is (1-5)×10 11 / mL; The volume percentage of the electroporation buffer in the mixed solution is not less than 70%; The resistance of the mixed solution is not higher than 100 ohms; In step (3), the exosome suspension is purified by ultrafiltration or centrifugation.

7. The preparation method according to claim 5, characterized in that: The nucleic acid is DNA or RNA, and the nucleic acid also contains artificially synthesized nucleotide analogs and / or modified nucleotides; the polypeptide is a polypeptide with a molecular weight less than 100kDa, or less than 90kDa; the molecular weight of the small molecule chemical agent is not greater than 1000.

8. The preparation method according to claim 5, characterized in that: The loading substance is siRNA, shRNA, miRNA, nerve growth factor, 5-fluorouracil or paclitaxel; The electroporation mode is positive and negative alternating decay square wave + exponential wave dynamic decay, and the specific parameters are: perforation pulse voltage: 150V-360V, perforation pulse start time: 6ms, perforation pulse end time: 10ms 50ms, electroporation pulse cycle: 4-10; Driving pulse attenuation wave voltage: 15V-25V, driving pulse attenuation wave opening time: 50ms, pulse interval: 50ms, attenuation times: 5-10, attenuation square wave: 40%.

9. An engineered exosome obtained by the preparation method according to any one of claims 1 to 8.

Images