Endogenous tRNA promoter and gene editing method for Thraustochytridaceae microorganisms

Abstract

The present invention discloses an endogenous tRNA promoter, whose nucleotide sequence is shown in SEQ ID NO: 1; an expression cassette and a recombinant vector containing the endogenous tRNA promoter; the application of the endogenous tRNA promoter, the expression cassette or the recombinant vector in the gene editing of Thraustochytriaceae microorganisms, and a method for gene editing of Thraustochytriaceae microorganisms. The present invention successfully establishes a CRISPR / Cas9 gene editing system based on the endogenous tRNA promoter, and realizes convenient, rapid and efficient site-specific editing in Thraustochytriaceae microorganisms, which has high application value; establishes a transformation system for screening recombinant Thraustochytriaceae microorganisms by using sodium acetate as an auxotrophic type, significantly improves the transformation screening efficiency of obtaining recombinant Thraustochytriaceae microorganisms based on Agrobacterium transformation method, and assists in realizing rapid gene editing.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and more specifically, to an endogenous tRNA promoter and a gene editing method for Thraustochytridaceae microorganisms. Background Art

[0002] As the Myxomycetes Labyrinthulomycetes ), Thraustochytridaceae has attracted wide attention as a potential industrial cell factory for the production of fatty acids and terpenoids. Docosahexaenoic acid (DHA, C22:6) produced by fermentation of Thraustochytridaceae has also been commercialized. Despite these advantages, strain development through genetic and metabolic engineering is still urgently needed to further improve the lipid production capacity of Thraustochytridaceae.

[0003] At present, the genetic modification of Thraustochytriaceae microorganisms mainly uses homologous recombination to overexpress or knockout genes. For example, Zhang et al. (Zhang, Y., Cui, X., Lin, S., Lu, T., Li, H., Lu,Y., Cao, M., Lin, X., Ling, X., 2024. Knockout of a PLD gene in Schizochytriumlimacinum SR21 enhances docosahexaenoic acid accumulation by modulation of the phospholipid profile. Biotechnology for Biofuels and Bioproducts 17, 16) knocked out phospholipase D by homologous recombination and explored the effect of its expression on lipid synthesis in Schizochytrium. Liu et al. (Liu, Y., Han, X., Chen, Zongcheng, Yan, Y., Chen, Zhi, 2024. Selectively superior production of docosahexaenoic acid in Schizochytrium sp. through engineering the fatty acid biosynthetic pathways. BiotechnologyforBiofuels and Bioproducts 17, 75) replaced the promoter of the FAS gene with a weak promoter through homologous recombination, thereby reducing the metabolic pathway of the FAS pathway and obtaining a nutritionally deficient strain with growth defects. Duan et al. (Duan, R., Pan, X., Li, K., Yang, Q., Cui, X., Zheng, Y., Lu, Y., Yao, C., Ling, X., 2023. Metabolism balance regulation for squalene production by disturbing triglyceride (TAG) synthesis in Schizochytrium sp. Algal Research 69, 102946) knocked out the elo1 gene by homologous recombination, thereby interfering with the synthesis of triacylglycerols (TAGs) and achieving the redistribution of carbon metabolic flux in the synthesis of squalene and TAG.However, it is worth noting that although genetic engineering methods based on this approach can achieve gene knockout, they often require cumbersome homology arm cloning.

[0004] The clustered regularly interspaced short palindromic repeats (CRISPR) system is a prokaryotic immune system that works primarily through CRISPR-associated proteins (Cas), which can recognize nucleic acid targets under the guidance of CRISPR RNA (crRNA). Some of these Cas proteins, especially CRISPR-Cas9, have revolutionized the metabolic engineering processes of many oil-producing microorganisms. However, it is worth noting that when using the CRISPR / Cas9 system for gene editing, both type II RNA polymerase (Pol II) and type III RNA polymerase (Pol III) promoters can be used to initiate gRNA. For example, patent CN201780055558.1 uses particle bombardment to transfer gRNA guided by RNA Pol II promoter (elongation factor 1α promoter) into Schizochytrium ( Schizochytrium sp.) ATCC 20888. Although the above patent has achieved good editing effects, the whole process is not only long (two rounds of transformant screening are required), but also requires more resistance markers (paromomycin and bleomycin). In addition, the transcription of the RNA Pol III promoter is different from the transcription of the RNA Pol II promoter responsible for mRNA. Studies have shown that RNA transcribed by RNA Pol III stays in the nucleus and is not transported to the cytoplasm. Among them, U3 and U6 are early RNA Pol III promoters commonly used to produce gRNA. For example, patent CN202011181851.2 was used to produce gRNA in Schizochytrium ( Schizochytrium sp.) HX-308 was used as the research object, and the gRNA guided by the endogenous promoter U6-2 was expressed by electroporation to achieve the knockout of the orotidine-5′-phosphate decarboxylase gene. Apart from this, there are no other related reports. There are no reports on endogenous efficient RNA Pol III promoters in Thraustochytridaceae microorganisms. Summary of the invention

[0005] An object of the present invention is to provide an endogenous tRNA promoter and a gene editing method for Thraustochytridaceae microorganisms to at least solve the above-mentioned problems.

[0006] In order to achieve the purpose and other advantages of the present invention, an endogenous tRNA promoter is provided, and the nucleotide sequence of the endogenous tRNA promoter is shown in SEQ ID NO: 1.

[0007] Endogenous tRNA promoters can induce the expression of sgRNA in Thraustochytridaceae microorganisms, so that Cas9 cuts the target sequence at the correct position; the endogenous tRNA promoter was cloned from the oil-producing fungus Schizochytrium, which was named Schizochytrium Aurantiochytrium limacinum SR21.

[0008] The present invention also provides an expression cassette, which contains the above-mentioned endogenous tRNA promoter.

[0009] Preferably, the expression cassette includes the endogenous tRNA promoter, and a sequence involved in recognizing the target gene target in the sgRNA operably linked thereto, and a gRNA scaffold. More preferably, the nucleotide sequence of the gRNA scaffold is as shown in SEQ ID NO: 2.

[0010] The present invention also provides a recombinant vector, which contains the above-mentioned endogenous tRNA promoter or the above-mentioned expression box.

[0011] The present invention also provides an application of the above-mentioned endogenous tRNA promoter, the above-mentioned expression cassette or the above-mentioned recombinant vector in gene editing of Thraustochytridaceae microorganisms.

[0012] The present invention also provides a method for gene editing of Thraustochytridaceae microorganisms, comprising co-transforming Thraustochytridaceae microorganisms with a sgRNA fragment containing the above-mentioned endogenous tRNA promoter-mediated editing target gene and a Cas9 expression vector, and screening successfully edited transformants.

[0013] Preferably, the regulatory elements of the Cas9 expression vector include PA promoter, Cas9 protein, SV40 NLS nuclear localization signal, promoter PE, terminator TE and geneticin resistance gene G418.

[0014] Preferably, the sgRNA fragment for editing the target gene mediated by the endogenous tRNA promoter includes the endogenous tRNA promoter, a sequence involved in recognizing the target gene target site in the sgRNA, and a gRNA scaffold, and the nucleotide sequence of the gRNA scaffold is shown in SEQ ID NO: 2.

[0015] Preferably, the method for screening transformants of Thraustochytridaceae microorganisms comprises: applying the Thraustochytridaceae microorganisms that have been co-cultured with Agrobacterium to a defective culture medium, wherein the defective culture medium is an Agrobacterium carbon source-deficient culture medium.

[0016] Preferably, the Agrobacterium carbon source-deficient culture medium uses xylose, molasses and / or sodium acetate as the carbon source.

[0017] Preferably, the Agrobacterium carbon source-deficient culture medium uses sodium acetate as the carbon source, and the concentration of the sodium acetate ranges from 20 to 100 g / L.

[0018] The present invention has at least the following beneficial effects:

[0019] First, the present invention has discovered an efficient endogenous tRNA promoter from Schizochytrium, which is an RNA Pol III promoter. The promoter sequence is not included in the public database and can be used in the field of gene editing technology of Thraustochytridaceae microorganisms.

[0020] Second, the present invention successfully established a CRISPR / Cas9 gene editing system based on endogenous tRNA promoter in Thraustochytrid microorganisms, and achieved convenient, rapid and efficient gene editing in Thraustochytrid microorganisms with low homologous recombination rates, which has high application value;

[0021] Third, the present invention successfully established a transformation system in Thraustochytridaceae microorganisms by using sodium acetate as an auxotrophic type to screen recombinant Thraustochytridaceae microorganisms, which significantly improved the transformation screening efficiency of Agrobacterium transformation method, avoided the use of cephalosporin antibiotics, and assisted in achieving rapid gene editing.

[0022] Other advantages, objectives and features of the present invention will be embodied in part through the following description, and in part will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 It is a structural map of the Cas9 expression vector pCB322 of the present invention.

[0024] Figure 2 1 is an electrophoresis diagram and amplification results of the Cas9 expression vector transformant of the present invention, wherein A is a diagram of the Cas9 expression vector transformant including a promoter and a Cas9 protein amplified fragment, lanes 1 to 8 are the transformant verification after the Cas9 protein is connected to the promoter, and lane 9 is a blank control; B is the electrophoresis result of PCR amplification of the Cas9 expression vector transformant, lanes 1 and 2 are Cas9 transformants, and lane 3 is a negative control.

[0025] Figure 3 The endogenous tRNA promoter and gRNA of the present invention CRTI Fragment amplification and sequence alignment results, where A is the endogenous tRNA promoter fragment and gRNA CRTI Electrophoresis results after fragment amplification, lanes 1, 3, and 5 are gRNA CRTI Fragments, lanes 2, 4, and 6 are endogenous tRNA promoters; lane B is the endogenous tRNA promoter fragment and gRNA CRTISequencing alignment results after fragment fusion.

[0026] Figure 4 This is the auxotrophic test result of the Agrobacterium of the present invention.

[0027] Figure 5 This is the sodium acetate tolerance test result of the Agrobacterium of the present invention.

[0028] Figure 6 This is the sodium acetate tolerance test result of Schizochytrium of the present invention.

[0029] Figure 7 It is a comparison of the screening system of the present invention and the phenotypic results of the knockout transformants, wherein A is the comparison result of the GUS color development quantity before and after the optimization of the screening system, and B is the microscopic examination result of the GUS color development single bacteria.

[0030] Figure 8 This is the sequencing result of the positive transformant of Schizochytrium ATCC 20888. DETAILED DESCRIPTION

[0031] The present invention is further described in detail below in conjunction with embodiments and drawings so that those skilled in the art can implement the invention with reference to the description.

[0032] It should be understood that the terms such as “having”, “including” and “comprising” used herein do not exclude the existence or addition of one or more other elements or combinations thereof.

[0033] It should be noted that the experimental methods described in the following embodiments are conventional methods unless otherwise specified, and the reagents and materials can be obtained from commercial channels unless otherwise specified.

[0034] Example 1: Construction of Cas9 backbone expression vector.

[0035] according to Figure 1 Construction of Cas9 expression vector pCB322, Figure 1 PA is the endogenous tRNA promoter from Schizochytrium; Cas9 is the Cas9 protein optimized for Schizochytrium; SV40 NLS is the nuclear localization signal of the virus SV40; PE and TE are the endogenous promoter and terminator of Schizochytrium; G418 is the geneticin resistance gene. The specific method is as follows:

[0036] 1. Primers

[0037]

[0038] 2. Fragment amplification and homologous recombination procedures

[0039]

[0040] 3. Experimental methods

[0041] The existing expression plasmid pC322-GFP in the laboratory was digested with restriction endonuclease ApaI to obtain the basic skeleton. The sequences of the endogenous promoter PA and terminator TA were amplified from the DNA genome of Schizochytrium SR21 using primer pairs PA1 / 2 and TA1 / 2, and the codon-optimized Cas9 was amplified using primer pair Cas1 / 2. It was then connected to the pC322-GFP expression vector containing G418 resistance and enzyme digestion using homologous recombinase. After it was transformed into Escherichia coli DH5α, a single colony was selected for PCR verification (the fragment spanning PA and Cas9 was the detection object, and the primer pair was PATEX1 / 2), and the positive transformant was verified, and pCB322 was successfully constructed.

[0042] The nucleotide sequence of the endogenous tRNA promoter PA is:

[0043] GTTTTCACAATCTGACTATTTTCCGGGTTCTCACTATCGCGAGTATGTTTCGTCCATCATTTAATTCAACCGTTCATTTGTCAGTGTGCGTCGCAACTAGACTATGTCTCGTTCTGTATATTTCATAGATCCTAAACTGAAATATATCATGTGTATAGGTATAGATATAATTTAGTGCAGCACAAAC TTACTCAGGCATGAATGTATTTTTTCCCTGCTTCCAATCGCAGTAGGTTTCTCCAAGCTTGATCAACTTTTAGTTAATGAACCTCTGTCAATCTGTAACAGTCATCTGGTTGATGCGTCAGTGGTTTAGTGGTAAAATAGCTGTTTCCATGCGGCTGCCCCGGGTTCGATTCCCGGCTGACGCT (SEQ ID NO: 1)

[0044] 4. Results

[0045] The electrophoresis and amplification results of Cas9 expression vector transformants are shown in Figure 2 .Depend on Figure 2 It can be seen that the PA fragment and the Cas9 fragment have been successfully connected to the backbone vector, and the positive transformant strain was then stored at -80°C for subsequent extraction of the Cas9 expression plasmid.

[0046] Example 2: Construction of fusion fragments of endogenous tRNA promoter regulating sgRNACRTI expression.

[0047] 1. Primers

[0048]

[0049] 2. Fragment amplification and homologous recombination procedures

[0050]

[0051] 3. Experimental methods

[0052] The endogenous tRNA promoter sequence (containing the N20 sequence of CRTI) for CRTI gene knockout was amplified from the DNA genome of Thraustochytriaceae microorganisms (such as Schizochytrium SR21) using primer pair tRNA1 / 2, and the gRNACRTI sequence was amplified based on the artificially synthesized gRNA scaffold fragment using primer pair gRNA1 / 2. Subsequently, the tRNA fragment and the gRNACRTI fragment were inserted into the BcuI site of the Cas9 expression vector pCB322 by homologous recombinase to obtain the Schizochytrium SR21 CRTI gene editing expression vector. After transformation with Escherichia coli DH5α, a single colony was selected to activate and extract the plasmid, and then BcuI restriction enzyme digestion verification was performed, and the transformants with correct restriction enzyme digestion verification were further sequenced for confirmation.

[0053] The nucleotide sequence of the gRNA scaffold is:

[0054] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO: 2)

[0055] 4. Results

[0056] The experimental results are as follows Figure 3 shown. Figure 3 The electrophoresis results and sequence sequencing comparison results showed that the endogenous tRNA promoter and gRNACRTI fragment were successfully fused, and then the fusion fragment tRNA-gRNACRTI was stored at -20℃.

[0057] Example 3: Transformation of tRNA-gRNACRTI and Cas9 expression vectors into Schizochytrium.

[0058] 1. Culture medium

[0059] Seed medium: 30 g / L (wt / vol) glucose, 8 g / L (wt / vol) yeast extract, and 20 g / L (wt / vol) sea crystal.

[0060] YEB medium: 5 g / L (wt / vol) sucrose, 10 g / L (wt / vol) tryptone, 1 g / L (wt / vol) yeast extract, and 0.5 g / L (wt / vol) magnesium sulfate heptahydrate.

[0061] IM induction medium: 0.98 g / L (wt / vol) glucose, 0.3 g / L (wt / vol) sodium chloride, 0.3 g / L (wt / vol) potassium hydrogen phosphate, 0.3 g / L (wt / vol) magnesium sulfate heptahydrate, 7.8 g / L (wt / vol) 2-morpholineethanesulfonic acid and 5 mL of glycerol, pH adjusted to 5.3.

[0062] Screening medium: 30 g / L (wt / vol) glucose, 8 g / L (wt / vol) yeast extract, and 20 g / L (wt / vol) sea crystal.

[0063] 2. Experimental methods

[0064] 1) Obtaining recombinant Agrobacterium.

[0065] Obtaining competent Agrobacterium: Take Agrobacterium tumefaciens AGL-1 stored at -80℃ and streak it on a YEB plate containing 50 μg / mL carbenicillin, and culture it in a 28℃ incubator until a single bacterium is obtained. Pick a single bacterium and inoculate it in 5 mL of liquid YEB (containing 50 μg / mL carbenicillin) for overnight culture (28°C, 200 rpm). Take 1 mL of bacterial liquid and inoculate it in 50 mL of liquid YEB (containing 50 μg / ml carbenicillin) for expansion culture, and culture (28°C, 200 rpm) until OD600 is 0.4-0.6. Transfer to a sterile centrifuge tube, centrifuge and remove the supernatant. Add 10 mL of pre-cooled CaCl2 solution (0.1M), gently suspend the cells, and place on ice for 30 min. Centrifuge (5000rpm, 5min) to remove the supernatant. Add 4 mL of pre-cooled CaCl2 solution (0.1 M) containing 15% sterile glycerol and gently suspend. The Agrobacterium suspension was dispensed into sterile centrifuge tubes, 100 μL per tube, and quickly frozen in liquid nitrogen for 5 minutes, and then stored at -80°C.

[0066] Obtaining recombinant Agrobacterium: Take the competent Agrobacterium cells stored at -80℃ and place them on an ice box until they melt. Add 1 μg of the fusion fragment tRNA-gRNACRTI plasmid DNA prepared in Example 2 for every 100μL competent cells, mix well, and then ice bath for 30min, -70℃ for 10min, 42℃ water bath for 1 min, and ice bath for 2 min. Add 1 mL of YEB medium without antibiotics and shake culture at 28℃ for 3-4 hours. Collect the bacteria by centrifugation (6000 rpm, 1min), take 100 μL of supernatant, resuspend the bacteria and spread it on the YEB plate (containing 50 μg / mL carbenicillin and 50 μg / mL kanamycin), and invert it in a 28℃ incubator for 2-3 days.

[0067] 2) Pretreatment of Schizochytrium.

[0068] First, after culturing Schizochytrium SR21 in seed medium overnight, it was inoculated into fresh seed medium and grown to the logarithmic phase. Then, the cells were collected by centrifugation (4 °C, 4000 × g, 5 min), and 1ⅹ BSS solution (10 mM KCl, 10 mM NaCl and 3 mM CaCl2) was added to the concentrated cells to resuspend the cells. Subsequently, the supernatant was removed by centrifugation (4 °C, 4000 × g, 5 min), and the cell pellet was collected by centrifugation (4 °C, 4000 × g, 5min). After repeating the above steps 3 times, 0.2 mL of sucrose solution (50 mM) was added to the concentrated Schizochytrium SR21 for the Agrobacterium-mediated genetic transformation system.

[0069] 3) Co-cultivation and screening.

[0070] Agrobacterium containing pCB322 was cultured in YEB medium containing 50 μg / mL kanamycin and 50 μg / mL carbenicillin at 28 °C to an OD600 of 0.8−1.2. Agrobacterium was then collected by centrifugation (4000 g, 4 °C, 5 min) and resuspended in IM induction medium (containing 200 μM acetosyringone and 50 μg / mL kanamycin) to an OD600 of 0.3−0.4. It was then cultured in a shaking incubator (28 °C, 6 h) to induce virulence effects. For transformation, Schizochytrium was incubated with Agrobacterium in IM medium for 48 h and then inoculated on a selection medium containing G418 and cephalosporin antibiotics at 28 °C (28 °C, 72 h) to select positive transformants.

[0071] The positive transformants were streaked onto the optimized medium containing G418 and the phenotypic changes of the transformants were observed.

[0072] 3. Experimental results

[0073] Positive transformants have a change in albino phenotype.

[0074] Example 4: Optimization of Agrobacterium genetic transformation system using sodium acetate as carbon source.

[0075] 1. Culture medium

[0076] Defective medium: 30 g / L (wt / vol) fructose, sucrose, xylose, molasses or sodium acetate were selected as carbon sources, 8 g / L (wt / vol) yeast extract and 20 g / L (wt / vol) sea crystal.

[0077] Optimize the culture medium: Select 5-60 g / L (wt / vol) sodium acetate as the carbon source, preferably 30 g / L, 8 g / L (wt / vol) yeast extract and 20 g / L (wt / vol) sea crystal.

[0078] 2. Experimental methods

[0079] The carbon source in the screening medium in step 3) of Example 3 is optimized. First, different carbon sources are selected, preferably fructose, sucrose, xylose, molasses and sodium acetate to replace the glucose in the screening medium. Subsequently, carbon sources of different concentrations are selected to optimize the system again according to the phenotypic changes of Agrobacterium. Finally, the two screening systems are compared by the transformants in Example 3, and the phenotypic changes of the transformants are observed by passage.

[0080] 3. Experimental results

[0081] The results are as follows Figure 4 , Figure 5 and Figure 6 As shown in Figure 2, Agrobacterium grows well on the defective medium with fructose and sucrose as carbon sources. However, on the medium with xylose, molasses and sodium acetate (sodium acetate is Figure 4 , Figure 5 and Figure 6 Agrobacterium no longer grows on a defective culture medium with sodium acetate (marked with acetate) as the carbon source. Considering the convenience of observing the background and the growth characteristics of Thraustochytridaceae microorganisms, sodium acetate was selected as the carbon source for the optimized culture medium for verification. At the same time, the concentration of sodium acetate was further optimized, and 0-60 g / L of sodium acetate was selected for co-cultivation of Schizochytrium and Agrobacterium. Agrobacterium can grow within a certain concentration range, but will no longer grow when it reaches or exceeds 20g / L. Schizochytrium can grow within the selected concentration range. Preferably, 30 g / L of sodium acetate is selected as the optimal carbon source concentration for screening the culture medium.

[0082] At the same time, the transformation efficiency of the optimized screening system was compared with that of the initial system. Figure 7 As shown in A. When randomly selected transformants were tested on a plate containing G418 and single colonies were propagated to the fifth generation, the number of positive transformants with GUS color development in the optimized solution was much greater than that in the unoptimized solution (7 for the unoptimized solution and 21 for the optimized solution). GUS color development bacterial liquid was randomly selected for examination under a microscope. The results are shown in Figure 7 As shown in B. The color-developing single bacteria are azure blue as a whole, which is consistent with the expected results. In summary, the optimized genetic transformation effect is significantly improved. This shows that the screening scheme used in the present invention is a faster and more effective screening system for transformants of Thraustochytridaceae microorganisms.

[0083] Example 5: Application of the CRISPR / Cas system to other members of the Thraustochytridaceae family.

[0084] In order to verify whether the CRISPR / Cas system is applicable to other members of the Thraustochytriaceae, the present invention selected members of the Thraustochytriaceae, Schizochytrium ATCC20888, Thraustochytrium roseum ATCC28210 and Ulkenia amoeboida, for verification.

[0085] 1. Primers

[0086]

[0087] 2. Fragment amplification and homologous recombination procedures

[0088]

[0089] 3. Experimental methods

[0090] 1) The plasmid pC322-GFP was transferred into Schizochytrium ATCC20888, Thraustochytrium ATCC28210 and Chytridium wilfordii using the optimized ATMA system, so that Schizochytrium ATCC20888, Thraustochytrium ATCC28210 and Chytridium wilfordii acquired G418 resistance.

[0091] 2) Replace the G418 resistance in pC322-GFP with bleomycin, then construct the fusion fragment expressing sgRNAG418 and transfer it into Schizochytrium ATCC20888, Thraustochytrium ATCC28210 and Oken's Chytrium containing G418 resistance. Use primer pair tRNA3 / 4 to amplify the endogenous tRNA promoter sequence (containing the N20 sequence of G418) for G418 gene knockout from the DNA genome of Thraustochytriaceae microorganisms (such as Schizochytrium SR21), and use primer pair gRNA-3 / 4 to amplify the gRNAG418 sequence based on the artificially synthesized gRNAscaffold fragment; then insert the tRNAG418 fragment and the gRNAG418 fragment into the BcuI site of the backbone vector pCB322 by homologous recombinase to construct the G418 knockout vector.

[0092] 3) The G418 knockout vector was transformed into Schizochytrium ATCC20888, Thraustochytrium ATCC28210 and Chytridium wukenii.

[0093] 4) Obtain a single bacterium by streaking, amplify the target band and send it for sequencing analysis to determine whether the target site of the target gene has been edited.

[0094] The construction process of the fusion fragment expressed by sgRNAG418 is shown in Example 2; the transformation method of pC322-GFP and tRNA-sgRNAG418 and the screening process of the transformants are shown in Examples 3 and 4; the G418 gene fragment was amplified using Test3 and Test4, and the amplified bands were sent for testing and then sequence alignment was performed.

[0095] 4. Results

[0096] The colonies that acquired G418 resistance can grow on G418 resistance plates, while the positive transformants after the introduction of tRNA-gRNA G418 and Cas9 expression vectors cannot grow on G418 resistance plates. The sequencing results of the positive transformants are as follows: Figure 8 , where the G418 gene was edited at the specific sgRNA binding position, resulting in a frameshift mutation in the entire gene. The sequencing results of Thraustochytrium ATCC28210 and Okenia are shown in the following table. Deletions are shown as dashes and insertions are shown as underlined text. This result further confirms that the endogenous tRNA promoter and the corresponding CRISPR / Cas9 gene editing system can be effectively applied in Thraustochytriaceae microorganisms.

[0097]

[0098] The number of equipment and processing scales described here are used to simplify the description of the present invention. Applications, modifications and variations of the endogenous tRNA promoters and their use of the present invention will be apparent to those skilled in the art.

[0099] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes, and they can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and the illustrations shown and described herein.

Claims

1. An endogenous tRNA promoter, characterized in that The nucleotide sequence thereof is shown in SEQ ID NO:

1.

2. An expression cassette, characterized in that It contains the endogenous tRNA promoter as claimed in claim 1.

3. A recombinant vector, characterized in that: It contains the endogenous tRNA promoter as claimed in claim 1 or the expression cassette as claimed in claim 2.

4. Use of the endogenous tRNA promoter according to claim 1, the expression cassette according to claim 2, or the recombinant vector according to claim 3 in gene editing of Thraustochytridaceae microorganisms.

5. A method for gene editing of a Thraustochytridaceae microorganism, characterized in that: The method comprises co-transforming a Thraustochytridaceae microorganism with a sgRNA fragment containing the endogenous tRNA promoter-mediated editing target gene as claimed in claim 1 and a Cas9 expression vector, and screening successfully edited transformants.

6. The method for gene editing of Thraustochytridaceae microorganisms according to claim 5, characterized in that The regulatory elements of the Cas9 expression vector include PA promoter, Cas9 protein, SV40 NLS nuclear localization signal, promoter PE, terminator TE and geneticin resistance gene G418.

7. The method for gene editing of Thraustochytridaceae microorganisms according to claim 5, characterized in that: The sgRNA fragment for editing the target gene mediated by the endogenous tRNA promoter includes the endogenous tRNA promoter, a sequence in the sgRNA involved in recognizing the target gene target site, and a gRNA scaffold, and the nucleotide sequence of the gRNA scaffold is shown in SEQ ID NO:

2.

8. The method for gene editing of Thraustochytridaceae microorganisms according to claim 5, characterized in that: The method for screening transformants of Thraustochytriaceae microorganisms comprises: applying the Thraustochytriaceae microorganisms that have been co-cultured with Agrobacterium to a defective culture medium, wherein the defective culture medium is an Agrobacterium carbon source-deficient culture medium.

9. The method for gene editing of Thraustochytridaceae microorganisms according to claim 8, characterized in that: The Agrobacterium carbon source-deficient culture medium uses xylose, molasses and / or sodium acetate as carbon sources.

10. The method for gene editing of Thraustochytridaceae microorganisms according to claim 9, characterized in that: The Agrobacterium carbon source-deficient culture medium uses sodium acetate as a carbon source, and the concentration range of the sodium acetate is 20-60 g / L.

Images