Sesame seed coat color regulation gene and method for identifying seed coat color

Abstract

The invention belongs to the technical field of sesame molecular genetic breeding, and particularly relates to a sesame seed coat color regulation gene and a method for identifying the seed coat color. According to the sesame brown seed coat color regulation gene SiLAC3, the color regulation gene is located on the sixth chromosome of a sesame genome and belongs to a dominant control gene; the length of the gene is 2270 bp, the gene comprises 6 exons and 5 introns, the control phenotype of the gene is brown seed coat, and the base sequence of the gene is SEQ ID N0.1. The gene provided by the invention is used for predicting seed coat color of a sesame sample and sesame molecular marker-assisted breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of sesame molecular genetic breeding, and specifically relates to a sesame seed coat color regulating gene and a method for identifying the seed coat color. Background Art

[0002] Sesame is a crop of the genus Sesame in the family Pedulaceae. It is an important high-quality oil crop and specialty agricultural product in my country. Sesame seeds have a high oil and protein content. In addition, they are rich in anthocyanin compounds, unique sesamin, sesamolin and other antioxidant substances. Therefore, sesame is not only an important source of high-quality edible oil, but also widely used in food processing, medical care and anti-aging.

[0003] According to the color of sesame seed coat, sesame is divided into black sesame, white sesame, yellow sesame, etc., among which black sesame and white sesame have the largest planting area. Seed coat color is an important agronomic trait of sesame. It is not only related to the biochemical characteristics of seeds, the content and activity of antioxidant components, but also closely related to the appearance and commodity quality of sesame. Therefore, research on sesame seed coat color has important theoretical significance for improving sesame quality and has practical value for meeting consumer needs. Summary of the invention

[0004] The object of the present invention is to provide a sesame seed coat color regulating gene and a method for identifying sesame seed coat color by using functional molecular markers on the regulating gene.

[0005] Based on the above purpose, the present invention adopts the following technical solutions: A sesame brown seed coat color regulatory gene SiLAC3 is located on chromosome 6 of the sesame genome and is a dominant control gene. The gene is 2270 bp long and contains 6 exons and 5 introns. The gene controls a brown seed coat phenotype, and the base sequence of the gene is SEQ ID N0.1.

[0006] Furthermore, the base sequence of the cDNA corresponding to the brown seed coat color regulatory gene SiLAC3 is SEQ ID NO.2, and the length of the cDNA sequence is 1710 bp.

[0007] Furthermore, the SiLAC3 protein encoded by the sesame brown seed coat color regulating gene SiLAC3 contains 569 amino acids, and the amino acid sequence is shown in SEQ ID NO.3.

[0008] The invention discloses an allele Silac3 of a sesame brown seed coat color regulating gene SiLAC3, wherein the controlled phenotype of the Silac3 is white seed coat, the gene length is 2271 bp, and the gene comprises 6 exons and 5 introns. The base sequence of the gene is SEQ ID NO.4.

[0009] Furthermore, the cDNA corresponding to the allele Silac3, the base sequence of the cDNA corresponding to the allele Silac3 is SEQ ID N0.5, and the length of the cDNA sequence is 1711 bp.

[0010] Furthermore, the Silac3 mutant protein translated from the cDNA corresponding to the Silac3 allele contains 444 amino acids, and the amino acid sequence is shown in SEQ ID NO.6.

[0011] An amplification primer pair for amplifying the brown seed coat gene SiLAC3 or the white seed coat gene Silac3: Forward primer SC1 Primer F: 5'-CTTCTTCGCCCAAAGTCTAA-3' Reverse primer SC1 Primer R: 5′-AACGACAGACAAACAAGACC-3′.

[0012] The PCR amplification primer pair is used to prepare the sesame brown seed coat gene SiLAC3 or its corresponding white seed coat allele Silac3 The PCR amplification method comprises the following steps: (1) Extracting genomic DNA from sesame brown seed coat material G3010 or white seed coat material Yuzhi No. 8; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair for PCR amplification; the amplification reaction system is 25 µL, as follows: Template DNA (50 ng / µL), 1.0 µL; 2×PrimeSTAR Max Premix, 12.5 µL; Forward Primer 1 (10µM), 1.0 µL; Reverse Primer (10µM), 1.0 µL; Add ddH2O to 25 µL; The specific PCR amplification procedure is as follows: pre-denaturation at 98°C for 3 minutes; then denaturation at 98°C for 15 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 4 minutes, 35 cycles; and finally extension at 72°C for 5 minutes. When the genomic DNA of brown seed coat material G3010 was used as template, the PCR amplification yielded the sesame brown seed coat gene SiLAC3 ; When the genomic DNA of the white seed coat material Yuzhi 8 was used as a template, the PCR amplification yielded the sesame white seed coat gene Silac3 .

[0013] A method for identifying sesame seed coat color using functional molecular markers on gene SiLAC3, comprising the following steps: (1) extracting DNA from the sesame sample to be identified, detecting the genotype of the sesame sample to be identified using the KASP primer combination, and performing genotyping on the SNP site BSC_SNP23 of the sesame sample to be identified using the SNPLine genotyping platform; (2) Since the BSC_SNP23 site involved in step (1) is a T base insertion mutation, there are three types of test sample results: If the typing result of the BSC_SNP23 locus is ( / : / ), it indicates that there is no T base insertion in the sample gene sequence at this locus, and the phenotype is brown seed coat; If the typing result of the BSC_SNP23 locus is ( / :T), it indicates that the sample is a heterozygous individual with a brown seed coat phenotype; If the typing result of the BSC_SNP23 locus is (T:T), it indicates that the sample gene sequence has a T base insertion at this locus and is a homozygous individual with a white seed coat phenotype; Furthermore, the KASP primer combination comprises: BSC_SNP23_F1: 5'-gaaggtgaccaagttcatgctTTGTACAGTTTAGTCCCAAACGTCA-3' BSC_SNP23_F2: 5'-gaaggtcggagtcaacggattGTACAGTTTAGTCCCAAACGTCG-3' BSC_SNP23_com: 5'-ACTGGAAACGTGAGCCAGGGAC-3'.

[0014] Further, the BSC_SNP23 is located at the 1763rd base in the coding region of the gene SiLAC3, and the molecular marker is a SNV marker of T base insertion or deletion; Among them, the sequence of 100bp before and after the molecular marker site corresponding to the brown seed coat is: GTTACCAAAACATACCCGGAGTTTTTACCACTGATTTTCCTCCTTCTCCACCTCTGGAGTTCGACTACACTGGAAACGTGAGCCAGGGACTGTGGCAGCC[-]GACGTTTGGGACTAAACTGTACAAGCTGAAGTTCGGTTCAGTAGTACAGGTTGTGTTGCAAGACACAACCATAGTTGCTGCGGAAAACCATCCGATCCAT The white seed coat is a single T base insertion, the inserted base is in square brackets, and the sequence of 100bp before and after the molecular marker site is: GTTACCAAAACATACCCGGAGTTTTTACCACTGATTTTCCTCCTTCTCCACCTCTGGAGTTCGACTACACTGGAAACGTGAGCCAGGGACTGTGGCAGCC[T]GACGTTTGGGACTAAACTGTACAAGCTGAAGTTCGGTTCAGTAGTACAGGTTGTGTTGCAAGACACAACCATAGTTGCTGCGGAAAACCATCCGATCCAT.

[0015] Furthermore, the PCR technique is used for identification in step (1), and the PCR amplification procedure is: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, extension at 61°C-55°C for 1 min, 10 cycles; denaturation at 94°C for 20 s, extension at 55°C for 1 min, 26 cycles; and storage at 10°C.

[0016] A method for identifying sesame seed coat color using the functional molecular marker is used in sesame seed coat color identification and molecular breeding.

[0017] The present invention uses the white seed coat material Yuzhi No. 8 and the brown seed coat material G3010 as parents to construct a large F2 population containing 1834 individual plants, locates the gene controlling the sesame seed coat color to the 83.4 Kb interval of chromosome 6, and combines the transcriptome and proteome analysis information to confirm and successfully clone the gene controlling the brown seed coat of sesame. SiLAC3 .

[0018] The present invention is based on sesame seed coat color regulation gene SiLAC3 or Silac3The mutation type of the sequence was used to develop the KASP molecular marker BSC_SNP23, which was completely linked to the seed coat color in the sesame F2 large population, indicating the accuracy of the marker. BSC_SNP23 can be used to quickly and accurately obtain the seed coat color information of sesame materials, and can be applied to sesame molecular marker-assisted breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 SEQ ID NO.1 is the base sequence of sesame brown seed coat color regulating gene SiLAC3; Figure 2 SEQ ID NO.2 is the base sequence of cDNA corresponding to brown seed coat color regulatory gene SiLAC3; Figure 3 The amino acid sequence of the SiLAC3 protein encoded by the sesame brown seed coat color regulating gene SiLAC3 is shown in SEQ ID NO. 3; Figure 4 The base sequence of the allele Silac3 of the sesame brown seed coat color regulating gene SiLAC3 is SEQ ID NO.4; Figure 5 The base sequence of the cDNA corresponding to the allele Silac3 is SEQ ID N0.5; Figure 6 The amino acid sequence of the Silac3 mutant protein translated from the cDNA corresponding to the Silac3 allele is shown in SEQ ID NO.6; Figure 7 a is the sesame seed coat color gene SiLAC3 Schematic diagram of initial positioning; Figure 7 b is the sesame seed coat color gene SiLAC3 Schematic diagram of fine positioning; Figure 7 c is a schematic diagram of gene distribution in the fine-mapping interval; Figure 8 a is a schematic diagram of the distribution of differentially expressed genes in the phenylpropanoid biosynthesis pathway; Figure 8 b is gene SIN_1023239 ( SiLAC3 ) Schematic diagram of differential expression at different developmental stages in brown and white seeds; Fig. 9 Schematic diagram of genotyping of KASP marker BSC_SNP23. DETAILED DESCRIPTION

[0020] Embodiment 1: The F2 population constructed by hybridization of Yuzhi No. 8 and G3010 was used as the research object to explore the genes related to controlling the brown or white seed coat of sesame. The specific process is as follows: (1) Construction of large F2 population and phenotypic investigation A large F2 population of 1,834 individual plants was constructed using Yuzhi No. 8 and G3010. The parents and the F2 population were planted in the Chengmai base in Hainan. When the seeds matured naturally, they were harvested and dried by individual plants, and the sesame seed coat color was investigated. White seed coat was marked as 1, and brown seed coat was marked as 2.

[0021] (2) Sesame brown seed coat gene SiLAC3 Fine positioning KASP markers were developed in the initial positioning interval, and DNA from 1834 sample plants was extracted using the CTAB method (reference for the extraction method: Synchronous extraction of sesame DNA and RNA, Molecular Plant Breeding, 2008, Vol. 6, No. 5, pp. 1025-1030). The LGC SNPline genotyping platform was used for typing, and after recombinant screening, the gene controlling the brown seed coat color of sesame was precisely located within a segment of 83.4 kb, such as Figure 7 As shown in Figure 7a, linkage analysis was used to locate the major QTL controlling brown seed coat color within the 1.19Mb interval of chromosome 6; as shown in Figure 7b, after screening of recombinant plants, the major QTL was finely located between markers BSC_SNP09 and BSC_SNP10, and the length of this interval was 83.4 kb; as shown in Figure 7c, 9 genes were displayed within the 83.4 kb genomic segment, namely SIN_1023234, SIN_1023235, SIN_1023236, SIN_1023237, SIN_1023238, SIN_1023239, SIN_1023240, SIN_1023241, and SIN_1023242. Transcriptome analysis of seeds of both parents at different developmental stages found that differentially enriched genes in the phenylpropanoid biosynthesis pathway were mainly concentrated in the lignin synthesis branch pathway, among which genes LAC (SIN_1023239) may be involved in catalyzing the synthesis of lignin, such as Figure 8 As shown in a; Among the above 9 candidate genes, only SIN_1023239 ( SiLAC3 ) showed significant differential expression at 15, 20, 25 and 30 days after fertilization of sesame, such as Figure 8 b; In summary, SIN_1023239 may be related to the formation of brown seed coat in sesame and is named SiLAC3 .

[0022] According to the target gene SiLAC3 obtained above, using the reference genome (Zhongzhi No. 13, Wang et al., 2016) data, the primer pairs for PCR amplification were designed as follows: Forward primer SC1 Primer F: 5'-CTTCTTCGCCCAAAGTCTAA-3' Reverse primer SC2 Primer R: 5'-AACGACAGACAAACAAGACC-3' The DNA of brown seed coat material "G3010" and white seed coat material "Yuzhi No. 8" were used as templates, and SC1Primer F / R primer pair was used for PCR amplification. The reaction system was 25μL, as follows: Template DNA (50 ng / µL), 1.0 µL; 2×PrimeSTAR Max Premix, 12.5 µL; Forward Primer 1 (10µM), 1.0 µL; Reverse Primer (10µM), 1.0 µL; Add ddH2O to 25 µL; The specific amplification procedure (PTC-100 thermal cycler, a product of MJ research company) is as follows: 98℃ pre-denaturation for 3 minutes; then 98℃ denaturation for 15 seconds, 58℃ renaturation for 15 seconds, 72℃ extension for 4 minutes, 35 cycles; finally 72℃ extension for 5 minutes; the amplified product is analyzed by electrophoresis. Then, the PCR amplified product is analyzed by electrophoresis, recovered, purified, and commissioned to Beijing Sangon Biotechnology Co., Ltd. for sequencing.

[0023] Brown seed coat material "G3010" SiLAC3 The gene is 2270 bp long and contains 6 exons and 5 introns; White seed coat material "Yuzhi No. 8" Silac3 The gene is 2271 bp long and contains 6 exons and 5 introns; After sequencing, it was found that the color regulatory gene SiLAC3 of the brown seed coat material "G3010" is located on the 6th chromosome of the sesame genome and is a dominant control gene; the gene is 2270 bp long, containing 6 exons and 5 introns. The gene controls the phenotype of brown seed coat, and the base sequence of the gene is SEQ ID N0.1.

[0024] The base sequence of the cDNA corresponding to the brown seed coat color regulatory gene SiLAC3 is SEQ ID N0.2, and the length of the cDNA sequence is 1710 bp.

[0025] The SiLAC3 protein encoded by the sesame brown seed coat color regulating gene SiLAC3 contains 569 amino acids, and the amino acid sequence is shown in SEQ ID NO.3.

[0026] White seed coat material "Yuzhi No. 8" Silac3 Brown seed coat color regulatory gene SiLAC3 The allele of this gene has a white seed coat as its controlling phenotype. The gene length is 2271 bp, including 6 exons and 5 introns. The base sequence of this gene is SEQ ID N0.4.

[0027] The base sequence of the cDNA corresponding to the allele Silac3 is SEQ ID N0.5, and the length of the cDNA sequence is 1711 bp.

[0028] The Silac3 mutant protein translated from the cDNA corresponding to the Silac3 allele contains 444 amino acids, and the amino acid sequence is shown in SEQ ID NO.6.

[0029] Gene SiLAC3 and Silac3 Sequence alignment revealed that Silac3 had a T base insertion at position 1763 in the CDS region of the full-length gene compared to SiLAC3; The insertion of the T base in the above gene sequence resulted in sequence changes in the 441-444 amino acids and premature termination of sequence translation.

[0030] To further confirm the gene SiLAC3 Participating in the regulation of the brown seed coat of sesame, based on the above comparison results, a KASP primer was designed using the sequence difference site, named BSC_SNP23, the BSC_SNP23 is located at the 1763rd base in the coding region of the gene SiLAC3, and the molecular marker is a SNV marker with T base insertion or deletion; wherein the sequence of 100bp before and after the molecular marker site corresponding to the brown seed coat is: GTTACCAAAACATACCCGGAGTTTTTACCACTGATTTTCCTCCTTCTCCACCTCTGGAGTTCGACTACACTGGAAACGTGAGCCAGGGACTGTGGCAGCC[-]GACGTTTGGGACTAAACTGTACAAGCTGAAGTTCGGTTCAGTAGTACAGGTTGTGTTGCAAGACACAACCATAGTTGCTGCGGAAAACCATCCGATCCAT The white seed coat is a single T base insertion, the inserted base is in square brackets, and the sequence of 100bp before and after the molecular marker site is: GTTACCAAAACATACCCGGAGTTTTTACCACTGATTTTCCTCCTTCTCCACCTCTGGAGTTCGACTACACTGGAAACGTGAGCCAGGGACTGTGGCAGCC[T]GACGTTTGGGACTAAACTGTACAAGCTGAAGTTCGGTTCAGTAGTACAGGTTGTGTTGCAAGACACAACCATAGTTGCTGCGGAAAACCATCCGATCCAT.

[0031] 840 individual plants from the F2 large population were randomly selected for verification. The specific process is as follows: (1) Based on the sequence difference (insertion or deletion of T base) site, the KASP primer combination was designed. The specific sequence is as follows: BSC_SNP23_F1: 5'-gaaggtgaccaagttcatgctTTGTACAGTTTAGTCCCAAACGTCA-3' BSC_SNP23_F2: 5'-gaaggtcggagtcaacggattGTACAGTTTAGTCCCAAACGTCG-3' BSC_SNP23_com: 5'-ACTGGAAACGTGAGCCAGGGAC-3' KASP primer mixture system: total volume 100 μL, of which 12 μL is BSC_SNP23_F1 primer (its concentration is 100 μM), 12 μL is BSC_SNP23_F2 primer (its concentration is 100 μM), 30 μL is BSC_SNP23 _com primer (its concentration is 100 μM), and 46 μL is double distilled water.

[0032] (2) Extract genomic DNA from the sesame sample to be tested and perform typing test using the LGC SNPline genotyping platform; The PCR reaction system is 1 μL: 1 μL template DNA (with a concentration of 20-50 ng / μL). After drying, 1 μL of 1×KASP Master Mix and a mixture of KASP primers is added. The volume of KASP primers in the mixture is about 1.4%. This step is completed by a Meridian2 microdispenser. PCR amplification was completed in a water bath thermal cycler. The PCR amplification program was as follows: 94°C pre-denaturation for 15 min; 94°C denaturation for 20 s, 61°C-55°C extension for 1 min, 10 cycles, with the temperature decreasing by 0.6°C for each cycle; 94°C denaturation for 20 s, 55°C extension for 1 min, 26 cycles; and storage at 10°C. The fluorescence data of the KASP reaction product was read using the microplate reader PHERAstar, and the fluorescence results were automatically converted into graphics. The SNV loci of the samples to be identified were genotyped using the SNPLine genotyping platform. Fig. 9 As shown in the figure, when the typing result of the BSC_SNP23 marker is ( / : / ) or ( / :T), the sample has a brown seed coat; when the typing result of the BSC_SNP23 marker is (T:T), the sample has a white seed coat. The above results show that the BSC_SNP23 marker is completely linked to the sesame seed coat color.

[0033] Therefore, it can be determined that SiLAC3 is the regulatory gene for the brown seed coat of sesame, and the BSC_SNP23 marker is a functional marker of SiLAC3, which can accurately detect the gene and be used to predict the seed coat color of sesame samples and sesame molecular marker-assisted breeding.

Claims

1. A sesame brown seed coat color regulating gene SiLAC3, characterized in that: The color regulation gene is located on chromosome 6 of the sesame genome and is a dominant control gene; the gene is 2270 bp long and contains 6 exons and 5 introns. The gene controls the phenotype of brown seed coat, and the base sequence of the gene is SEQ ID N0.

1.

2. The sesame brown seed coat color regulating gene SiLAC3 according to claim 1, characterized in that: The base sequence of the cDNA corresponding to the brown seed coat color regulatory gene SiLAC3 is SEQ ID N0.2, and the length of the cDNA sequence is 1710 bp.

3. The SiLAC3 protein encoded by the sesame brown seed coat color regulating gene SiLAC3 according to claim 1, characterized in that: It contains 569 amino acids, and the amino acid sequence is shown in SEQ ID NO.

3.

4. An allele Silac3 of the sesame brown seed coat color regulating gene SiLAC3, characterized in that: The controlled phenotype of the Silac3 is white seed coat, the gene length is 2271 bp, including 6 exons and 5 introns, and the base sequence of the gene is SEQ ID N0.

4.

5. The cDNA corresponding to the allele Silac3 according to claim 4 is characterized in that: The base sequence of the cDNA corresponding to the allele Silac3 is SEQ ID N0.5, and the length of the cDNA sequence is 1711 bp.

6. The Silac3 mutant protein translated from the cDNA corresponding to the Silac3 allele according to claim 5, characterized in that: It contains 444 amino acids, and the amino acid sequence is shown in SEQ ID NO.

6.

7. An amplification primer pair for amplifying the brown seed coat gene SiLAC3 of claim 1 or the white seed coat gene Silac3 of claim 4: Forward primer SC1 Primer F: 5'-CTTCTTCGCCCAAAGTCTAA-3' Reverse primer SC1 Primer R: 5′-AACGACAGACAAACAAGACC-3′.

8. A method for identifying sesame seed coat color using the functional molecular marker on the gene SiLAC3 in claim 1, characterized in that: It consists of the following steps: (1) extracting DNA from the sesame sample to be identified, detecting the genotype of the sesame sample to be identified using the KASP primer combination, and performing genotyping on the SNP site BSC_SNP23 of the sesame sample to be identified using the SNPLine genotyping platform; (2) Since the BSC_SNP23 site involved in step (1) is a T base insertion mutation, there are three types of test sample results: If the typing result of the BSC_SNP23 locus is ( / : / ), it indicates that there is no T base insertion in the sample gene sequence at this locus, and the phenotype is brown seed coat; If the typing result of the BSC_SNP23 locus is ( / :T), it indicates that the sample is a heterozygous individual with a brown seed coat phenotype; If the typing result of the BSC_SNP23 locus is (T:T), it indicates that there is a T base insertion in the sample gene sequence at this site and it is a homozygous individual with a white seed coat phenotype.

9. The method according to claim 8, characterized in that The KASP primer combination comprises: BSC_SNP23_F1: 5'-gaaggtgaccaagttcatgctTTGTACAGTTTAGTCCCAAACGTCA-3' BSC_SNP23_F2: 5'-gaaggtcggagtcaacggattGTACAGTTTAGTCCCAAACGTCG-3' BSC_SNP23_com: 5'-ACTGGAAACGTGAGCCAGGGAC-3'.

10. The method according to claim 8, characterized in that The BSC_SNP23 is located at the 1763rd base in the coding region of the gene SiLAC3, and the molecular marker is a SNV marker of T base insertion or deletion; Among them, the sequence of 100bp before and after the molecular marker site corresponding to the brown seed coat is: GTTACCAAAACATACCCGGAGTTTTTACCACTGATTTTCCTCCTTCTCCACCTCTGGAGTTCGACTACACTGGAAACGTGAGCCAGGGACTGTGGCAGCC[-]GACGTTTGGGACTAAACTGTACAAGCTGAAGTTCGGTTCAGTAGTACAGGTTGTGTTGCAAGACACAACCATAGTTGCTGCGGAAAACCATCCGATCCAT The white seed coat is a single T base insertion, the inserted base is in square brackets, and the sequence of 100bp before and after the molecular marker site is: GTTACCAAAACATACCCGGAGTTTTTACCACTGATTTTCCTCCTTCTCCACCTCTGGAGTTCGACTACACTGGAAACGTGAGCCAGGGACTGTGGCAGCC[T]GACGTTTGGGACTAAACTGTACAAGCTGAAGTTCGGTTCAGTAGTACAGGTTGTGTTGCAAGACACAACCATAGTTGCTGCGGAAAACCATCCGATCCAT.

11. The method according to claim 8, characterized in that The PCR technique is used for identification in the step (1), and the PCR amplification procedure is: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, extension at 61°C-55°C for 1 min, 10 cycles; denaturation at 94°C for 20 s, extension at 55°C for 1 min, 26 cycles; and storage at 10°C.

12. Application of a method for identifying sesame seed coat color using the functional molecular markers of claims 8-11 in sesame seed coat color identification and molecular breeding.

Images