Nucleic acid probe for detecting VEGFA-VEGFR interaction on single living cell as well as preparation method and use method of nucleic acid probe

Abstract

The invention discloses a nucleic acid probe for VEGFA-VEGFR (vascular endothelial growth factor receptor-vascular endothelial growth factor receptor) interaction detection on a single living cell as well as a preparation method and a use method of the nucleic acid probe. The preparation method comprises a step of preparing a VEGFA binding probe, a step of preparing a VEGFA binding probe and a step of preparing a locking type DNA (deoxyribonucleic acid) probe, and the steps are combined into a kit. When in use, the VEGFR probe is firstly added into a sample, then the VEGFA probe is added, finally the locked DNA probe is added, and then the super-resolution imaging technology is used for imaging. According to the invention, high-sensitivity and specific visual detection of the interaction of the VEGFA-VEGFR on the living cell membrane can be realized.

Description

Technical Field

[0001] The present invention belongs to the technical field of biochemical detection, and in particular relates to a nucleic acid probe for detecting VEGFA-VEGFR interaction on a single living cell, and a preparation method and a use method thereof. Background Art

[0002] Cytotoxic T lymphocytes (CTLs) are the main effector cells of anti-tumor immune response, which are activated by tumor antigens and specifically kill tumor cells through cytotoxicity. Studies have found that the interaction between vascular endothelial growth factor A (VEGFA) and vascular endothelial growth factor receptor (VEGFR) is one of the key factors affecting the cytotoxic activity of CTLs. VEGFA produced in the tumor microenvironment can directly or indirectly act on CTLs, causing them to lose their cytotoxic activity. When antibodies or kinase inhibitors are used to block the VEGFA-VEGFR interaction, the activity of intratumoral CTLs can be significantly increased, thereby enhancing the CTL-mediated anti-tumor immune response. Therefore, monitoring the binding events of VEGFR and VEGFA on the surface of CTLs at the molecular level will help to understand the molecular mechanism of VEGFA-VEGFR interaction regulating the cytotoxic activity of CTLs, and can provide a new paradigm for the formulation of tumor immunotherapy.

[0003] The existing methods for detecting VEGFA-VEGFR interaction mainly include surface plasmon resonance, immunoprecipitation, fluorescence co-localization and bimolecular fluorescence complementation technology, which are introduced one by one below.

[0004] Surface plasmon resonance technology: By measuring the change in optical signal caused by VEGFA binding to VEGFR fixed on the sensor surface, its binding rate and affinity are determined. However, the detection equipment of surface plasmon resonance technology is expensive, complicated to operate, and usually requires high-purity protein samples, which is only applicable to in vitro experiments.

[0005] Co-immunoprecipitation technique: Use specific antibodies to recognize and bind to VEGFA and VEGFR. Once the antibody binds to the target protein, the entire protein complex can be separated from the cell extract by immunoprecipitation. Subsequently, the partners that interact with the target protein can be identified by protein electrophoresis (such as SDS-PAGE), mass spectrometry, or other detection methods. The results of this method depend largely on the quality of the antibody. If the antibody is not specific or sensitive enough, false positive or false negative results may result. In addition, proteins that interact weakly or transiently are often removed during the washing process and are difficult to detect by this method.

[0006] Fluorescence co-localization technology: Based on the analysis of the overlap of different fluorescently labeled proteins in space, it is determined whether these proteins are in the same area. Different fluorescent protein tags (such as GFP, RFP, YFP, etc.) are fused to the target protein VEGFR and its ligand VEGFA respectively through genetic engineering. Or different fluorescently labeled biorecognition probes such as antibodies and nucleic acid aptamers are used to specifically bind to the target protein VEGFR and its ligand VEGFA. In this way, each protein will emit fluorescence of a specific color. Use a fluorescence microscope to observe the distribution of the two fluorescent signals in the cell. When VEGFA-VEGFR interacts, the fluorescent labels will bind to each other or approach each other in the cell, resulting in the co-localization of the two fluorescence in the nucleus. However, the resolution of traditional fluorescence microscopes is limited to about 200-300 nanometers, making this method unable to distinguish proteins that are very close but not interacting. In addition, the steric hindrance of fluorescent proteins is large, which will interfere with the contact between VEGFA and VEGFR to a certain extent, thereby limiting the precise monitoring of VEGF-VEGFR binding events.

[0007] Bimolecular fluorescence complementation technology: By dividing the fluorescent protein into two complementary fragments and fusing them with VEGFR and VEGFA respectively, when VEGFA-VEGFR interacts, the two fluorescent protein fragments will be spatially close and reassembled into a complete fluorescent protein, thereby restoring the fluorescence activity. This recovery of the fluorescent signal can be used to indicate the interaction between proteins. However, the fusion of fluorescent protein fragments may affect the natural function of the protein, not only producing false negative or false positive results, but also interfering with other biological processes. Summary of the invention

[0008] The object of the present invention is to solve the above-mentioned defects of the prior art and to provide a nucleic acid probe for detecting VEGFA-VEGFR interaction on a single living cell and a preparation method and a use method thereof.

[0009] The present invention adopts such a technical solution: a method for preparing a nucleic acid probe for detecting VEGFA-VEGFR interaction on a single living cell, comprising the following steps: 1) VEGFR aptamer and extended sequence are hybridized with complementary strands to prepare VEGFR binding probes: The sequence of the VEGFR aptamer and extension (VEGFR-apt) starting from the 5' end is AATGGGCTAGTTCTAGCTCATCTTTTTTTAGGTGGGTTCGGGGGTGCTGGTCGGGGGGTG; the sequence of the complementary chain starting from the 5' end is GAGCTAGAACTAGCCCATTGCTC, and the 5' and 3' ends are modified with the quencher group BHQ1 and the fluorescent group FAM, respectively, called Competitor, and the two are hybridized to obtain the VEGFR binding probe; the VEGFR-apt chain and the Competitor chain are heated at 95°C for 5 minutes, and then quickly cooled to room temperature; the two are mixed in PBS to a final concentration of 100 nM, and incubated at room temperature in the dark for 1 hour to form a hybrid double chain; 2) Preparation of VEGFA binding probe: The VEGFA binding probe consists of five nucleic acid chains: Chain 1 is TGTGGGGGTGGACGGGCCGGGTAGAAAAAAAGATGAGCTAGGCTCGACCAGGATGGACATCATAGT from the 5' end; Chain 2 is CTGCGAATATACTATGATGT from the 5' end; Chain 3 is ATATTCGCAGTGCATTACTGGTAGTGGTAGGTAGACATTCATAGTACAGATGCATTACTGGTAGTGGTAGGTAGACATTCCTGAGTGTTG from the 5' end, with a phosphate group (Phos) modified at the 5' end; Chain 4 is AAGTGACTGTTTACGTCGCCGTCCACTAGCCCATT, with a phosphate group (Phos) modified at the 5' end; Chain 5 is ACAGTCACTTCAACACTCAG from the 5' end; the above chains were resuspended in enzyme-free water at 200 μM, 1.5 uL of chains 1, 2, 4, 5 and 1.0 uL of chain 3 were taken and mixed evenly, and then heated at 70 Heat at ℃ for 3 minutes and leave at room temperature for 5 minutes; then add 1 μL of T7 DNA ligase diluted 10 times with ultrapure water to the reaction system and react at room temperature in the dark for 1 hour or overnight; 3) Preparation of padlock DNA probe: The padlock DNA probe includes a primary padlock probe and a secondary padlock probe, each of which consists of five nucleic acid chains; for the primary padlock probe, chain 1 is ACTACCAGTAATGCA / iCy5 / TTTTAATATT from the 5' end, with an alkynyl group (Hexynyl) modified at the 5' end and Cy5 modified at the mid-chain end; chain 2 is TAACTCATTGAATATTAAAA from the 5' end. Chain 3 is CAATGAGTTACAGGAGTTGTGTTTGTGGACGAAGAGCACCATCATATTAAGGCAGGAGTTGTGTTTGTGGACGAAGAGCACCataagaatca from the 5' end, with a phosphate group (Phos) modified at the 5' end. Chain 4 is AAGTGACTGTGAATGTCTACCTACC from the 5' end, with a phosphate group (Phos) modified at the 5' end and an azide group (AzideN) modified at the 3' end. Chain 5 is ACAGTCACTTTGATTCTTAT from the 5' end. For the secondary padlock probe, chain 1 is CAAACACAACTCCTG / iCy5 / ACATCATAGT from the 5' end, with an alkyne group (Hexynyl) modified at the 5' end and Cy5 modified at the mid-chain end. Chain 2 is CTGCGAATATACTATGATGT from the 5' end. Chain 3 is ATATTCGCAGTGCATTACTGGTAGTGGTAGGTAGACATTCATAGTACAGATGCATTACTGGTAGTGGTAGGTAGACATTCCTGAGTGTTG from the 5' end, with a phosphate group (Phos) modified at the 5' end. Chain 4 is AAGTGACTGTGGTGCTCTTCGTCCA from the 5' end, with a phosphate group (Phos) modified at the 5' end and an azide group (AzideN) modified at the 3' end. Chain 5 is ACAGTCACTTCAACACTCAG from the 5' end. Resuspend the five component chains at 200 μM in enzyme-free water, take 1.5 uL of chains 1, 2, 4, 5 and 1.0 uL of chain 3, mix them evenly, heat them at 70 °C for 3 minutes, and leave them at room temperature for 5 minutes. Then add 1 μL of T7 DNA ligase diluted 10 times with ultrapure water to the reaction, and react at room temperature in the dark for 1 hour or overnight; 4) The probes obtained in the above three steps are packaged separately and combined into a kit.

[0010] Another technical solution of the present invention is a nucleic acid probe obtained through the above steps for detecting VEGFA-VEGFR interaction on a single living cell.

[0011] The present invention also adopts such a technical solution: a method for using a nucleic acid probe for detecting VEGFA-VEGFR interaction on a single living cell, comprising the following steps: 1) For adherent cells, culture the cells in a confocal dish until the cell density reaches 70%-80%; for suspension cells, collect 1.0-2.0 × 10 6 The cells were placed in a centrifuge tube and washed twice with PBS buffer, and the samples were weighed below; 2) Add 200 μL of VEGFR binding probe to the sample, incubate at 4°C in the dark for 3 minutes, and wash twice with washing buffer (10% formamide, 2× sodium citrate buffer (SSC)); then add a mixed solution containing 200 μL of hybridization buffer (10% dextran sulfate, 20% formamide, 2× SSC) and 2 μL of VEGFA binding probe, incubate at 4°C in the dark for 12 minutes, and wash twice with washing buffer; 3) Add a mixed solution containing 200 μL of hybridization buffer and 4 μL of primary padlock DNA probe and incubate at 4 °C in the dark for 20 minutes, then wash twice with wash buffer; 4) After the primary padlock probe incubation is completed, perform a click reaction: take freshly prepared 75 μM copper sulfate, 150 μM 2-[4-({bis[(1-tert-butyl-1H-1,2,3-triazol-4-yl)methyl]amino}methyl)-1H-1,2,3-triazol-1-yl]acetic acid (BTTAA) and 2.5 mM sodium ascorbate solution as the click reaction mixture, add it to the sample treated in step 3), incubate at 4 °C for 10 minutes, and wash twice with washing buffer solution; 5) Add a mixed solution containing 200 μL of hybridization buffer and 8 μL of secondary padlock DNA probe and incubate at 4°C in the dark for 20 minutes, then wash twice with wash buffer; 6) After the secondary probe incubation is completed, continue to add the click reaction mixture for click reaction, wash twice with washing buffer solution, and then rinse once with anti-fading buffer (10 mM Tris, 2× SSC, 1% glucose); 7) Finally, an anti-fading buffer containing catalase and glucose oxidase was added to prevent photobleaching, and imaging was performed using super-resolution imaging techniques including but not limited to dual-ring modulated selected plane illumination microscopy (IDDR-SPIM), structured illumination microscopy (SIM), and stochastic optical reconstruction microscopy (STORM); In the above steps, the washing buffer used was 10% formamide, 2× sodium citrate buffer (SSC); the hybridization buffer used was 10% dextran sulfate, 20% formamide, 2× SSC; and the anti-fading buffer used was 10 mM Tris, 2× SSC, 1% glucose.

[0012] The present invention realizes highly sensitive and specific visual detection of VEGFA-VEGFR interaction on living cell membranes through the synergistic effect of VEGFA aptamers, VEGFR aptamers, padlock DNA probes and super-resolution imaging technology (including but not limited to IDDR-SPIM, SIM, STORM, etc.). For the VEGFA binding probe, the left part is the VEGFA aptamer, the right part is the extended sequence of the aptamer, the circular sequence is used for hybridization with the padlock DNA probe part, and the remaining sequence is used for hybridization with the VEGFR aptamer extended sequence; for the VEGFR binding probe, the left part is the VEGFR aptamer, the right part is the extended sequence of the aptamer, which is used for subsequent hybridization with the VEGFA aptamer extended sequence, and the extended sequence is combined with a DNA chain with a green fluorescent group (FAM) and a quenching group (BHQ1) at both ends through complementary pairing; for the padlock DNA probe, the left and right ends of the DNA are modified with an alkynyl group and an azido group, respectively, and a red fluorescent group (Cy5) is labeled at the same time. After the interacting nucleic acid probes are incubated with cells, the VEGFA binding probe and the VEGFR binding probe first target VEGFA and VEGFR respectively through the nucleic acid aptamer part. When VEGFA and VEGFR interact, VEGFA and VEGFR approach each other to trigger the proximity hybridization of the two binding probes, forming a closed ring structure. At this time, the short DNA chain complementary to the VEGFA binding probe is competed off to form a stem-loop structure, causing the green fluorescence to extinguish. Subsequently, the padlock DNA probe hybridizes with part of the sequence of the ring structure, and the two ends of the padlock probe are covalently connected to form a ring through a click reaction, lighting up the red fluorescence signal representing the interaction, thereby realizing the dynamic detection of VEGFA-VEGFR interaction in living cells.

[0013] The technical effects of the present invention are as follows: the dual recognition design based on nucleic acid aptamers helps to reduce false positive detection signals from the interaction between single VEGFA or VEGFR and other ligands; two nucleic acid aptamer-based binding probes trigger in situ connection and click reactions, and identify whether VEGFR interacts with the target ligand through transient assembly and conversion of fluorescence signals, thereby achieving high-sensitivity and high-accuracy detection of VEGFA-VEGFR interactions; used in conjunction with super-resolution imaging technology, the nucleic acid probe visualizes the VEGFA-VEGFR interaction on the surface of living cells with high spatiotemporal resolution; by replacing the nucleic acid aptamers targeting VEGFA and VEGFR with corresponding biomolecular probes, the nucleic acid probe can be expanded for dynamically monitoring the interactions of other biomolecules. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 It is a schematic diagram of the composition of several probes of the present invention.

[0015] Figure 2 It is a schematic diagram of the specific detection of VEGFA-VEGFR interaction of the present invention.

[0016] Figure 3 It is the agarose gel electrophoresis diagram of VEGFA binding probe and padlock DNA probe.

[0017] Figure 4 This is a super-resolution imaging diagram of the present invention implemented step by step in A549 cells.

[0018] Figure 5 Flow cytometry was used to detect the isolated CD8 + Purity chart of T cells.

[0019] Figure 6 The activation status of CTL cells was detected by flow cytometry.

[0020] Figure 7 This is a super-resolution imaging diagram of the present invention for detecting VEGFA-VEGFR interaction on CTL cells. DETAILED DESCRIPTION Example 1

[0021] VEGFR nucleic acid aptamer and extended sequence are hybridized with complementary strands to prepare VEGFR binding probes: The VEGFR nucleic acid aptamer and extension sequence (VEGFR-apt) is AATGGGCTAGTTCTAGCTCATCTTTTTTTAGGTGGGTTCGGGGGTGCTGGTCGGGGGGTG. The sequence of the complementary chain is GAGCTAGAACTAGCCCATTGCTC from the 5' end, and the quencher group BHQ1 and the fluorescent group FAM are modified at the 5' and 3' ends, respectively, which are called Competitor. The two are hybridized to obtain a VEGFR binding probe. The VEGFR-apt chain and the Competitor chain are heated at 95°C for 5 minutes and then quickly cooled to room temperature. The two are mixed in PBS to a final concentration of 100 nM, and incubated at room temperature in the dark for 1 hour to form a hybrid double chain. Example 2

[0022] Preparation of VEGFA binding probe: The VEGFA binding probe consists of five nucleic acid chains. Chain 1 is TGTGGGGGTGGACGGGCCGGGTAGAAAAAAAGATGAGCTAGGCTCGACCAGGATGGACATCATAGT from the 5' end; Chain 2 is CTGCGAATATACTATGATGT from the 5' end; Chain 3 is ATATTCGCAGTGCATTACTGGTAGTGGTAGGTAGACATTCATAGTACAGATGCATTACTGGTAGTGGTAGGTAGACATTCCTGAGTGTTG from the 5' end, with a phosphate group (Phos) modified at the 5' end; Chain 4 is AAGTGACTGTTTACGTCGCCGTCCACTAGCCCATT, with a phosphate group (Phos) modified at the 5' end; Chain 5 is ACAGTCACTTCAACACTCAG from the 5' end. Resuspend the above chains at 200 μM in enzyme-free water, take 1.5 uL of chains 1, 2, 4, 5 and 1.0 uL of chain 3, mix them evenly, heat them at 70°C for 3 minutes, and leave them at room temperature for 5 minutes. Then add 1 μL of T7 DNA ligase diluted 10 times with ultrapure water to the reaction, and react at room temperature in the dark for 1 hour or overnight. Example 3

[0023] Preparation of padlock DNA probe: Padlock DNA probes include primary padlock probes and secondary padlock probes, each of which consists of five nucleic acid chains. For the primary padlock probe, chain 1 is ACTACCAGTAATGCA / iCy5 / TTTTAATATT from the 5' end, with an alkynyl group (Hexynyl) modified at the 5' end and Cy5 modified at the mid-chain end; chain 2 is TAACTCATTGAATATTAAAA from the 5' end. Chain 3 is CAATGAGTTACAGGAGTTGTGTTTGTGGACGAAGAGCACCATCATATTAAGGCAGGAGTTGTGTTTGTGGACGAAGAGCACCataagaatca from the 5' end, with a phosphate group (Phos) modified at the 5' end. Chain 4 is AAGTGACTGTGAATGTCTACCTACC from the 5' end, with a phosphate group (Phos) modified at the 5' end and an azide group (AzideN) modified at the 3' end. Chain 5 is ACAGTCACTTTGATTCTTAT from the 5' end. For the secondary padlock probe, chain 1 is CAAACACAACTCCTG / iCy5 / ACATCATAGT from the 5' end, with an alkyne group (Hexynyl) modified at the 5' end and Cy5 modified at the mid-chain end. Chain 2 is CTGCGAATATACTATGATGT from the 5' end. Chain 3 is ATATTCGCAGTGCATTACTGGTAGTGGTAGGTAGACATTCATAGTACAGATGCATTACTGGTAGTGGTAGGTAGACATTCCTGAGTGTTG from the 5' end, with a phosphate group (Phos) modified at the 5' end. Chain 4 is AAGTGACTGTGGTGCTCTTCGTCCA from the 5' end, with a phosphate group (Phos) modified at the 5' end and an azide group (AzideN) modified at the 3' end. Chain 5 is ACAGTCACTTCAACACTCAG from the 5' end. Resuspend the five component chains at 200 μM in enzyme-free water, take 1.5 μL of chains 1, 2, 4, 5 and 1.0 μL of chain 3, mix them evenly, heat them at 70 °C for 3 minutes, and leave them at room temperature for 5 minutes. Then add 1 μL of T7 DNA ligase diluted 10 times with ultrapure water to the reaction, and react at room temperature in the dark for 1 hour or overnight.

[0024] The schematic diagrams of the three probes obtained above are attached. Figure 1 . Example 4

[0025] Synthesis and characterization of VEGFA binding probes and padlock DNA probes: Agarose gel electrophoresis was performed using 3.5% agarose gel. The gel consisted of agarose (HydraGene), 1× TBE buffer, GelstainRedTM The solution containing 20 µL of sample was mixed with 4 μL × Gelloading Dye Purple and then transferred to the wells. The gel was run at 80 V for 60 minutes. The image was taken using the Amersham ImageQuant 800 Biomolecular Imager. The results are shown in the attached Figure 3 . Example 5

[0026] Implementation of Interaction Nucleic Acid Probes in Living Cells: A549 cells were cultured in a confocal dish to a density of 70%, washed twice with phosphate buffered saline (PBS), added with 200 μL VEGFR binding probe, incubated at 4°C in the dark for 3 minutes, and washed twice with washing buffer (10% formamide, 2× sodium citrate buffer (SSC)). Then, a mixed solution containing 200 μL hybridization buffer (10% dextran sulfate, 20% formamide, 2× SSC) and 2 μL VEGFA binding probe was added and incubated at 4°C in the dark for 12 minutes, and washed twice with washing buffer. Then, a mixed solution containing 200 μL hybridization buffer and 4 μL primary padlock DNA probe was added and incubated at 4°C in the dark for 20 minutes, and washed twice with washing buffer. After the primary padlock probe incubation was completed, the click reaction was performed. That is, 75 μM copper sulfate, 150 μM 2-[4-({bis[(1-tert-butyl-1H-1,2,3-triazol-4-yl)methyl]amino}methyl)-1H-1,2,3-triazol-1-yl]acetic acid (BTTAA) and 2.5 mM sodium ascorbate (freshly prepared and added to the solution immediately before use) were pre-mixed in 2× SSC to prepare the click reaction mixture, and then the click reaction mixture was added and incubated at 4°C for 10 minutes, and washed twice with washing buffer. Then, a mixed solution containing 200 μL of hybridization buffer and 8 μL of secondary padlock DNA probe was added and incubated at 4°C in the dark for 20 minutes, and washed twice with washing buffer. After the incubation of the secondary probe was completed, the click reaction mixture was added to carry out the click reaction, washed twice with washing buffer, and finally rinsed once with anti-fading buffer (10 mM Tris, 2× SSC, 1% glucose). Finally, an antifade buffer containing catalase and glucose oxidase was added to prevent photobleaching and imaging was performed using IDDR-SPIM. Figure 4 . Example 6

[0027] Preparation and culture of CTL cells Spleens from 6-12 week old C57BL / 6 mice were collected, ground and filtered through a 70 μm cell strainer, and incubated with ammonium-chloride-potassium (ACK) lysis buffer for 5 min to lyse red blood cells, 2 mL per spleen. + MagniSort™ Mouse CD8+ Naive T Cell Enrichment Kit is used to isolate and purify CD8+ T cells from spleen cells by magnetic bead negative selection. + T cells. Purified CD8 + T cells were counted at 1.0 - 2.0 × 10 6 The cells were resuspended in complete medium at a concentration of 100 / mL, which consisted of RPMI 1640 medium supplemented with 10% fetal bovine serum, 1% penicillin-streptomycin solution, 50 μM 2-mercaptoethanol and 10 ng / mL recombinant interleukin-2 (IL-2). CTL cells were stimulated for 48 hours in a plate coated with 5 μg / mL anti-differentiation cluster 3 (CD3) and 5 μg / mL anti-leukocyte differentiation antigen 28 (CD28). Activated CTL cells were cultured in complete medium, and the medium was changed every 2 days. Flow cytometry was used to detect their purity and activation status. The results are shown in the attached figure. Figure 5 , 6 . Example 7

[0028] Detection of VEGFA-VEGFR interaction on CTL cells using interaction nucleic acid probes: Activated CTL cells were collected from the well plate, the supernatant was removed by centrifugation, and the cells were washed twice with PBS. The probe incubation process was consistent with the steps of the above-mentioned "Implementation process of interactive nucleic acid probes in living cells". Finally, imaging was performed using IDDR-SPIM. The bright spots in the FAM channel indicate non-interacting VEGFRs, and the bright spots in the Cy5 channel indicate VEGFA-VEGFR interactions. The results are shown in the attached Figure 7 .

Claims

1. A method for preparing a nucleic acid probe for detecting VEGFA-VEGFR interaction on a single living cell, comprising the following steps: 1) VEGFR aptamer and extended sequence are hybridized with complementary strands to prepare VEGFR binding probes: The sequence of the VEGFR aptamer and extension (VEGFR-apt) starting from the 5' end is AATGGGCTAGTTCTAGCTCATCTTTTTTTAGGTGGGTTCGGGGGTGCTGGTCGGGGGGTG; the sequence of the complementary chain starting from the 5' end is GAGCTAGAACTAGCCCATTGCTC, and the 5' and 3' ends are modified with the quencher group BHQ1 and the fluorescent group FAM, respectively, called Competitor, and the two are hybridized to obtain the VEGFR binding probe; the VEGFR-apt chain and the Competitor chain are heated at 95°C for 5 minutes, and then quickly cooled to room temperature; the two are mixed in PBS to a final concentration of 100 nM, and incubated at room temperature in the dark for 1 hour to form a hybrid double chain; 2) Preparation of VEGFA binding probe: The VEGFA binding probe consists of five nucleic acid chains: Chain 1 is TGTGGGGGTGGACGGGCCGGGTAGAAAAAAAGATGAGCTAGGCTCGACCAGGATGGACATCATAGT from the 5' end; Chain 2 is CTGCGAATATACTATGATGT from the 5' end; Chain 3 is ATATTCGCAGTGCATTACTGGTAGTGGTAGGTAGACATTCATAGTACAGATGCATTACTGGTAGTGGTAGGTAGACATTCCTGAGTGTTG from the 5' end, with a phosphate group (Phos) modified at the 5' end; Chain 4 is AAGTGACTGTTTACGTCGCCGTCCACTAGCCCATT, with a phosphate group (Phos) modified at the 5' end; Chain 5 is ACAGTCACTTCAACACTCAG from the 5' end; the above chains were resuspended in enzyme-free water at 200 μM, 1.5 uL of chains 1, 2, 4, 5 and 1.0 uL of chain 3 were taken and mixed evenly, and then heated at 70 Heat at ℃ for 3 minutes and leave at room temperature for 5 minutes; then add 1 μL of T7 DNA ligase diluted 10 times with ultrapure water to the reaction system and react at room temperature in the dark for 1 hour or overnight; 3) Preparation of padlock DNA probe: The padlock DNA probe includes a primary padlock probe and a secondary padlock probe, each of which consists of five nucleic acid chains; for the primary padlock probe, chain 1 is ACTACCAGTAATGCA / iCy5 / TTTTAATATT from the 5' end, with an alkynyl group (Hexynyl) modified at the 5' end and Cy5 modified at the mid-chain end; chain 2 is TAACTCATTGAATATTAAAA from the 5' end. Chain 3 is CAATGAGTTACAGGAGTTGTGTTTGTGGACGAAGAGCACCATCATATTAAGGCAGGAGTTGTGTTTGTGGACGAAGAGCACCataagaatca from the 5' end, with a phosphate group (Phos) modified at the 5' end. Chain 4 is AAGTGACTGTGAATGTCTACCTACC from the 5' end, with a phosphate group (Phos) modified at the 5' end and an azide group (AzideN) modified at the 3' end. Chain 5 is ACAGTCACTTTGATTCTTAT from the 5' end. For the secondary padlock probe, chain 1 is CAAACACAACTCCTG / iCy5 / ACATCATAGT from the 5' end, with an alkyne group (Hexynyl) modified at the 5' end and Cy5 modified at the mid-chain end. Chain 2 is CTGCGAATATACTATGATGT from the 5' end. Chain 3 is ATATTCGCAGTGCATTACTGGTAGTGGTAGGTAGACATTCATAGTACAGATGCATTACTGGTAGTGGTAGGTAGACATTCCTGAGTGTTG from the 5' end, with a phosphate group (Phos) modified at the 5' end. Chain 4 is AAGTGACTGTGGTGCTCTTCGTCCA from the 5' end, with a phosphate group (Phos) modified at the 5' end and an azide group (AzideN) modified at the 3' end. Chain 5 is ACAGTCACTTCAACACTCAG from the 5' end. Resuspend the five component chains at 200 μM in enzyme-free water, take 1.5 uL of chains 1, 2, 4, 5 and 1.0 uL of chain 3, mix them evenly, heat them at 70 °C for 3 minutes, and leave them at room temperature for 5 minutes. Then add 1 μL of T7 DNA ligase diluted 10 times with ultrapure water to the reaction, and react at room temperature in the dark for 1 hour or overnight; 4) The probes obtained in the above three steps are packaged separately and combined into a kit.

2. A nucleic acid probe for detecting VEGFA-VEGFR interaction on a single living cell prepared by the method of claim 1.

3. The method for using the nucleic acid probe for detecting VEGFA-VEGFR interaction on a single living cell as claimed in claim 2, comprising the following steps: 1) For adherent cells, culture the cells in a confocal dish until the cell density reaches 70%-80%; for suspension cells, collect 1.0-2.0 × 10 6 The cells were placed in a centrifuge tube and washed twice with PBS buffer, and the samples were weighed below; 2) Add 200 μL of VEGFR binding probe to the sample, incubate at 4°C in the dark for 3 minutes, and wash twice with washing buffer; then add a mixed solution containing 200 μL of hybridization buffer and 2 μL of VEGFA binding probe, incubate at 4°C in the dark for 12 minutes, and wash twice with washing buffer; 3) Add a mixed solution containing 200 μL of hybridization buffer and 4 μL of primary padlock DNA probe and incubate at 4 °C in the dark for 20 minutes, then wash twice with wash buffer; 4) After the primary padlock probe incubation is completed, perform a click reaction: take freshly prepared 75 μM copper sulfate, 150 μM 2-[4-({bis[(1-tert-butyl-1H-1,2,3-triazol-4-yl)methyl]amino}methyl)-1H-1,2,3-triazol-1-yl]acetic acid and 2.5 mM sodium ascorbate solution as the click reaction mixture, add it to the sample treated in step 3), incubate at 4°C for 10 minutes, and wash twice with washing buffer solution; 5) Add a mixed solution containing 200 μL of hybridization buffer and 8 μL of secondary padlock DNA probe and incubate at 4 °C in the dark for 20 minutes, then wash twice with wash buffer; 6) After the secondary probe incubation is completed, continue to add the click reaction mixture for click reaction, wash twice with washing buffer solution, and then rinse once with anti-fading buffer; 7) Add antifade buffer containing catalase and glucose oxidase to prevent photobleaching and use super-resolution imaging technology for imaging; In the above steps, the washing buffer used was 10% formamide, 2× sodium citrate buffer; the hybridization buffer used was 10% dextran sulfate, 20% formamide, 2× sodium citrate buffer; the anti-fading buffer used was 10 mM tris, 2× sodium citrate buffer, 1% glucose.

Images