Rice bacterial streak resistance detection primer group, application and method for improving rice resistance

Abstract

The invention discloses a rice bacterial streak resistance detection primer group, application and a method for improving rice resistance, and relates to the field of rice breeding. According to the application, a bacterial streak resistance site qBls8.1 is positioned in the 3, 503, 873-3, 525 and 334 bp intervals of the No.8 chromosome of rice for the first time, the genotype in a resistant variety is G, the genotype in a susceptible variety is T, and the sequence of a KASP molecular marker primer group is developed as shown in SEQ IN NO.1-SEQ IN NO.3, so that the KASP molecular marker primer group is used for resistance detection and assistant breeding of the rice bacterial streak; a new gene resource is provided for cultivating bacterial leaf streak resistant varieties, and the breeding period is shortened.

Description

Technical Field

[0001] The invention belongs to the field of rice breeding and relates to a method for improving resistance to bacterial leaf streak disease of rice. Background Art

[0002] As one of the three major food crops in the world, rice has made a huge contribution to global food security. Rice bacterial leaf streak disease (referred to as rice leaf streak disease) is caused by Xanthomonas oryzae pv. oryzae and is the fourth largest rice disease after rice blast, sheath blight, and bacterial leaf blight. Rice can be infected from the seedling stage to the heading stage, and is most sensitive to rice leaf streak disease from the end of tillering to the early heading stage. After the disease occurs, rice generally loses 15-25% of its yield, and in severe cases it can reach 40-60%, posing a serious threat to the high and stable yield of rice.

[0003] Rice resistance to rice streak disease is controlled by multiple genes. However, the discovery of rice streak disease resistance genes and their breeding applications are relatively slow, mainly due to the lack of highly resistant varieties. Currently, 10 resistant germplasms have been reported, including Acc8558, DP3, CarolinaCold Select, etc., all of which are foreign wild rice germplasms. Researchers have used the above germplasms to study rice streak disease resistance loci. Currently, more than 40 resistance QTLs have been reported, and the explained phenotypic contribution rate is between 6.82-39.01%. The ones with larger effects include qBLS-5-1 (39.01%) and qBLSR-11-1 (36.3%). Most of them are minor QTLs, and only 6 resistance genes have been cloned. Among them, the recessive disease resistance gene qBlsr5a has been located in the 30kb interval of chromosome 5. Some researchers have confirmed that xa5 is a candidate gene for qBlsr5a, which encodes a small γ subunit of a conserved transcription factor TF11A. The RNAi strain of this gene upregulates the expression of disease-related genes, thereby regulating resistance to streak disease. However, some studies have shown that after the OsPGIP4 gene in the interval where qBlsr5a is located is overexpressed, the polygalacturonase inhibitory protein it encodes is upregulated, which can enhance the streak disease resistance of the susceptible variety Zhonghua 11. This gene may also be a candidate gene for qBlsr5a. Recessive disease resistance QTL bls1 was located, and OsMAPK6 was determined to be the candidate gene of bls1. Low expression of this gene increased the content of jasmonic acid and abscisic acid in rice, thereby increasing resistance to rice streak disease. In addition, dominant disease resistance genes Xo1, Xo2 and the major recessive disease resistance gene bls2 were also cloned, but their molecular mechanisms have not yet been elucidated. Studies have shown that there is a non-host resistance gene Rxo1 in corn, which can recognize the conserved rice streak disease gene avrRxo1 and stimulate a resistance response. Although six genes have been cloned so far, bls1, bls2, and qBlsr5a are recessive genes and are restricted in hybrid rice breeding; Rxol is a non-host resistance gene, and its use in disease-resistant breeding requires genetic modification, and its current promotion is limited; and although Xo1 is a dominant disease-resistance gene, its resistance spectrum is relatively narrow, and it is only resistant to African strains but not to Asian strains; Xo2 is a newly discovered dominant resistance gene in 2022. Current research has shown that it can make up for the limitations of the above-mentioned resistance genes and is resistant to most of the stripe pathogens in my country. However, it is difficult to overcome the broad-spectrum resistance to stripe pathogens with only one gene, and other dominant resistance genes need to be urgently discovered.

[0004] Most of the QTLs for resistance to rice streak have been located in wild rice germplasm, while there are few studies using natural populations. Currently, a total of 94 related resistance loci have been detected using GWAS. However, the fine positioning of related loci has not yet been carried out, the exploration of resistance loci in natural populations is still insufficient, and there are no reports on the application of rice streak resistance loci obtained by GWAS to breeding practice. Summary of the invention

[0005] In response to the above problems, this application discovered a new rice leaf streak resistance locus qBls8.1 for the first time, obtained the excellent haplotype of this locus, and developed KASP molecular markers based on this locus, and applied and methods for improving rice bacterial leaf streak resistance.

[0006] Specifically, the present application is implemented through the following technical solutions:

[0007] First, the present application provides a set of KASP primers for detecting resistance to rice bacterial leaf streak disease, which primers are composed of primers whose nucleotide sequences are shown in SEQ IN NO.1 to SEQ IN NO.3.

[0008] Secondly, the present application provides the use of the primer set whose nucleotide sequences are shown in sequence as SEQ IN NO.1 to SEQ IN NO.3 in rice bacterial leaf streak disease resistance detection or assisted breeding;

[0009] That is, using the leaf DNA of the target rice plant as the template DNA, using SEQ ID NO.1 and SEQ ID NO.2 as the upstream primers, and using SEQ ID NO.3 as the downstream primer to perform PCR amplification, and then reading the fluorescence signal of the amplified product (such as using a TECAN infinite M1000 microplate reader); then using the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) to analyze and convert the fluorescence signal, if the amplified product emits green fluorescence (FAM), it carries the "G" allele, if the amplified product emits blue fluorescence (HEX), it carries the "T" allele, and it is judged that the rice carrying the "G" allele has higher resistance to bacterial leaf streak disease than the rice carrying the "T" allele.

[0010] Further, the PCR amplification system is as follows: 5 μl of 2×PARMS master mix, 0.15 μl of primer SEQ ID NO.1 at a concentration of 0.1 μM / ml, 0.15 μl of primer SEQ ID NO.2 at a concentration of 0.1 μM / ml, 0.4 μl of primer SEQ ID NO.3 at a concentration of 0.1 μM / ml, 10-100 ng of DNA template, and ddH2O to make up to 10 μl;

[0011] PCR reaction program: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 65-57°C (-0.8°C / Cycle) for 1 min, 10 cycles; annealing at 94°C for 20 s, extension at 57°C for 1 min, 32 cycles; PCR amplification products were stored at 4°C.

[0012] Third, the present application provides a method for improving resistance to bacterial leaf streak disease in rice, the specific steps of which are as follows:

[0013] 1) To carry qBls8.1 T Rice with qBls8.1 as the recipient G Rice with the same locus (such as Yangxiang 1B) was used as a donor for hybridization to obtain the F1 generation;

[0014] 2) Backcrossing the F1 generation with the recipient rice to obtain the BC1F1 generation; selecting the BC1F1 generation to carry qBls8.1 G The varieties of the locus are used as BC2F1 generation;

[0015] 3) Self-pollinate the BC2F1 generation and select the progeny carrying qBls8.1 G The single strain of the locus (i.e., qBls8.1 G Homozygous genotype) as BC2F2 generation;

[0016] 4) Self-pollinate the BC2F2 generation and select the progeny carrying qBls8.1 G The single strain of the locus (i.e., qBls8.1 G The homozygous genotype) was used as the BC2F3 generation, that is, a rice variety with improved resistance to fine stripe disease was obtained. The obtained BC2F3 generation significantly improved the resistance to fine stripe disease compared with the recipient. This method used the molecular marker-assisted selection method to select qBls8.1 G Introduced into the backbone parent to improve the resistance of the recipient parent's derivative lines to bar disease.

[0017] In the above step 1), "carry qBls8.1 T Rice carrying qBls8.1 GThe "rice with the "G" allele" refers to: using the leaf DNA of the target rice plant as the template DNA, using SEQ ID NO.1 and SEQ ID NO.2 as the upstream primers, and using SEQ ID NO.3 as the downstream primer to perform PCR amplification, and then reading the fluorescence signal of the amplified product; if the amplified product emits green fluorescence (FAM), it carries the "G" allele, and the corresponding rice variety is the one carrying qBls8.1 G If the amplified product emits blue fluorescence (HEX), it carries the "T" allele, and the corresponding rice variety is the rice variety carrying qBls8.1 T site of rice.

[0018] In the above steps -2)-4), "select to carry qBls8.1 G The "site" means: using the leaf DNA of the target rice plant as the template DNA, using SEQ ID NO.1 and SEQ ID NO.2 as the upstream primers of the target rice material, and using SEQ ID NO.3 as the common downstream primer for PCR amplification, and then reading the fluorescence signal of the amplified product, and then using the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) to parse and convert the fluorescence signal to obtain a clear and intuitive typing diagram, and output the genotype results according to different colors. The value of carrying the disease-resistant SNP - "G" is assigned to FAM (green fluorescence), and the value of carrying the disease-susceptible SNP - "T" is assigned to HEX (blue fluorescence); the variety carrying the "G" base is "carrying qBls8.1 G Varieties of sites".

[0019] This application first linked a rice streak resistance locus through GWAS. The resistance locus qBls8.1 is located in the 3,503,873-3,525,334bp interval of rice chromosome 8 (R498 is used as the reference genome); the physical position of the marker with the highest -log(P) value is at 3,509,515bp, and the -log(P) value is 7.72, which belongs to the SNP type of variation. The genotype is "G" in the resistant variety, and the genotype is "T" in the susceptible variety. Based on this, this application further developed a KASP molecular marker primer set and provided its application in detecting rice streak resistance and assisting breeding. Compared with the existing detection methods, the beneficial effects of the present invention are:

[0020] 1. Provides a new resistance locus for fine streak disease, qBls8.1

[0021] In this application, R498 is used as the reference genome, 246 selected indica rice backbone parents are resequenced, and the stripe disease resistance loci are quickly located through whole-genome association analysis, thereby shortening the positioning cycle and ensuring the reliability of the positioning results.

[0022] 2. Provides molecular markers that can be used to improve the resistance of varieties to streak disease

[0023] This application located a new bar streak resistance locus qBls8.1 for the first time, which has not been reported in other studies. The KASP molecular marker developed from the genomic sequence near the qBls8.1 locus was used to identify qBls8.1 through molecular marker-assisted selection. G After being introduced into varieties susceptible to fine streak disease, the resistance of the introduced line to fine streak disease can be significantly improved. The discovery of this site provides new genetic resources for breeding fine streak disease-resistant varieties and shortens the breeding cycle. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Phenotypic distribution of natural populations

[0025] A: Resistance level corresponding to phenotype; B: Distribution of resistance level in natural population; C: Population structure K=8, each material is represented by a vertical line and is divided into colored segments. The length of each segment represents the proportion of the genome occupied by the material when K=8. The green bar graph on the upper side of the population structure corresponds to the material resistance level, and the red arrow is the location of the material with a phenotype of level 3 (medium resistance).

[0026] Figure 2 Results of GWAS mapping and identification of rice streak resistance loci in the backbone parent of indica rice;

[0027] A: Manhattan plot of the seedling spray method; B: GWAS QQ plot of the seedling spray method; It can be seen that the GWAS method detected multiple streak resistance loci, among which qBls8.1 located in the 3,503,873-3,525,334bp interval on chromosome 8 had the highest -log(P).

[0028] Figure 3 The schematic diagram of the phenotypic difference of the streak disease resistance locus qBls8.1 and the KASP molecular marker typing;

[0029] A: Carry qBls8.1 T and qBls8.1 G Box plot of the resistance phenotype of the material to streak disease, ***: P < 0.0001; B: carrying qBls8.1 T and qBls8.1 GPicture of the material's resistance to stripe disease; C: Gene typing diagram of KASP marker at the qBls8.1 polymorphic site, green dots represent materials carrying "G", blue dots represent materials carrying "T", and red dots represent materials carrying heterozygous types; it can be seen that qBls8.1 typing has a good correlation with the stripe disease resistance phenotype, and the developed molecular markers are used to improve varieties, and the stripe disease resistance of the improved lines is significantly improved. Figure 4 Schematic diagram of KASP marker sequence;

[0030] This is a schematic diagram of the genomic reverse complementary sequence of chromosome 8 3,509,282-3,509,695bp of the sequence-susceptible silk stripe disease material and the KASP molecular marker sequence information. DETAILED DESCRIPTION

[0031] The rice varieties involved in the following examples are all preserved by the Jiangsu Lixiahe Regional Agricultural Science Research Institute and are all conventional rice varieties. Zhongjiang 6280 was purchased from Zhongjiang Seeds; Yangxiang 1B was obtained by hybridizing "Yangxian 9B" (CNA20180807.1) as the female parent and Yangxian 7B as the male parent to obtain the F1 generation. The F1 was tested by molecular testing to contain the rice blast resistance gene Pigm and the fragrance gene as the male parent and backcrossed with Yangxian 9B. The backcross BC1F1 was further backcrossed with Yangxian 9B by molecular testing. BC2F1-BC2F3 were continuously tested by molecular testing to select the three-line maintenance line of blast resistance and fragrance. The applicant named it "Yangxiang 1B".

[0032] The culture medium involved in the embodiment:

[0033] NA slant medium: sucrose 10g, peptone 5g, yeast powder 1g, beef extract 3g, agar 15g, add water to 1L, pH 7.0-7.2, sterilize at 121℃ for 20min before use.

[0034] NB culture medium: sucrose 10g, peptone 5g, yeast powder 1g, beef extract 3g, add water to 1L, pH 7.0-7.2, sterilize at 121℃ for 20min before use.

[0035] The highly pathogenic strain of rice leaf streak disease (GDXc1608) was donated by the Plant Protection Institute of Guangdong Academy of Agricultural Sciences. This strain is a conventional pathogenic bacterium, as disclosed in the document "Evaluation of resistance of rice variety resources to bacterial leaf streak pathogen".

[0036] The nucleotide sequences involved in the embodiments are:

[0037] SEQ IN NO.1:

[0038] GAAGGTGACCAAGTTCATGCTATCACCGGAATCAGATTTCTAGC;

[0039] SEQ IN NO.2:

[0040] GAAGGTCGGAGTCAACGGATTGATCACCGGAATCAGATTTCTAGA; SEQ IN NO.3: GGAAAATCTATACGACCATATCATCA.

[0041] Example 1 GWAS positioning of rice streak disease resistance loci

[0042] 1. Prepare 246 core indica rice parent seeds collected worldwide (as shown in Table 1), 100 seeds of each variety, place them in a constant temperature oven at 45°C for 5 days to break dormancy, and then place them in an incubator for germination (germination conditions are 45°C / 12 hours day and night alternation, light intensity: 25,000Lx). When the seedlings grow to the 4-leaf stage, remove the fresh leaves for the next step of genomic DNA extraction.

[0043] 2. Genomic DNA extraction (CTAB method)

[0044] 200 mg of young leaves of rice seedlings were taken, cut into pieces and put into a 2 ml centrifuge tube, the leaves in the centrifuge tube were quickly frozen with liquid nitrogen, and ground into powder.

[0045] In this example, DNA was extracted according to the DNASoltis Lab CTAB DNA Extraction Protocol (Reference: Doyle & Doyle, 1987; and Cullings 1992) Revised November 14, 2002), 500 mg of the obtained DNA was used for genome sequencing library construction, and the rest was stored at -80°C for future use.

[0046] 3. The list of 246 indica rice varieties used for next-generation resequencing is as follows (Table 1). The genomic DNA extraction of each variety refers to steps 1 and 2 above.

[0047] Table 1 Varieties used for GWAS mapping of streak disease resistance genes

[0048]

[0049]

[0050] 4. Genotype analysis of sequenced varieties

[0051] The genomic library was constructed using the Genotyping-By-Sequencing method (a conventional method in the art, the method disclosed in the reference "Genotyping-by-Sequencing in Plants doi:10.3390 / biology1030460" in this example), and the library of each variety was sequenced using an Illumina MiSeq & HiSeq1000 sequencer to ensure that 4GB of sequencing data was obtained. AdapterRemove2 and FastqMcf software were used to remove mismatched bases, low-quality bases, and adapter contamination in the above raw data.

[0052] After data filtering, R498 was used as the reference genome (a recognized reference gene in this field, as disclosed in the document “Sequencing and de novo assembly of a near complete indica rice genome, DOI: 10.1038 / ncomms15324”), and the sequencing data were aligned to the Nipponbare reference genome using SOAP2 and Bowtie2, and a BAM format file was generated. Samtools and GATK software were then used to detect SNPs variations among the sequenced varieties and obtain the genotypes of the sequenced varieties.

[0053] 5. Phenotypic identification of fine streak disease at the seedling stage

[0054] The sequencing varieties selected in step 1 were sown in Yangzhou, about 40 plants, and soaked and germinated before sowing. After the rice buds were white, they were planted on the field seedling board. Transplanting began when the field seedlings were about 25 days old, with single plants, 10 cm spacing between plants and 20 cm spacing between rows. After transplanting, field management referred to normal indica rice management methods.

[0055] The highly pathogenic strain (GDXc1608) was cultured on NA slant medium in a 28°C incubator for 48 h, and then a single colony with normal morphology was picked and transferred to NB liquid culture medium and cultured at 28°C and 200 rpm for 16-18 h (until the logarithmic growth phase);

[0056] The cultured seed liquid was transferred into sterilized NB culture medium at a 1% inoculum volume for expansion culture, cultured at 28°C 200 rpm for 48 h, and finally centrifuged in a centrifuge at 6000 rpm for 10 min. The supernatant was removed and the bacterial cells were prepared into a suspension with sterile water and diluted to 3×10 8 CFU / mL was used for inoculation.

[0057] To simulate the natural disease of rice field, spray inoculation was adopted. 0.01% Tween-20 was added to the bacterial solution by volume, and after mixing evenly, the bacterial solution was loaded into the MSB151 sprayer with good atomization degree, and spray inoculation was performed at the rice seedling stage to ensure that the bacterial solution was evenly sprayed on the rice leaves (inoculation amount 1.5×10 13 CFU / mu), within 24 hours after inoculation, spray water every 2 hours to keep moisture, to ensure that the streak bacteria have suitable conditions to infect rice, and carry out rice resistance phenotype identification 20 days after inoculation.

[0058] For each material, 10 plants were selected, the main stem was found, and the area of ​​lesions on each leaf was recorded starting from the lowest leaf. The area of ​​lesions was converted into disease resistance grade according to the following standards in Table 2:

[0059] Table 2

[0060]

[0061] The disease index was then calculated according to the following formula:

[0062] Disease index = 100 × ∑ (number of diseased leaves at each level × representative value of each level) / (total number of leaves surveyed × highest representative value)

[0063] The statistical results are as follows Figure 1 As shown in A, levels 0-9 range from high resistance to high sensitivity. Figure 1 B and C are the frequency distribution histogram of resistance classification of silk streak disease and the population structure analysis of 246 materials (K=8), respectively. Figure 1 The phenotype and test results show that the phenotypic variation of fine streak disease in the mapping population is rich, which is a typical quantitative trait, and GWAS can be used to explore fine streak disease resistance loci.

[0064] 6. GWAS analysis of resistance loci to schizontosis

[0065] The variety genotypes and rice streak phenotypes obtained in the above steps were imported into Tassel (V5.2.7.9) software. The genotype filtering conditions were: gene frequency greater than 5%, missing rate less than 20%, and varieties with genotype missing more than 40% were eliminated. The filtered genotypes were used for principal component analysis, and the number of components was set to '2'; the results of GWAS positioning and identification of rice streak resistance loci in indica rice varieties are shown in Figure 2. Figure 2As shown, a total of 17 resistance sites were scanned, among which the significant site located on chromosome 8 had the highest -log(P), which the applicant named qBls8.1. The confidence interval of this site was 3,503,873-3,525,334bp, and the physical position with the highest -log(P) was 3,509,515bp, which was the SNP variation "G / T", which was "G" in the disease-resistant parent (disease resistance grade MR) and "T" in the susceptible parent (disease resistance grade S and below).

[0066] Example 2: qBls8.1 KASP marker development

[0067] According to the SNP variation at 3,509,515bp on chromosome 8 in the resistant and susceptible silk streak disease materials ( Figure 3 A), the KASP marker was designed by Primerprimer 5.0 software, the upstream primer qBls8.1-P1-F of the disease-resistant material, the upstream primer qBls8.1-P2-F of the disease-susceptible material, and the common downstream primer qBls8.1-R are shown in SEQ IN NO.1-SEQ IN NO.3. The schematic diagram of the KASP sequence marker is shown in Figure 4 As shown, Figure 4 The displayed sequence is the reverse complementary sequence of the physical location of chr8:3509282-3509695. The bases in red background and blue font are the SNP differences of the resistant and susceptible materials at the chr8:3,509,515bp site. The red background sequence of the resistant parent is the sequence information of SEQ ID NO.1, the red background sequence of the susceptible parent is the sequence information of SEQ ID NO.2, and the yellow background sequence in the resistant and susceptible parents is the reverse complementary sequence information of SEQ ID NO.3.

[0068] Using rice plant leaf DNA as target DNA, SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 as primers, PCR amplification was performed. The amplified product was used to read the fluorescence signal using a TECAN infinite M1000 microplate reader, and then the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) was used to analyze and convert the fluorescence signal to obtain a clear and intuitive genotype diagram, and the genotype results were output according to different colors. The value of carrying the disease-resistant SNP "G" was assigned to FAM (green fluorescence), and the value of carrying the disease-susceptible SNP "T" was assigned to HEX (blue fluorescence); the resistance of rice carrying the "G" base to fine streak disease was stronger than that of rice carrying the "T" base.

[0069] PCR reaction system: 5 μl of 2×PARMS master mix, 0.15 μl of primer SEQ ID NO.1, 0.15 μl of primer SEQ ID NO.2, 0.4 μl of primer SEQ ID NO.3, 10 ng of DNA template (in the specific implementation, 10-100 ng of DNA template can be used for good amplification), and ddH2O is added to 10 μl.

[0070] PCR reaction program: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 65-57°C (-0.8°C / Cycle) for 1 min, 10 cycles; annealing at 94°C for 20 s, extension at 57°C for 1 min, 32 cycles, and the PCR product was stored at 4°C.

[0071] This example further tests rice varieties Yangxiang 1B and Zhongjiang 6280, and finds that Yangxiang 1B carries the "G" base, which is a disease-resistant variety; Zhongjiang 6280 carries the "T" base, which is a disease-susceptible variety.

[0072] Example 3 Marker-assisted selection to improve resistance to fine streak disease in susceptible varieties

[0073] 1) August 2021, using qBls8.1 G The fine streak disease-resistant material Yangxiang 1B was used as a donor to carry qBls8.1 T The susceptible material Zhongjiang 6280 was used as the receptor, and F1 was obtained by hybridization;

[0074] 2) In December of the same year, F1 was planted in Sanya, and in March 2021, F1 was backcrossed with the recipient to obtain 50 BC1F1 seeds. In May of the same year, BC1F1 was planted in Yangzhou to obtain 20 BC1F1 plants. 0.2 g of fresh leaves were taken from each plant for DNA extraction. The DNA extraction method was referred to step 2 of Example 1. The extracted DNA was used to perform molecular marker detection on 20 plants using the KASP marker developed in Example 2. At the same time, combined with agronomic traits (phenotype was medium resistance to MR), a strain carrying qBls8.1 was obtained. G Six of the individual plants were backcrossed with the recipients to obtain 10 BC2F1 lines, 20 plants of each line were planted in Sanya in December;

[0075] 3) In January 2022, DNA was extracted from leaves of the above BC2F1 lines, and KASP molecular marker detection was performed again (same as in Example 2). One plant with excellent agronomic traits (moderate plant type, sturdy stems, moderate growth period, good rice quality, etc.) carrying homozygous qBls8.1 was selected from each line. GBC2F2 seeds were harvested from individual plants. In June of the same year, 10 BC2F2 lines were planted, with 20 plants in each line, and self-pollinated. In October 2022, the excellent and superior traits and homozygous qBls8.1 were harvested. G BC2F3 seeds of 10 lines were used for identification of resistance to streak disease.

[0076] Phenotypic identification of resistance to streak disease was performed by referring to step 5 of Example 1. According to the actual identification results, the strain carrying qBls8.1 G Backcross recombinant inbred line (introduced resistance locus qBls8.1 G ) was more resistant than the control qBls8.1 T Resistance is significantly improved (such as Figure 3 The results are shown in A and B in Figure 1, which have reached statistical significance, p<0.0001, and molecular marker-assisted selection has been achieved to improve the resistance of varieties susceptible to fine streak disease. The KASP molecular marker typing designed at this SNP site is shown in Figure 1. Figure 3 Shown in C (progeny of the segregating population mated with the resistant and susceptible material).

[0077] In this example, the resistance phenotype of the stripe disease of the resistant and susceptible materials was significantly different. After the resistant material Yangxiang 1B carrying "G" was used to improve the susceptible material Zhongjiang 6280 carrying "T", the qBls8.1 G Near isogenic lines compared to qBls8.1 T The resistance to fine streak disease has been significantly improved, and the typing results of the KASP molecular marker developed using this site are also ideal, providing a good molecular marker for subsequent fine streak disease resistance breeding.

Claims

1. A primer set for detecting resistance to rice bacterial leaf streak disease, characterized in that: The primer set consists of primers whose nucleotide sequences are shown in sequence as SEQ IN NO.1 to SEQ IN NO.

3.

2. Use of the primer set as claimed in claim 1 in detecting resistance to rice bacterial leaf streak disease or assisting breeding.

3. The use according to claim 2, characterized in that The application refers to using the leaf DNA of the target rice plant as the template DNA, using the primer set as the primer for PCR amplification, reading the fluorescent signal of the amplified product, if the amplified product emits green fluorescence, it carries the G allele; if the amplified product emits blue fluorescence, it carries the T allele, and it is judged that the resistance of rice carrying the G allele to bacterial leaf streak disease is higher than that of rice carrying the T allele.

4. The use according to claim 3, characterized in that: The PCR amplification refers to: PCR amplification system: 5 µl 2×PARMS master mix, 0.15 µl 0.1 μM / ml primer SEQ ID NO.1, 0.15 µl 0.1 μM / ml primer SEQ ID NO.2, 0.4 µl 0.1 μM / ml primer SEQ ID NO.3, 10-100 ng DNA template, ddH2O to 10 µl; PCR amplification program: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 65-57°C (-0.8°C / Cycle) for 1 min, 10 cycles; annealing at 94°C for 20 s, extension at 57°C for 1 min, 32 cycles.

5. A method for improving resistance to bacterial leaf streak disease in rice, characterized in that: The specific steps are as follows: 1) To carry qBls8.1 T Rice with the locus as the receptor carries qBls8.1 G The rice at the locus is used as the donor and hybridized to obtain the F1 generation; The carrying qBls8.1 T Rice with the locus qBls8.1 G The rice of the locus refers to: using the leaf DNA of the target rice plant as a template, using the primer set of nucleotide sequences as shown in SEQ IN NO.1-SEQ IN NO.3 as primers for PCR amplification, and reading the fluorescence signal of the amplified product; if the amplified product emits green fluorescence, it carries the G allele, and the corresponding rice variety is the one carrying the G allele. qBls8.1 G If the amplified product emits blue fluorescence, it carries the T allele, and the corresponding rice variety is the one carrying the T allele. qBls8.1 T Rice in the site; 2) Backcross the F1 generation with the recipient rice to obtain the BC1F1 generation; select the BC1F1 generation that carries qBls8.1 G The varieties of the locus are used as BC2F1 generation; 3) Self-pollinate the BC2F1 generation and select the progeny that carry qBls8.1 G The individual plants of the site were used as the BC2F2 generation; 4) Self-pollinate the BC2F2 generation and select the progeny that carry qBls8.1 G The individual plants at the locus are the BC2F3 generation, and the BC2F3 generation has improved resistance to rice bacterial leaf streak disease compared with the recipient; The selection carries qBls8.1 G The locus refers to: using the target rice plant leaf DNA as a template, using the primer set shown in SEQ IN NO.1-SEQ IN NO.3 as primers to perform PCR amplification, and reading the fluorescence signal of the amplified product; if the amplified product emits green fluorescence, it carries the G allele, and the corresponding rice variety is the one carrying the G allele. qBls8.1 G site of rice.

Images