South America white shrimp nitrite stress resistance character related gene SNP (Single Nucleotide Polymorphism) marker, detection primer and application thereof

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) marker for nitrite stress resistance character related genes of penaeus vannamei, a detection primer and application of the SNP marker. The SNP molecular marker is located at a 193bp site of a sequence as shown in SEQ ID NO.2, and the mutation types are A / A homozygosis, G / G homozygosis and A / G heterozygosis. The nitrite capacity of the South America white prawn with the A / A homozygous genotype is obviously higher than that of the South America white prawn with the G / G homozygous and A / G heterozygous genotypes. According to the invention, the SNP marker related to the nitrite stress resistance character of the penaeus vannamei is explored, and a method for molecular marker-assisted nitrite-resistant breeding of the penaeus vannamei is established by applying the marker, so that the breeding process of nitrite-resistant excellent varieties of the penaeus vannamei is accelerated.

Description

Technical Field

[0001] The invention belongs to the field of molecular marker-assisted breeding of aquatic animals, and specifically relates to a SNP marker of a gene related to nitrite resistance traits of white shrimp, a detection primer and an application thereof. Background Art

[0002] The white shrimp, scientifically known as Litopenaeus vannamei, is the world's largest shrimp farmed on a large scale. It is native to the Pacific coast of the Western Hemisphere from southwestern Mexico to western Peru. There is a lack of local wild resources in my country. Although my country is not the country of origin of white shrimp, so far, my country has bred 12 new varieties of white shrimp with variety rights, and the breeding traits are concentrated in growth rate, low temperature resistance, and resistance to Vibrio disease. At the same time, my country is currently the world's largest white shrimp farming country. According to the "China Fisheries Statistical Yearbook 2023", the national marine aquaculture white shrimp production in 2022 was 1.34 million tons, accounting for 81% of the total marine aquaculture shrimp production in my country.

[0003] The development needs of industry and agriculture, the discharge of industrial wastewater and domestic sewage, the increasing use of fertilizers, and the development of high-density aquaculture have aggravated the accumulation of ammonia and nitrite in water bodies. When crustaceans are in an abnormal environment, the body will produce a large amount of reactive oxygen. If the reactive oxygen content exceeds the range of the antioxidant system, it will cause oxidative damage to the body itself, leading to death, which restricts the healthy development of shrimp farming. Therefore, breeding for high nitrite traits in white shrimp can provide theoretical support for stress resistance breeding of white shrimp.

[0004] Traditional breeding methods have long cycles and low efficiency. With the rapid transformation of modern biotechnology and genetics in the field of aquaculture, molecular marker technology based on trait-related functional genes has become one of the key technologies in aquatic genetic breeding. Single nucleotide polymorphism (SNP) is a third-generation molecular marker with a high distribution density in the genome. SNP has been widely used in aquatic genetic breeding because of its advantages such as rapid and large-scale screening, easy typing, and high genetic stability. Summary of the invention

[0005] The present invention aims to accelerate the breeding process of superior stress-resistant varieties of Penaeus vannamei by exploring SNP markers related to nitrite stress resistance of Penaeus vannamei and establishing a method for molecular marker-assisted stress resistance breeding of Penaeus vannamei by applying the markers.

[0006] The first object of the present invention is to provide a SNP molecular marker of a gene related to nitrite resistance of white shrimp, wherein the SNP molecular marker is located at the 193bp site of the sequence shown in SEQ ID NO.2, and the mutation types are A / A homozygous, G / G homozygous and A / G heterozygous.

[0007] The present invention finds the polymorphism of the catalase gene (Lv-Catalase) of white shrimp (its nucleotide sequence is shown in SEQ ID NO.2). The site is located at the 193bp position of the catalase gene, the base is A or G, and the survival rate of white shrimp homozygous for A (A / A) under nitrite stress is significantly higher than that of A / G heterozygous and G / G homozygous. The white shrimp individuals with the A / A genotype at the SNP site have good stress resistance, so the stress resistance advantage genotype of the SNP molecular marker is the A / A homozygous genotype.

[0008] Therefore, the present invention provides a SNP molecular marker for distinguishing the nitrite resistance of white shrimp, which is located at the 103bp site of the CDS region of the white shrimp catalase gene (whose nucleotide sequence is shown in SEQ ID NO.2), and the mutation types are A / A homozygous, G / G homozygous and A / G heterozygous.

[0009] The second object of the present invention is to provide a detection primer for SNP molecular markers of genes related to nitrite resistance traits of white shrimp, which comprises the following primers:

[0010] Lv-Cat-F: 5'-TTGTTTGTGCTAAGATGAGG-3';

[0011] Lv-Cat-R: 5'-GAATGAAAATGTAAGTGGCA-3'.

[0012] The detection primers are stable and repeatable in amplification. The nucleotide sequence of the amplified product is shown in SEQ ID NO.2. The SNP site is located at the 193bp position of the amplified product sequence, which is a mutation from A to G. The dominant genotype of the marker for nitrite resistance is the A / A homozygous genotype.

[0013] The third object of the present invention is to provide a detection kit, which comprises the above-mentioned detection primers Lv-Cat-F and Lv-Cat-R.

[0014] The fourth object of the present invention is to provide the use of the above-mentioned SNP molecular marker, the above-mentioned detection primer or the above-mentioned detection kit in distinguishing the ability of white shrimp to resist nitrite.

[0015] Preferably, the SNP molecular marker is that the ability of white shrimp with A / A homozygous genotype to resist nitrite is significantly higher than that of G / G homozygous and A / G heterozygous genotypes.

[0016] The fifth object of the present invention is to provide the use of the above-mentioned SNP molecular marker, the above-mentioned detection primer or the above-mentioned detection kit in the individual identification of whiteleg shrimp broodstock with nitrite resistance, population breeding or the maintenance of high-resistant strains of whiteleg shrimp resistant to nitrite.

[0017] The sixth object of the present invention is to provide a product for identifying the above-mentioned SNP molecular markers for use in preparing a reagent for distinguishing the ability of white shrimp to resist nitrite.

[0018] A seventh object of the present invention is to provide a method for breeding a nitrite-resistant variety of Penaeus vannamei, comprising the following steps:

[0019] a. Extracting the genomic DNA of Penaeus vannamei to be tested;

[0020] b. Performing PCR amplification on the genomic DNA of Penaeus vannamei to be tested using the above-mentioned detection primers Lv-Cat-F and Lv-Cat-R;

[0021] c. Sequencing the amplified product to determine the genotype of the molecular SNP marker, and selecting A / A homozygous genotype individuals as reserve parents for breeding of nitrite-resistant varieties of white shrimp.

[0022] Preferably, the PCR amplification reaction system comprises: 15 μL of 2×Taq PCR Master Mix, 2 μL of forward primer, 2 μL of reverse primer, 1 μL of DNA template, and the rest is made up to 30 μL with sterile double distilled water.

[0023] Preferably, the reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 2 minutes; denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 30 seconds, for a total of 35 cycles; and extension at 72°C for another 10 minutes.

[0024] Preferably, the PCR amplification product is subjected to Sanger sequencing using ABI 3730xl DNA Analyzer sequencer.

[0025] Advantages of the present invention:

[0026] The present invention discovers SNP markers related to the nitrite resistance trait of white shrimp, and establishes a method for effectively carrying out molecular marker-assisted genetic breeding of white shrimp with nitrite resistance by applying the markers. The method has high efficiency and simple operation, accelerates the breeding process of excellent white shrimp nitrite resistance varieties, and the genotype of the bred individuals is stable without genetic differentiation. The progress of stress resistance breeding can be significantly accelerated, and the method has important guiding significance for improving the stress resistance breeding of white shrimp. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a gel image of DNA electrophoresis test of white shrimp. M is StarMarker D2000 Plus Cat#M021 (Tianyi Huiyuan Biotechnology Co., Ltd.). The negative control (negative) template is a sterile water sample, proving that the extraction process is pollution-free. The positive control (positive) template is a verified fish fin DNA, proving that the extraction process is normal.

[0028] Figure 2 It is the electrophoresis diagram of the random inspection of PCR amplification products, and M is DL2000 (Tianyi Huiyuan Biotechnology Co., Ltd.).

[0029] Figure 3 This is the A / A homozygous, G / G homozygous and A / G heterozygous peak diagram of the 103bp position amplified by the Lv-Cat-F and Lv-Cat-R primer pairs of the catalase gene of white shrimp. DETAILED DESCRIPTION

[0030] The present invention is further described below with reference to the embodiments, but is not limited thereto.

[0031] The experimental methods in the following examples, unless otherwise specified, are all conventional methods or carried out according to the instructions of the kit. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial channels. Cloning sequencing and primer synthesis were completed by Wuhan Tianyi Huayu Gene Technology Co., Ltd.

[0032] Embodiment 1:

[0033] 1. Collection of samples of Penaeus vannamei resistance to nitrite

[0034] 1.1 Stress resistance test

[0035] In a shrimp farm in Maoming, whiteleg shrimps with a body length of about 3 cm were collected and subjected to a nitrite stress experiment (sodium nitrite was used to make the final concentration of NO2-N 100 mg / L (in terms of nitrogen)). The number of survivors after 72 hours of stress treatment was recorded. The results are shown in Table 1 below:

[0036] Table 1 Nitrite resistance test results

[0037] Number of experimental shrimp fry (tails) 118 (last) 24-hour death rate in stress resistance test 17 Number of deaths after 48 hours of stress test 19 Number of deaths after 72 hours of stress resistance test 20 Stress test 72h survival number 62

[0038] 1.2 Collection of samples of Penaeus vannamei resistance to nitrite

[0039] The white shrimp that survived 72 hours after nitrite stress were taken as nitrite-resistant samples, and the vannamei that died after 72 hours (including before 72 hours) were taken as non-nitrite-resistant samples. 48 samples were taken from the nitrite-resistant and non-resistant samples for testing.

[0040] 2. Development of stress-resistant SNP markers

[0041] 2.1 Extraction of genomic DNA from stress-resistant and non-stress-resistant Penaeus chinensis

[0042] 48 stress-resistant and non-stress-resistant individuals were selected and the experiment was carried out using a magnetic bead tissue genome extraction kit (NMG0611-500, Wuhan Nano-magnetic Biotechnology Co., Ltd.). Take 30-50 mg of sample, cut it into pieces and place it in the corresponding wells of the extraction plate; add 400 μL tissue lysis solution and 5 μL proteinase K to each well of the sample plate, shake and mix, and place it in a 65°C constant temperature box for overnight digestion; in a new extraction plate, dispense 100 μL of magnetic beads per well and place it in station 2 of the extractor, dispense three plates of 500 μL / well of 75% ethanol and place them in stations 3, 4, and 5 respectively, dispense 100 μL / 80 μL / 60 μL (dispense the corresponding volume according to the sample status) of elution solution per well and place it in station 6; the next day, take out the extraction plate (sample plate) and place it in station 1 of the extractor, start the program to lyse for 15 minutes, after the lysis is completed, add 280 μL of isopropanol to each well of the sample plate, and place the sample plate in station 1 of the extractor; select the corresponding program, check the instrument status and extraction plate information and run it; after the run is completed, take out the elution plate for DNA concentration and electrophoresis gel detection, and store it at 4°C. Take 2μL DNA stock solution and add 2μL bromophenol blue for agarose gel electrophoresis detection, gel concentration: 1%, marker loading volume: 2μL, voltage: 120v, electrophoresis time: 20min. DNA electrophoresis detection gel map as shown below Figure 1 shown.

[0043] 2.2 PCR primer design

[0044] Based on the mRNA sequence of the catalase gene of Penaeus vannamei obtained from NCBI (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) (GenBank: AY518322.1) (its nucleotide sequence is shown in SEQ ID NO.1), primers were designed to amplify the CDS region of the Catalase gene. The primers were located upstream and downstream of the CDS region, and the design requirements were: primer length 18-22 bp, GC content 40-60%, Tm value 50-62°C, the difference between the Tm values ​​of the upstream and downstream primers was no more than 5, and primer dimers, hairpin structures and mismatches were avoided as much as possible.

[0045] 2.3 Amplification primers:

[0046] The primer sequences are as follows:

[0047] Lv-Cat-F(1-20):5'-TTGTTTGTGCTAAGATGAGG-3';

[0048] Lv-Cat-R(848-867): 5'-GAATGAAAATGTAAGTGGCA-3'.

[0049] The numbers in brackets represent the positions of the nucleotides in the primer in the upstream and downstream sequences of the Catalase CDS region (the nucleotide sequence of which is shown in SEQ ID NO.2).

[0050] 2.4 PCR amplification system:

[0051] Table 2 PCR amplification system

[0052]

[0053] 2.5PCR amplification reaction procedure:

[0054] Pre-denaturation at 95°C for 2 minutes; denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 30 seconds, for a total of 35 cycles; and extension at 72°C for another 10 minutes.

[0055] 2.6 PCR product analysis

[0056] Electrophoresis identification: To ensure the specificity of PCR amplification, after PCR amplification, take 2 μL of PCR product for agarose gel electrophoresis (1% concentration) to determine the specificity of each sample amplification product by the band pattern of the PCR product. This step is defaulted to random inspection ( Figure 2 ).

[0057] Sanger sequencing: According to the results of PCR product electrophoresis, the PCR products that meet the target fragment size are subjected to Sanger sequencing. The sequencing platform is ABI's 3730xL DNA Analyzer sequencer.

[0058] 2.7 Screening of SNP loci and SNP genotype analysis

[0059] The sequencing peaks of all amplified products were compared and analyzed to screen SNP sites, and a total of 6 SNP sites were detected (see Table 3). The genotype frequencies of each SNP site in the nitrite stress resistant and non-resistant groups were tested by the non-parametric test method (chi-square test) in SPSS16.0, and the restrictive threshold P = 0.05 was set. The results showed that the genotype of the SNP site at the 103rd bp of the CDS region of the sequence amplified by the above Lv-Cat F and Lv-Cat R primers was significantly different in the resistant and non-resistant white shrimp (P < 0.05). The SNP site was located at the 103rd base in the box from the 5' end of the SEQ ID NO.2 sequence. The SNP marker was a white shrimp nitrite resistance marker, and the box part represented the CDS sequence (the SNP site was a mixed base R with an underline and bold, and R represented A or G) with A / A homozygous, A / G heterozygous and GG homozygous (see the peak diagram Figure 3 ) three genotypes, among which the A / A homozygous genotype was only detected in the resistance of white shrimp to nitrite stress (Table 3), indicating that the A / A homozygous genotype was the dominant genotype for nitrite stress resistance. A method for molecular marker-assisted nitrite-resistant breeding of white shrimp was established by applying this marker, which accelerated the breeding process of excellent nitrite-resistant white shrimp varieties.

[0060] Table 3 SNP sites in Lv-Cat sequences, genotypes, frequencies and difference tests of SNP sites

[0061]

[0062] NR samples represent nitrite-resistant samples, NS samples represent samples that are not resistant to high nitrite stress, and the numbers in the second column represent SNPs

[0063] The position of the site in the CDS region of the Lv-Cat sequence

[0064] SEQ ID NO.1 (nucleotide sequence of the catalase gene of Penaeus vannamei)

[0065] TCCTTCTTCTGCAGCCTCAGTTGGACGTTCTAGGATATTTTACGTCTCTGTTTTCACCTCTAAATCTTCAAGATGCCGCGTGACAAGTGTGCAGAGCAATTGAATGACTTCAAGAAACAACAGACGGCTCCCGATAACCTGACCACGAGCCATGGGTGCCCACTTGCGGACAAGCTTAATTCCCTGACTGTAGGTCCAAGGGGCCCCATCCTCCTGCAGGACATTCA A

[0066] TTGTTTGTGCTAAGATGAGG GAATTTGTGCAGTGCTATTTACAGTATGCCATTCCAC AATGTCTCTAATTCATCATGCTTGTTTTCTGCA

[0067] ACTAGTTGTTTAATTCTTATAACTTTTTTG

[0068] TTGGTATTGTCATATTACTATTATGATCATTATCACTGTCAACTTTATCTTTATCGTTATTGTT

[0069] ATTATTATTGTTATCTTTATCATTATCTTAATTTTTATTGCTGCCCTGACCAAGTGTATTAGA

[0070] ATTGGTATTATAAGTAGTGTTTATTARTCCTGTTTATCAATATTAGTATCGATATAATTATGAT

[0071] GATATATAGAGAGATGATACAAAGGCTAGAGAACTCAGGCTGTGTGAGTGGGATCAGGT

[0072] GGTATGaAACATGCAGATTGTTACTAATGAAATTCAATATATTTA

[0073] TAGATATATGCAGTGGAAATTTTGAATGGGAATGAATTTGTAATTAAC

[0074] ATTTAGAATTTCATCTTGTCAGAATCACACTAAGTGTTGTTCTGTGGAAAAAAATATTG

[0075] AAA TGCCACTTACATTTTCATTC ACTTACATTTTCATTCAACATCTCCTTACCGGGATGTG

[0076] TGAGGTGCT

[0077] The boxed part is the CDS region, R represents the SNP site, and the remaining sequences are the upstream and downstream sequences of the CDS.

Claims

1. A SNP molecular marker for a gene related to nitrite resistance of Penaeus vannamei, characterized in that: The SNP molecular marker is located at the 193bp site of the sequence shown in SEQ ID NO.2, and the mutation types are A / A homozygous, G / G homozygous and A / G heterozygous.

2. A detection primer for SNP molecular markers of genes related to nitrite resistance of white shrimp, characterized in that: The following primers were included: Lv-Cat-F: 5'-TTGTTTGTGCTAAGATGAGG-3'; Lv-Cat-R: 5'-GAATGAAAATGTAAGTGGCA-3'.

3. A detection kit, characterized in that: Contains the detection primer according to claim 2.

4. Use of the SNP molecular marker according to claim 1, the detection primer according to claim 2 or the detection kit according to claim 3 in distinguishing the nitrite resistance of Penaeus vannamei.

5. The use according to claim 4, characterized in that: The SNP molecular marker is that the ability of the white shrimp with A / A homozygous genotype to resist nitrite is significantly higher than that of G / G homozygous and A / G heterozygous genotypes.

6. Use of the SNP molecular marker according to claim 1, the detection primer according to claim 2 or the detection kit according to claim 3 in individual identification of nitrite-resistant Penaeus vannamei broodstock, population breeding or maintenance of nitrite-resistant Penaeus vannamei high-resistant strains.

7. Use of the product for identifying the SNP molecular markers according to claim 1 in preparing a reagent for distinguishing the nitrite resistance of Penaeus vannamei.

8. A method for breeding a nitrite-resistant variety of Penaeus vannamei, characterized in that: The following steps are involved: a. Extracting the genomic DNA of Penaeus vannamei to be tested; b. Perform PCR amplification on the genomic DNA of Penaeus vannamei to be tested using the detection primers Lv-Cat-F and Lv-Cat-R described in claim 2; c. Sequencing the amplified product to determine the genotype of the molecular SNP marker according to claim 1, and selecting individuals with A / A homozygous genotype as backup parents for breeding of nitrite-resistant varieties of white shrimp.

9. The method according to claim 8, characterized in that The PCR amplification reaction system includes: 2×TaqPCRMaster Mix 15 μL, forward primer 2 μL, reverse primer 2 μL, DNA template 1 μL, and the rest is supplemented to 30 μL by sterile double distilled water.

10. The method according to claim 8, characterized in that The reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 2 minutes; denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 30 seconds, a total of 35 cycles; and extension at 72°C for another 10 minutes.

Images