Bacillus thermoamyloliquefaciens detection method and kit

Abstract

The invention relates to a primer group for nucleic acid amplification of bacillus thermoamylovorans as well as a nucleic acid detection method and a kit for correspondingly, rapidly and sensitively detecting the bacillus thermoamylovorans. The invention overcomes the defects of long time consumption, tedious process and the like of the existing detection method for the bacillus thermoamyloliquefaciens, provides a detection method which is high in sensitivity, good in specificity, strong in repeatability, rapid in detection result and capable of reducing pollution, and shows wide application potential in the field of detection of the bacillus thermoamyloliquefaciens.

Description

Technical Field

[0001] The present invention relates to the technical field of amplification and detection, and in particular to a primer for amplifying Bacillus thermoamylovorans, and a related detection method and kit involved therefrom. Background Art

[0002] Milk contaminated with trace amounts of foodborne pathogens poses a serious threat to food safety and public health. Therefore, rapid and accurate detection of foodborne pathogens in milk is of vital importance. Contamination of dairy products with spore-forming bacteria is a daily challenge for the dairy industry. Spore-forming bacteria are ubiquitous in nature due to their highly adaptable spores.

[0003] Bacillus thermoamylovorans is a new spore-forming bacterium that has emerged in the dairy industry. The threat of B. thermoamylovorans contamination is increasing, not only in food ingredients and raw milk, but also in pasteurized milk and dairy products. Animal feed, processing equipment and farm environment are potential entry points for milk contamination with B. thermoamylovorans. The ability of B. thermoamylovorans to produce lipolytic enzymes and β-galactosidase has been associated with food spoilage. B. thermoamylovorans spores have comparable heat resistance to Bacillus sporothermodurans spores, indicating the potential to survive ultra-high temperature treatment. Current detection methods for B. thermoamylovorans mainly rely on bacterial isolation culture and mass spectrometry technology, but this detection method is time-consuming and the detection process is relatively cumbersome.

[0004] Therefore, there is still a need in the art for a highly sensitive and specific method for rapid detection of thermomylophagic Bacillus. Summary of the invention

[0005] The inventors used the nucleic acid method to detect thermomylophagous Bacillus for the first time, selected 16SrDNA, gyrA or lipase gene as the detection target gene, screened out several pairs of primer pairs and probes that can efficiently and sensitively detect thermomylophagous Bacillus, and achieved rapid detection of specific genes for thermomylophagous Bacillus, thereby realizing the present invention.

[0006] Therefore, in a first aspect, the present invention provides a primer pair for Bacillus thermoamylovorans nucleic acid amplification, wherein the primer pair is directed against 16S rDNA, gyrA or lipase gene of Bacillus thermoamylovorans.

[0007] In a second aspect, the present invention provides a probe for detecting Bacillus thermoamylovorans nucleic acid, wherein the probe is directed to 16S rDNA, gyrA or lipase gene of Bacillus thermoamylovorans.

[0008] In a third aspect, the present invention provides a primer-probe reaction system for detecting Bacillus thermoamylovorans, wherein the primer-probe reaction system comprises one or more primer pairs of the first aspect.

[0009] In a fourth aspect, the present invention provides a method for detecting Bacillus thermoamylovorans, comprising:

[0010] 1) Providing a nucleic acid sample of Bacillus amylovora;

[0011] 2) using the nucleic acid sample as a template, and using one or more primer pairs of the first aspect to amplify Bacillus thermomylophagous nucleic acid; and

[0012] 3) Detection using one or more probes of the second aspect.

[0013] In a fifth aspect, the present invention provides a kit for detecting Bacillus thermoamylovorans, comprising:

[0014] 1) one or more primer pairs of the first aspect;

[0015] 2) one or more probes of the second aspect; and

[0016] 3) Instructions for use for indicating how to use the kit.

[0017] In summary, the present invention uses 16SrDNA, gyrA or lipase gene of Bacillus thermoamylovorans as detection target gene, and provides a primer set for nucleic acid amplification of Bacillus thermoamylovorans, and a nucleic acid detection method and a kit for detecting Bacillus thermoamylovorans accordingly. The detection method of the present invention has high sensitivity (the minimum detection limit can reach 100 cfu / mL), good specificity, strong repeatability, fast detection results and can reduce pollution at the same time. The present invention overcomes the defects of the existing detection method for Bacillus thermoamylovorans, such as long time consumption and cumbersome process, and shows broad application potential in the detection field of Bacillus thermoamylovorans, and can be used for rapid detection of dairy products such as milk. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the specific implementation of the present invention or the technical solution in the prior art, the drawings required for use in the specific implementation or the description of the prior art are briefly introduced below.

[0019] Figure 1 The schematic diagram of amplification of primers and probes designed for 16SrDNA, gyrA and lipase genes of Bacillus thermomylovora is shown.

[0020] Figure 2 The diagram shows the amplification of primers and probes further designed for the gyrA gene of Bacillus thermomylovora.

[0021] Figure 3 The results of sensitivity detection of the primer pair and probe according to the present invention against Bacillus thermomylophagous are shown.

[0022] Figure 4 The specific detection results of the primer pair and probe according to the present invention for the concentration of thermoamylophagous Bacillus are shown. DETAILED DESCRIPTION

[0023] Hereinafter, the present invention will be described in detail with reference to the accompanying drawings. It should be understood that the following description is only used to illustrate the present invention by way of example, and is not intended to limit the scope of the present invention. The scope of protection of the present invention shall be subject to the attached claims. In addition, those skilled in the art will understand that the technical solution of the present invention may be modified without departing from the spirit and purpose of the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0024] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter described herein belongs. Before describing the present invention in detail, the following definitions are provided for a better understanding of the present invention.

[0025] Where a numerical range is provided, such as a concentration range, a percentage range, or a ratio range, it is understood that each intervening value to one-tenth of the unit of the lower limit between the upper and lower limits of the range and any other stated or intervening values ​​in the stated range are included in the subject matter unless the context clearly dictates otherwise. The upper and lower limits of these smaller ranges may be independently included in the smaller ranges, and such embodiments are also included in the subject matter, subject to any specifically excluded limit in the stated range. Where the stated range includes one or two limits, ranges excluding either or both of those included limits are also included in the subject matter.

[0026] In the context of the present invention, many embodiments use the expressions "comprising", "including" or "consisting essentially / mainly of..." The expressions "comprising", "including" or "consisting essentially / mainly of..." can usually be understood as open-ended expressions, indicating that it includes not only the elements, components, assemblies, method steps, etc. specifically listed after the expression, but also other elements, components, assemblies, method steps. In addition, in this article, the expressions "comprising", "including" or "consisting essentially / mainly of..." can also be understood as closed expressions in some cases, indicating that it only includes the elements, components, assemblies, method steps specifically listed after the expression, but does not include any other elements, components, assemblies, method steps. At this time, the expression is equivalent to the expression "consisting of..."

[0027] In order to better understand the present teachings and not to limit the scope of the present teachings, unless otherwise indicated, all numbers and other numerical values ​​used in the specification and claims indicating quantities, percentages or ratios should be understood as being modified by the term "about" in all cases. Therefore, unless otherwise indicated, the numerical parameters set forth in the following specification and the appended claims are approximate values, which may vary depending on the desired properties sought to be obtained. At a minimum, each numerical parameter should at least be interpreted in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0028] In the present invention, primer pairs and probes were designed for 16SrDNA, gyrA and lipase genes in the thermoamylovorous Bacillus sequence.

[0029] Therefore, in a first aspect, the present invention provides a primer pair for Bacillus thermoamylovorans nucleic acid amplification, wherein the primer pair is directed against 16S rDNA, gyrA or lipase gene of Bacillus thermoamylovorans.

[0030] In a specific embodiment, the primer pair for the 16SrDNA gene includes an upstream primer whose sequence is shown in SEQ ID NO.1 and a downstream primer whose sequence is shown in SEQ ID NO.2, wherein:

[0031] SEQ ID NO.1: TAGATTATCTTTCCGCCTGG

[0032] SEQ ID NO. 2: CCGTTACCTCACCAACTA.

[0033] In another specific embodiment, the primer pair for the gyrA gene includes an upstream primer having a sequence as shown in SEQ ID NO.4, SEQ ID NO.10, SEQ ID NO.13 or SEQ ID NO.16 and a downstream primer having a sequence as shown in SEQ ID NO.5, SEQ ID NO.11, SEQ ID NO.14 or SEQ ID NO.17, wherein:

[0034] SEQ ID NO.4:AATCGGAACAATGCATCCAT

[0035] SEQ ID NO.5: CAGCTGCGACCAATGACA

[0036] SEQ ID NO.10: TGCGGATTGTCATGGAACTC

[0037] SEQ ID NO.11: TTCACAAGGGCAAGGTTATT

[0038] SEQ ID NO.13: CGAAAAGACGTGAATGCCAA

[0039] SEQ ID NO.14: TGACCGTTCACAAGGGCAAG

[0040] SEQ ID NO.16:ACTCCGAAAAGACGTGAATG

[0041] SEQ ID NO. 17: CACAAGGGCAAGGTTATTGA.

[0042] When the above embodiment is adopted, it can be understood that any one of the upstream primers for the gyrA gene can be used in combination with any one of the downstream primers for the gyrA gene.

[0043] In another specific embodiment, the primer pair for the lipase gene includes an upstream primer having a sequence as shown in SEQ ID NO.7 and a downstream primer having a sequence as shown in SEQ ID NO.8, wherein:

[0044] SEQ ID NO.7:GACGTGAATGCCAATGTGTT

[0045] SEQ ID NO. 8: CGTTCACAAGGGCAAGGTTA.

[0046] In a preferred embodiment, the primer pair for the gyrA gene includes: an upstream primer for gyrA with a sequence as shown in SEQ ID NO.4 and a downstream primer for gyrA with a sequence as shown in SEQ ID NO.5, an upstream primer for gyrA with a sequence as shown in SEQ ID NO.10 and a downstream primer for gyrA with a sequence as shown in SEQ ID NO.11, an upstream primer for gyrA with a sequence as shown in SEQ ID NO.13 and a downstream primer for gyrA with a sequence as shown in SEQ ID NO.14, or an upstream primer for gyrA with a sequence as shown in SEQ ID NO.16 and a downstream primer for gyrA with a sequence as shown in SEQ ID NO.17.

[0047] In a second aspect, the present invention provides a probe for detecting Bacillus thermoamylovorans nucleic acid, wherein the probe is directed to 16S rDNA, gyrA or lipase gene of Bacillus thermoamylovorans.

[0048] In a specific embodiment, the probe comprises:

[0049] A probe targeting 16S rDNA having a sequence as shown in SEQ ID NO. 3;

[0050] A probe targeting gyrA whose sequence is shown in SEQ ID NO.6, SEQ ID NO.12, SEQ ID NO.15 or SEQ ID NO.18; or

[0051] The sequence of the probe for lipase is shown in SEQ ID NO.9; wherein:

[0052] SEQ ID NO.3: CCCATCTGTAAGTGATGGCAAAAGC

[0053] SEQ ID NO.6: CTCTTATACCAGACAAAGCCCGGCAC

[0054] SEQ ID NO.9: AGCATACAGCCCTGCAAACTACTTTTGG

[0055] SEQ ID NO.12: TAAGCATACAGCCCTGC

[0056] SEQ ID NO.15: CATACAGCCCTGCAAAC

[0057] SEQ ID NO. 18: CAATGTGTTATTAAATAATTTGTA.

[0058] When the primer pair of the first aspect and the probe of the second aspect are used in combination, it can be understood that the primer pair and probe for the same gene are used in combination. For example, the probe for 16SrDNA is used in combination with the primer pair for the 16SrDNA gene, the probe for gyrA is used in combination with the primer pair for the gyrA gene, and the probe for lipase is used in combination with the primer pair for the lipase gene. TaqMan probe method fluorescence quantitative PCR has been widely promoted and applied in medical detection and diagnosis due to its strong specificity, high sensitivity, good repeatability and rapidity.

[0059] In a preferred embodiment, the probe is labeled with a fluorescent reporter group at one end and a fluorescent quencher gene at the other end. In a specific embodiment, the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

[0060] In a preferred embodiment, the fluorescent reporter group can be one selected from FAM, HEX, TET, ROX, TAMRA, JOE, VIC, cy2, cy3, cy5, cy5.5, NED, DY-495, and ATTO 495, but is not limited thereto.

[0061] In a more preferred embodiment, the fluorescent reporter group may be FAM.

[0062] In another preferred embodiment, the quenching group may be one selected from BHQ1, BHQ2, BHQ3, Dabcyl, Eclipse, MGB, BHQ1-dT, BHQ2-dT, but is not limited thereto.

[0063] In a more preferred embodiment, the quencher group may be BHQ1.

[0064] In a third aspect, the present invention provides a primer-probe reaction system for detecting Bacillus thermoamylovorans nucleic acid, wherein the primer-probe reaction system comprises one or more primer pairs of the first aspect.

[0065] In a preferred embodiment, the primer-probe reaction system further comprises one or more probes of the second aspect.

[0066] When the primer pair of the first aspect and the probe of the second aspect are used in combination, it can be understood that the primer pair and the probe for the same gene are used in combination. For example, the probe for 16SrDNA is used in combination with the primer pair for the 16SrDNA gene, the probe for gyrA is used in combination with the primer pair for the gyrA gene, and the probe for lipase is used in combination with the primer pair for the lipase gene.

[0067] In a fourth aspect, the present invention provides a method for detecting Bacillus thermoamylovorans, comprising:

[0068] 1) Providing a nucleic acid sample of Bacillus amylovora;

[0069] 2) using the nucleic acid sample as a template, and using one or more primer pairs of the first aspect to amplify the thermoamylophagous Bacillus nucleic acid;

[0070] 3) Detection using one or more probes of the second aspect.

[0071] In a specific embodiment, the concentration of each primer is 100 nM-1000 nM, for example, it can be 100 nM, 200 nM, 300 nM, 400 nM, 500 nM, 600 nM, 700 nM, 800 nM, 900 nM or 1000 nM or a range consisting of any two values ​​therein.

[0072] In a preferred embodiment, the concentration of each primer is 400 nM.

[0073] In another specific embodiment, the concentration of the probe is 100 nM-1000 nM, for example, it can be 100 nM, 200 nM, 300 nM, 400 nM, 500 nM, 600 nM, 700 nM, 800 nM, 900 nM or 1000 nM or a range consisting of any two of these values.

[0074] In a preferred embodiment, the concentration of each primer is 200 nM.

[0075] In another specific embodiment, the detection is a fluorescent quantitative PCR detection, preferably a fully closed operation fluorescent quantitative PCR detection, that is, after adding the sample to extract the nucleic acid, the tube cover does not need to be opened, thereby reducing the chance of contamination.

[0076] In a fifth aspect, the present invention provides a kit for detecting Bacillus thermoamylovorans, comprising:

[0077] 1) one or more primer pairs of the first aspect;

[0078] 2) one or more probes of the second aspect; and

[0079] 3) Instructions for use for indicating how to use the kit.

[0080] In a specific embodiment, the kit may further include a PCR reaction solution, an enzyme reaction solution, and optional positive controls and negative controls.

[0081] In a further specific embodiment, the PCR reaction solution may include PCR buffer, Mg 2+ Such as MgCl2, dUTP and dNTP.

[0082] In a further specific embodiment, the enzyme reaction solution may include at least one Taq enzyme. Preferably, the Taq enzyme may be a hot-start Taq enzyme to prevent false positives caused by aerosol contamination.

[0083] In a preferred embodiment, the enzyme reaction solution may also include uracil DNA glycosylase (UDG enzyme). Adding UDG enzyme to the reaction solution can prevent contamination of the amplification product.

[0084] In a preferred embodiment, the positive control may be a genome extracted from Bacillus thermomylovora (BNCC336387).

[0085] In a preferred embodiment, the negative control may be RNase-free water.

[0086] Example

[0087] In the following examples, the characterization of primer pairs and probes of the present invention and related properties is shown. Unless otherwise specified, the test methods used are conventional methods, and unless otherwise specified, the test materials used in the following examples are purchased from conventional reagent stores. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of the present invention.

[0088] It should be noted that the terms used in the specification of the present invention are only for the purpose of describing specific embodiments, and are not intended to limit the present invention. The above summary of the invention and the detailed description below are only for the purpose of specifically explaining the present invention, and are not intended to limit the present invention in any way. Without departing from the spirit and purpose of the present invention, the scope of the present invention is determined by the attached claims.

[0089] Example 1: Design and screening of primers and probes

[0090] 1.1 Primer design and synthesis: The present invention selects 16SrDNA, gyrA, and lipase genes of thermomylophagous Bacillus (BNCC336387) as target genes for detection, selects species-specific regions of target genes, and designs primer pairs and probes. The detection primer amplification region is 50-300bp, preferably 80-250bp, and more preferably 75-150bp. The design of primer pairs and probes is designed using PrimerExpress 3.0.1 dedicated software, and the designed primer pairs and probes are compared in NCBI and BLAST specificity analysis is performed. Primer pairs and probes are synthesized in a professional synthesis company.

[0091] 1.2 Genome extraction: Take 200 μL of milk sample containing Bacillus thermomylovora (BNCC336387), and use a fully automatic nucleic acid extractor (Auto-Pure32A nucleic acid extractor, Hangzhou Aosheng Instrument Co., Ltd.) and a homemade magnetic bead nucleic acid extraction reagent to extract nucleic acid from the milk sample of Bacillus thermomylovora (BNCC336387).

[0092] 1.3 Establishment of Q-PCR detection system: In each PCR reaction tube, prepare the amplification reaction system according to the components shown in Table 1 (the final concentration of a single primer in the reaction system is 400nM, and the final concentration of the probe in the reaction system is 200nM). Set the fluorescence PCR instrument to the FAM fluorescence detection channel (the quenching group is None). PCR parameter settings: 37℃, 2min, 95℃, 5min, 1 cycle; 95℃, 15s, 60℃, 40s, 40 cycles. Fluorescence signal collection is performed at 60℃, 40s. After saving the set program, put the reaction tube into the instrument and start running.

[0093] Table 1: Amplification reaction system

[0094]

[0095]

[0096] 1.4 Preliminary screening: Set different primer sets for comparative testing, compare the amplified Ct values ​​and fluorescence values, and observe whether the curve morphology is "S" shaped. From the screening results, select primer pairs and probes with higher Ct values, higher fluorescence values, and "S" shaped curves. The screened primer pairs and probe sequences and Ct value results are as follows: Figure 1 And as shown in Table 2.

[0097] Table 2: Screened primer pairs and probe sequences and obtained Ct values

[0098]

[0099] according to Figure 1 From the test results in Table 2, it can be seen that the combination of primer pairs (gyrA-F and gyrA-R) and probes (gyrA-P) designed according to the gyrA target gene is optimal, because the Ct value and fluorescence value are better than those of the other two sets of primers and probes, the Ct value is closer to the front, and the curve is "S-shaped".

[0100] 1.5 Further screening: Several pairs of primers and probes were designed for different segments of the gyrA conserved gene for a new round of screening tests to screen out primers and probes with higher amplification efficiency (higher Ct value, higher fluorescence value) and "S"-shaped curves. The nucleotide sequences of the final selected primer pairs and probes are shown in Table 3 below. The corresponding amplification results are shown in Figure 2 and as shown in Table 4 below.

[0101] Table 3: Nucleotide sequences of primer pairs and probes designed based on the gyrA target gene

[0102]

[0103]

[0104] Table 4: Ct values ​​of different primer sets

[0105] Primer pairs Ct value gyrA-F / R / P 24.1 gyrA-F1 / R1 / P1 25.0 gyrA-F2 / R2 / P2 23.7 gyrA-F3 / R3 / P3 25.5

[0106] Depend on Figure 2 As shown in the detection results in Table 4, the combination of primer pair (gyrA-F2 and gyrA-R2) and probe (gyrA-P2) has better amplification efficiency (more advanced Ct value, higher fluorescence value), and the curve morphology is also "S-shaped".

[0107] Example 2: Sensitivity test

[0108] The thermoamylophagous Bacillus standard strain was diluted 10 times in series, and the genome was extracted according to step 1.2 of Example 1 to obtain a series of standard templates with concentrations of 1000000 cfu / mL, 100000 cfu / mL, 10000 cfu / mL, 1000 cfu / mL, 100 cfu / mL, 100 cfu / mL, and 10 cfu / mL, respectively. Q-PCR amplification was performed according to step 1.3 of Example 1 using primer pairs and probe combinations gyrA-F2, gyrA-R2, and gyrA-P2.

[0109] The test results are shown in Table 5 and Figure 3(The curves from left to right are shown in order of bacterial concentrations of 1000000 cfu / mL, 100000 cfu / mL, 10000 cfu / mL, 1000 cfu / mL, 100 cfu / mL, 100 cfu / mL, 10 cfu / mL.) The results show that the primer and probe combination according to the present invention has good sensitivity, the CT value changes in a gradient as the concentration decreases, and the minimum detection limit of the DNA nucleic acid amount can reach 100 cfu / mL.

[0110] Table 5: Correspondence between bacterial concentration and Ct value

[0111] Strain concentration Ct (8 replicates) 1000000cfu / mL 21.5 100000 cfu / mL 25.0 10000cfu / mL 28.3 1000cfu / mL 31.5 1000cfu / mL 35.5 10cfu / mL No Ct

[0112] The sensitivity of other primer-probe pairs was tested in the same way, and the results are shown in Table 6. It can be seen that other primer-probe combinations also have relatively good sensitivity.

[0113] Table 6: Sensitivity test results (8 replicates)

[0114]

[0115]

[0116] Example 3: Specificity test

[0117] The primer pair and probe combination gyrA-F2, gyrA-R2, gyrA-P2 were used to detect the DNA of Bacillus thermomylophagous and other 7 non-target bacteria (including Staphylococcus aureus, Escherichia coli, Streptococcus agalactiae, Salmonella, Klebsiella pneumoniae, Staphylococcus epidermidis and Enterococcus faecium) according to steps 1.2 and 1.3 of Example 1. The DNA of the standard strain of Bacillus thermomylophagous was used as a positive control and pure water was used as a negative control for specificity verification.

[0118] Test results such as Figure 4 As shown, the results show that the above primer and probe combination according to the present invention only has an amplification curve when using the genomic DNA of Bacillus thermomylovora as a template, and the reactions when using the genomic DNA of the other six bacteria and pure water as templates are all negative.

[0119] Testing of other primer and probe combinations of the present invention showed the same specificity results, as shown in Table 7 below.

[0120] Table 7: Specificity test results

[0121]

Claims

1. A primer pair for nucleic acid amplification of Bacillus thermoamylovorans, wherein the primer pair is directed to 16SrDNA, gyrA or lipase gene of Bacillus thermoamylovorans.

2. The primer pair according to claim 1, wherein The primer pair for 16SrDNA gene includes an upstream primer with a sequence as shown in SEQ ID NO.1 and a downstream primer with a sequence as shown in SEQ ID NO.2; The primer pair for the gyrA gene includes an upstream primer having a sequence as shown in SEQ ID NO.4, SEQ ID NO.10, SEQ ID NO.13 or SEQ ID NO.16 and a downstream primer having a sequence as shown in SEQ ID NO.5, SEQ ID NO.11, SEQ ID NO.14 or SEQ ID NO.17; or The primer pair for the lipase gene includes an upstream primer with a sequence as shown in SEQ ID NO.7 and a downstream primer with a sequence as shown in SEQ ID NO.

8.

3. The primer pair according to claim 2, wherein: Primer pairs targeting the gyrA gene include: An upstream primer for gyrA having a sequence as shown in SEQ ID NO.4 and a downstream primer for gyrA having a sequence as shown in SEQ ID NO.5, An upstream primer for gyrA having a sequence as shown in SEQ ID NO.10 and a downstream primer for gyrA having a sequence as shown in SEQ ID NO.11, An upstream primer for gyrA having a sequence as shown in SEQ ID NO.13 and a downstream primer for gyrA having a sequence as shown in SEQ ID NO.14, or The upstream primer for gyrA is shown in SEQ ID NO.16 and the downstream primer for gyrA is shown in SEQ ID NO.

17.

4. A probe for detecting Bacillus thermoamylovorans nucleic acid, wherein the probe is directed to 16SrDNA, gyrA or lipase gene of Bacillus thermoamylovorans.

5. The probe according to claim 4, wherein The probe comprises: A probe targeting 16S rDNA having a sequence as shown in SEQ ID NO. 3; A probe targeting gyrA whose sequence is shown in SEQ ID NO.6, SEQ ID NO.12, SEQ ID NO.15 or SEQ ID NO.18; or A probe targeting lipase whose sequence is shown in SEQ ID NO.9; Preferably, the probe is labeled with a fluorescent reporter group at one end and a fluorescent quencher gene at the other end.

6. A primer-probe reaction system for detecting Bacillus thermoamylovorans, the primer-probe reaction system comprising one or more primer pairs according to any one of claims 1-3; preferably, the reaction system also comprises one or more probes according to claim 4 or 5.

7. A method for detecting Bacillus thermoamylovorans, comprising: 1) Providing a nucleic acid sample of Bacillus amylovora; 2) using the nucleic acid sample as a template, and using one or more primer pairs described in any one of claims 1 to 3 to amplify Bacillus thermomylophagous nucleic acid; and 3) Detection using one or more probes according to claim 4 or 5.

8. The method according to claim 6, wherein: The concentration of each primer is 100-1000 nM, preferably 400 nM, and the concentration of the probe is 100-1000 nM, preferably 200 nM.

9. A kit for detecting Bacillus thermoamylovorans, comprising: 1) one or more primer pairs according to any one of claims 1 to 3; 2) one or more probes according to claim 4 or 5; as well as 3) Instructions for use for indicating how to use the kit.

10. The kit according to claim 9, wherein The kit also includes a PCR reaction solution, an enzyme reaction solution, and optional positive controls and negative controls; Preferably, the PCR reaction solution includes PCR buffer, Mg 2+ Such as MgCl2, dUTP and dNTP; Preferably, the enzyme reaction solution includes at least one Taq enzyme; preferably, it is a hot-start Taq enzyme; more preferably, the enzyme reaction solution also includes uracil DNA glycosylase.

Images