Method for interfering collection traits of oriental bees by using double-stranded RNA (Ribonucleic Acid)
By injecting dsRNA matching the foraging gene into eastern bees, interfering with their collection behavior, the resource waste and health problems caused by bees' collection behavior are solved, and efficient regulation of bees' collection behavior is achieved.
Patent Information
- Application Number
- CN202411627835.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-14
- Publication Date
- 2025-01-14
AI Technical Summary
Over-gathering behavior of Eastern bees leads to waste of resources and health problems among bee groups, and uncontrolled collection activities during external emergency responses increase the risk of disease infection.
By designing double-stranded RNA (dsRNA) that specifically binds to the foraging gene of Oriental bees, injected into the bees to interfere with their collection behavior, RNA interference technology is used to inhibit the expression of related genes and regulate the collection behavior of bees.
It effectively reduces bee collection behavior, significantly reduces resource waste, and optimizes bee management without affecting the overall health and viability of bees.
Smart Images
Figure CN119307556A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of gene engineering technology, and in particular to a method for interfering with the collection characteristics of oriental honey bees by using double-stranded RNA. Background Art
[0002] As an important economic insect, the Oriental honey bee plays an indispensable role in agricultural production, especially in pollination services. However, excessive collection behavior can cause bee colonies to steal bee food from each other, which can not only trigger fierce fights between individual bees, resulting in a waste of honey and pollen resources, but also may cause intensified competition between individual bees, affecting the overall health and productivity of the bee colony. In addition, uncontrolled outdoor collection activities during external emergencies not only waste the labor of bees, but also increase the risk of bees contracting diseases, especially when the environment is polluted.
[0003] In recent years, RNA interference (RNAi) technology has been widely used in many fields due to its ability to precisely regulate gene expression. RNAi activates the silencing mechanism in cells by introducing specific double-stranded RNA molecules, specifically degrading target mRNA, thereby inhibiting the expression of related genes. This technology has been successfully applied to plants, animals and even human cells for the purpose of studying gene function and treating diseases.
[0004] In the study of bees, RNAi technology also shows great potential. Studies have shown that by injecting or feeding specific dsRNA into bees, it is possible to effectively interfere with the expression of certain genes related to bee behavior, thereby changing their behavior patterns. For example, by interfering with genes related to memory formation, the learning ability of bees can be affected; interfering with genes related to hormone signaling pathways can regulate the reproductive behavior of bees.
[0005] Regarding the foraging behavior of oriental honey bees, existing studies have pointed out that the foraging behavior of honey bees is regulated by multiple factors, including environmental factors, social factors, and gene expression levels. Among them, the expression levels of certain key genes have a significant impact on the foraging behavior of honey bees. Therefore, if the expression of these genes can be specifically interfered with through RNAi technology, it is theoretically possible to achieve effective regulation of the foraging behavior of honey bees. Summary of the invention
[0006] The purpose of the present invention is to provide a method for interfering with the foraging characteristics of Oriental honey bees using double-stranded RNA, which can effectively regulate the foraging behavior of Oriental honey bees through gene interference and has important theoretical and application value.
[0007] The above technical objectives of the present invention are achieved through the following technical solutions:
[0008] A method for interfering with the collection characteristics of oriental honey bees using double-stranded RNA, comprising the following steps:
[0009] S1. Design primers for interference fragments based on the foraging gene of the oriental honey bee. The sequences of the primers designed on Snapgene are:
[0010] Xi F:GTGAGAAGTTACCCCGGCAG
[0011] Xi R:TTCGCGTATCTGTCGCCTCC
[0012] The primers designed by NCBI are as follows:
[0013] Hi F:TTATGGGGGAGGCTGATTGC
[0014] Hi R:GTGAATGGTGGTGTACCCGT
[0015] S2, synthesizing dsRNA that specifically binds to the foraging gene of the oriental honey bee according to the primers of the interference fragment in step S1;
[0016] S3, injecting the dsRNA obtained in step S2 into oriental honey bees to interfere with the honey bee's collection behavior;
[0017] S4. After injection, the bees were placed in a constant temperature incubator at 20°C and 75% humidity to recover from silencing.
[0018] Further preferably, the detailed steps of step S2 are:
[0019] S21, obtaining interference fragments by PCR amplification;
[0020] S22. Add T7 promoter sequence to the 5' end of the PCR product. The primer sequence is as follows:
[0021] Xi F+T7:TAATACGACTCACTATAGGgtgagaagttaccccggcag
[0022] Xi R+T7:TAATACGACTCACTATAGGttcgcgtatctgtcgcctcc
[0023] Hi F+T7:TAATACGACTCACTATAGGttatgggggaggctgattgc
[0024] Hi R+T7:TAATACGACTCACTATAGGgtgaatggtggtgtacccgt
[0025] PCR amplification was performed using primers containing the T7 promoter;
[0026] S23. dsRNA was synthesized using T7 RiboMAXTM Express RNAi System, and high-purity dsRNA was obtained through annealing and purification steps.
[0027] Further preferably, the collection behavior in step S3 includes a kissing response and a taste response.
[0028] More preferably, in step S3, the injection is performed at the fifth and sixth abdominal intersegments of the bee's abdomen.
[0029] Further preferably, the injection volume in step S3 is 1 μL.
[0030] Further preferably, the silence time in step S4 is 20 minutes.
[0031] In summary, the present invention has the following beneficial effects:
[0032] First, by designing and synthesizing dsRNA that specifically binds to the foraging gene of the oriental honey bee, the expression of the foraging gene was efficiently inhibited. The experimental results showed that after the injection of 1μg / μL and 3μg / μL for dsRNA, the relative expression of the foraging gene of the honey bee was significantly reduced, indicating that this method is highly specific and effective.
[0033] Second, after interfering with the foraging gene, the kissing response (PER) and taste response score (GRS) of the oriental honey bees decreased significantly. The kissing response ratio of bees injected with 3μg / μL fordsRNA dropped to 41.78%, which was significantly lower than the control group injected with saline (77.26%). At the same time, the taste response score also decreased significantly, with the lowest being 3, which was much lower than the 7 in the control group. This shows that dsRNA treatment can significantly reduce the collection behavior of bees, which helps to optimize bee management and reduce resource waste.
[0034] Third, the experimental results show that dsRNA treatment has no significant negative impact on other important physiological functions of bees, such as survival rate and vitality. This ensures that while regulating the collection behavior, it will not adversely affect the overall health and survival ability of the bees. BRIEF DESCRIPTION OF THE DRAWINGS
[0035] Figure 1 This is a schematic diagram of transfection of DH5-α competent cells with oriental honey bee dsRNA;
[0036] Figure 2 It is the electrophoresis diagram of plasmid enzyme digestion identification;
[0037] Figure 3 It is the electrophoresis diagram of dsRNA;
[0038] Figure 4 This is a schematic diagram of the injection site of the interfering RNA for bee collection genes;
[0039] Figure 5 This is a schematic diagram of the state of the oriental honey bee after 1 μL of saline was injected into its head;
[0040] Figure 6 It is the gel electrophoresis diagram of total RNA of the sample to be tested;
[0041] Figure 7 This is a graph showing the changes in the relative expression of the foraging gene after injection of dsRNA;
[0042] Figure 8 This is a diagram showing the changes in the bee's state after the injection of dsRNA;
[0043] Fig. 9 This is a schematic diagram of the relative expression of the foraging gene in different injection time treatments and different parts;
[0044] Fig.10 This is a schematic diagram of the verification of cGMP concentration and PKG enzyme activity in honey bees after injection of dsRNA;
[0045] Fig.11 This is a schematic diagram of the verification of the bee's kissing reaction and taste reaction after injection of dsRNA. DETAILED DESCRIPTION
[0046] In order to make those skilled in the art better understand the technical solution of the present invention, the present invention is further described in detail below in conjunction with embodiments. It will be understood by those skilled in the art that the following embodiments are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention.
[0047] Example 1: Honey bee collection trait interference double-stranded RNA (dsRNA) synthesis
[0048] 1.1 Honey bee RNA extraction and cDNA synthesis
[0049] The interference fragments were obtained by PCR amplification. The steps are as follows:
[0050] 1.2 Primer design for interference fragments
[0051] Two pairs of primers were used in this study. One was designed on Snapgene based on the CDS sequence of the CDS region of the foraging gene obtained from the NCBI accession number of the oriental honey bee (Gene ID: 108004011). The other was designed on NCBI based on the CDS region of the foraging gene from the NCBI primer. The primers are shown in Table 1.
[0052] Table 1 Primers for interference fragments
[0053]
[0054] 1.3 Preparation of PCR reaction solution:
[0055] Melt 2×UltraHiFi Mix1, PCR Enhancer, primers, template and ddH2O at room temperature, mix well, centrifuge briefly and place on ice for later use. Note: 2×UltraHiFi mix may precipitate sometimes, so it must be fully dissolved before use. PCR reaction system: Prepare the PCR reaction system and reaction procedure according to the system in the table below. See Table 2.
[0056] Table 2 PCR reaction system components
[0057]
[0058] 1.4 Result detection
[0059] After the reaction is completed, take 15 μL of the product, mix it with an equal volume of 6×DNA Loading Buffer, and perform agarose gel electrophoresis.
[0060] (1) Install the large comb and glue tank and pre-cool them at 4°C;
[0061] (2) Weigh 0.25 g agarose and 25 mL 1×TAE, mix well, heat in a microwave for 1 min to dissolve, add 2.5 μL Gene Green, pour into a gel tank while hot, and protect from light for 20-30 min;
[0062] (3) Spotting: Remove the comb vertically and place the gel in the electrophoresis tank with TAE solution covering the gel surface. Spot 15 μL of the above PCR product and an equal volume of 6× Loading buffer. Spot two wells for each sample point to maximize gel recovery. The remaining well is used as a marker.
[0063] (4) Electrophoresis at 120 V for 20-30 min. Image and take photos.
[0064] (5) Gel recovery: After the scalpel was burned with flame and then cooled, the target band was cut in the gel imaging system, and a 1.5 mL centrifuge tube was peeled to remove excess gel as much as possible. The target band was chopped into pieces and placed in a centrifuge tube, which was weighed. Gel recovery was performed according to the operating instructions of the gel recovery kit (Tian Gen, Shanghai).
[0065] 1.5 Carrier connection
[0066] Use the PGM-T cloning Kit to connect the target fragment and the vector. The reaction system is 5μL Buffer, 1μL pGEM-T EasyVector, 1μL PCR purified product, 1μL T4 DNA Ligase, and 2μL ddH2O. Incubate at 4℃ overnight to obtain the connection product, which is placed on ice when used.
[0067] 1.6 Preparation of ampicillin medium and transformation of target fragment
[0068] First, sterilize the 500ml conical flask and the 250ml conical flask at 180℃ for 2h, and then prepare the culture medium according to Table 3. After preparation, sterilize at 121℃ for 20min.
[0069] Table 3 Culture medium components
[0070]
[0071] Note: *Required for preparing solid plate culture medium. Under normal circumstances, 2 bottles of liquid culture medium and 1 bottle of solid culture medium are required. After the solid is sterilized, it needs to be placed in a 55℃ water bath to prevent solidification.
[0072] 1.7 Add ampicillin
[0073] When cooled to 55°C, add 50-100 ng / μL of ampicillin to one of the batches of liquid culture medium and solid culture medium respectively, and do not add ampicillin to the other bottle of liquid culture medium, which is used for transformation activation. Pour the solid culture medium into a plate, and the amount poured is 20 mL. Be careful not to contaminate the culture medium when pouring the plate. Weigh 0.5 g of ampicillin, dissolve it in 10 mL of enzyme-free water, and add 5 μL of ampicillin solution to every 5 mL of LB culture medium, that is, the ampicillin concentration is 100 ng / μL.
[0074] 1.8 Transformation plate preparation:
[0075] (1) Add 40 μL x-Gal and 16 μL IPTG to the plate and incubate at 37°C for 1-3 hours.
[0076] (2) Vector ligation product: Add 50-100 μL (no more than 10%) of DH5-α competent cells taken out of a -80°C refrigerator and thawed on ice to a 1.5 mL centrifuge tube. Take 5 μL or 10 μL of the ligation product, flick to mix, and place on ice for 30 minutes. Heat shock in a 42°C metal bath for 90 seconds, and immediately place on ice for 2 minutes.
[0077] (3) Pre-culture: Add 500 μL of LB medium restored to room temperature into a centrifuge tube, gently pipette and mix, and place in a 37°C shaker at 200 rpm for 1 h to allow the resistance gene on the plasmid to express.
[0078] (4) Plate coating: Pipette 16 μL of 50 mg / mL LIPTG solution and 40 μL of 20 mg / mL X-gal, mix them, and evenly coat them on the prepared plate near the flame of an alcohol burner.
[0079] (5) Cultivation: Place the plate in a constant temperature incubator for 1 to 3 hours. After IPTG and X-gal are completely absorbed by the plate, evenly spread 100 μL of the mixed bacterial solution on the plate and invert and culture overnight in a 37°C incubator. Figure 1 .
[0080] 1.9 Selection of blue-white bacteria and bacterial solution PCR
[0081] (1) Prepare PCR tubes according to the number of samples: label the PCR tubes and add 20 μL of enzyme-free water. Pick up the plaques. Hold the culture dish over the flame and open it. Use a 200 μL gun to gently pick up the plaques. Make one PCR tube for each plaque. Place it in the PCR tube with enzyme-free water and blow gently. You can see that the liquid is turbid, with 3 blue bacteria and 10 white bacteria.
[0082] Table 4 Bacterial liquid PCR reaction system
[0083]
[0084] (2) Preparation of M13 primers: Select universal primer M13, dilute the primer with a concentration of 100 mM to 10 mM working solution according to the volume corresponding to the OD value of the synthetic primer, and aliquot to avoid repeated freezing and thawing. Primer M13F: TGTAAAACGACGGCCAGT, M13R: CAGGAAACAGCTATGACC.
[0085] (3) Preparation of bacterial solution PCR reaction system: You can prepare the working solution other than the template bacterial solution first, and then divide it into aliquots, see Table 4.
[0086] (4) PCR reaction program: 98°C for 2 min, 35 cycles including: 98°C for 10 s, 53°C for 20 s, 72°C for 25 s, 72°C for 5 min, and hold at 4°C.
[0087] 1.10 Gel electrophoresis of bacterial culture PCR products
[0088] Same as 1.4.
[0089] 1.11 Bacterial liquid expansion
[0090] The bacterial solution with a band around 500 bp was cultured. During the culture, 10 mL of liquid culture medium with Amp and 18 μL of the target bacterial solution were added to a 50 mL centrifuge tube. The culture was shaken at 37°C, 200 rpm, and cultured for 8 h. The plasmid was then extracted from the bacterial solution according to the kit instructions, and the concentration and quality were measured using a NanoDrop 2000 spectrophotometer (Thermo Scientific, USA).
[0091] 1.12 Plasmid restriction enzyme digestion identification
[0092] (1) The plasmid enzyme digestion identification reaction system is 20 μL, and the reaction components are: 2 μL 10× Buffer, 8 μL plasmid, 0.5 μL F-Cor I enzyme, 0.2 μL BSA, 9.3 μL ddH2O, and incubate at 37°C in a metal bath or water bath for 2 h.
[0093] (2) When the above time reaches 1.5 hours, prepare the gel for electrophoresis.
[0094] (3) Gel preparation: Weigh 0.5 g Agarose and dissolve it in 50 mL 1×TAE, then add 5 μL GeneGreen, heat to dissolve, and then prepare the gel.
[0095] (4) Spotting: Add 20 μL of plasmid to 20 μL of 6× loading buffer and directly spot 40 μL of marker. Perform electrophoresis at 120 V for 30 min.
[0096] (5) Imaging: The product formed by the primers designed initially is 400-500 bp in length with a dark band, indicating successful enzyme digestion and the sample can be sent for sequencing.
[0097] (6) Comparison of sequencing results
[0098] The samples were sequenced by Beijing Qinke Biological Co., Ltd., and the sequencing results were compared with NCBI-BLAST. The comparison result was 100% matching the target gene, and the next step of the experiment could be carried out ( Figure 2 ), from left to right in the figure: Marker2000, H1, H2, H3, H4, H5, H6, X1, X2, X3, X4, X5, X6.
[0099] 1.13 Synthesis of template containing T7 promoter
[0100] (1) Add T7 promoter to the 5' end of the primers designed for the CDS region of the target gene above. Use EGFP gene as the control gene and also add T7 promoter. The primers are shown in Table 5:
[0101] Table 5 Primers containing T7 promoter
[0102]
[0103] (2) Template synthesis
[0104] The plasmid DNA of the positive clone was used as a template for PCR amplification using primers containing T7 promoter. Two PCRs were performed respectively, and the primers were (Table 6): the first one contained the upstream (F) primer of T7 promoter and the downstream (R) primer without T7 promoter, and the second one contained the downstream (R) primer of T7 promoter and the upstream (F) primer without T7 promoter. The reaction procedure was the same as above. The two PCR products of the same gene were recovered by gel respectively, and the concentration and quality were determined by Nano. Note that the concentration of the product needs to be >125ng / μL.
[0105] Table 6 Synthesis of templates containing T7 promoter
[0106]
[0107] 1.14 dsRNA synthesis and purification
[0108] (1) Based on T7 RiboMAX TM dsRNA synthesis was performed according to the operating instructions of the Express RNAi System. The reaction system is shown in Table 7, and then vortexed to mix and incubated at 37°C for 30 min.
[0109] Table 7 T7 expression system
[0110]
[0111] (2) Equal volumes of the upstream and downstream products containing T7 were mixed, annealed at 70°C for 10 min, and slowly cooled to room temperature.
[0112] (3) Take 1 μL of RNase Solution (placed at room temperature) in the kit and dilute it 200 times by adding 199 μL of ddH2O to a 200 μL centrifuge tube. Add 2 μL of the diluted RNase Solution and RQ1 RNase-Free DNase to the mixture to remove ssRNA and template DNA from the dsRNA reaction solution. Then, incubate at 37°C for 30 min.
[0113] (4) The principle of dsRNA purification is the same as that of RNA purification, which is briefly described as follows:
[0114] 1) Transfer the mixed liquid in the PCR tube to a 1.5 mL centrifuge tube for easy centrifugation.
[0115] 2) Add NaAc at a volume ratio of dsRNA:NaAc = 10:1. NaAc is a component in the kit with a concentration of 3M and a pH of 5.2, i.e., 4 μL of NaAc is added.
[0116] 3) Add an equal volume of isopropanol, i.e. 48 μL, mix well and place on ice for 5 min. Then, a flocculent precipitate will appear and centrifuge at 12000 rpm for 10 min.
[0117] 4) Discard the supernatant, wash with 75% ethanol in an ice bath, centrifuge at 12000 rpm for 10 min, discard the supernatant, and repeat once.
[0118] 5) Briefly centrifuge to collect the residual liquid, aspirate with a pipette, and dry in a fume hood on ice for 15 minutes with the lid open to remove as much residual ethanol as possible.
[0119] 6) Take 20 μL of enzyme-free water to dissolve the dsRNA precipitate and determine the concentration and quality ( Figure 3 ), the integrity of dsRNA fragments was detected by 1% agarose gel electrophoresis, and the dsRNA products were stored at -80°C.
[0120] Example 2: Verification of the effect of interfering double-stranded RNA (dsRNA) on honey bee collection traits
[0121] 2.1 Determine the injection amount and injection site of Apis cerana dsRNA
[0122] In order to determine the interference effect of the dsRNA product of the foraging interference fragment of the oriental honey bee foraging gene, the injection amount and injection site of the oriental honey bee foraging bees were tested (Table 8; Figure 4 ; Figure 5 ). Each time, 10 bees were captured from the hive door using a test tube, brought to the laboratory and placed at -20℃ for 3min30s for anesthesia, and repeated 3 times. Figure 4 A. The injection site of the honey bee abdomen is at the junction of the 4th and 5th dorsal plates. Figure 4 B The injection site on the bee's head is at the base of the antennal coxa, and the red arrow indicates the injection site. Figure 5 A: The state of the bee after 1 μL was injected into the base of the antennae of the head for 10 minutes. The bee is basically motionless. Figure 5 B: The posterior proboscis of a fixed bee is abnormal. Figure 5 C: Abnormal antennae after bee fixation. Red arrows indicate abnormal points.
[0123] After the bees' movements slowed down, pierce the base of the bees' antennae and between the fourth and fifth dorsal plates of their abdomens with a 5μL microsyringe. The injection volumes are 1μL and 5μL, respectively. Physiological saline is injected as a test reagent, and the state of the bees after injection and the number of deaths are observed.
[0124] Experimental tests have shown that when interfering with the gene collection of honey bees, it is most appropriate to inject 1 μL of dsRNA between the fifth and sixth abdominal intersegments of the honey bee's abdomen.
[0125] Table 8 Condition of 10 worker bees after injection of saline solution
[0126]
[0127] Note: “√” indicates that the bees are in good condition, “×” indicates that the bees are dead, and “-” indicates poor vitality.
[0128] 2.2 Changes in foraging gene expression in Apis cerana after injection of dsRNA
[0129] Through the above tests, it was determined that the injection site of the oriental honey bee foraging bee dsRNA was the fifth and sixth abdominal intersegments, the optimal injection volume was 1 μL, and the optimal silencing time was 20 min. Then the relative expression of the oriental honey bee foraging gene (hereinafter referred to as Acfor) was determined. The kit was used to extract the honey bee RNA and synthesize cDNA. The relative expression of the Acfor gene was measured using 2 -△△t The RNA quality of the obtained samples was tested by agarose gel electrophoresis. Figure 6 10 bees were tested each time, and the test was repeated 3 times. The order of spotting in the figure is: 1for1, 1for2, 1for3, 3for1, 3for2, 3for3, 1e1, 1e2, 1e3, 3e1, 3e2, Marker. The Marker in the figure is a DNA Marker, which is only used to detect genomic contamination and does not represent the size of the RNA band.
[0130] 2.3 Optimal silencing time after injection of dsRNA in Apis cerana
[0131] In order to determine the optimal silencing time for interference with the foraging gene of Oriental honey bees after injection of dsRNA, the injection volume and injection site determined above were used to inject 10 Oriental honey bees in each group with concentrations of 1μg / μLfor i, 3μg / μLfor i, 1μg / μL EGFP, and 3μg / μLEGFP, respectively. Normal saline (NS) was used as a blank control to observe the number of deaths and bee status (normal, slow movement, abnormal) of bees at 10min, 20min, 30min, and 1h after injection of dsRNA. After the above-mentioned time treatment, 10 whole bees in each group were ground in liquid nitrogen in a mortar, and the relative expression of the foraging gene was detected by qPCR after RNA extraction and cDNA synthesis. After 20min of silencing, 10 foraging bees in each group were separated by head, thorax, and abdomen, and then liquid nitrogen was added to mix and grind to detect the relative expression of the foraging gene, and the technology was repeated 3 times.
[0132] 2.4 Detection of the concentration of cGMP, the precursor of the foraging gene-encoded protein, and the activity of PKG, the protein kinase encoded by the foraging gene, after dsRNA injection
[0133] To detect the effect of interfering double-stranded RNA (dsRNA) on the target gene-encoded protein of Oriental honey bees, test tubes were used to capture bees that had left the nest, and 10 Oriental honey bees were treated with each dsRNA concentration. They were brought to the laboratory, and the bees were injected with dsRNA using the above method. They were then placed in a 20°C 75% constant temperature incubator to allow the bees to recover and absorb dsRNA for 20 minutes, and each concentration was repeated 3 times. The bee's head was then immediately removed, placed in a cryopreservation tube and immersed in liquid nitrogen, frozen for 20 minutes, and then stored at -80°C. The protein leader cGMP concentration and gene-encoded protein kinase (PKG) activity were detected using an ELISA kit.
[0134] 2.5 Verification of the behavior of oriental honey bees after injection of dsRNA
[0135] Through the above tests, it was determined that the injection site of the oriental honey bee foraging bee dsRNA was the fifth and sixth abdominal intersegments, the optimal injection volume was 1 μL, and the optimal silencing time was 20 minutes, followed by a honey bee PER-GRS behavioral model test. After the test bees were slightly frozen anesthetized, they were fixed on the learning and memory test tube, and only the head and forelegs of the bees were able to move freely. Then, the bee antennae were stimulated with sucrose solution with concentrations (%, v / v) of 0, 0.1, 0.3, 1, 3, 10, and 30, and the kissing reaction (PER) and sugar taste response score (GRS) were recorded. During the test, the for gene dsRNA concentration was 1 μg / μL and 3 μg / μL, and the enhanced green fluorescent protein gene EGFP concentration was 1 μg / μL and 3 μg / μL as an irrelevant gene control, and 1 μL of physiological saline was used as a blank control. Ten bees were treated with each injection dsRNA concentration, and each concentration was repeated 6 times to determine the effect of oriental honey bee foraging gene interference on bee foraging behavior.
[0136] Example 3: Results of the verification of the effect of interfering double-stranded RNA (dsRNA) on honey bee collection traits
[0137] 3.1 Changes in relative expression of foraging genes after dsRNA injection
[0138] After the Oriental honey bee was injected with dsRNA of the for gene, the relative expression level of the for gene decreased significantly ( Figure 7 , MS=0.4743, F(4,100)=8.957, P<0.0001). After injection of 1μg / μL for i (0.707±0.028), the relative expression of for gene in honey bees was significantly lower than that in the group injected with saline (P=0.0007; Tukey's multiple comparisons test) and the group injected with 1μg / μL EGFP (P=0.0123). After injection of 3μg / μL for i (0.786±0.045), the relative expression of for gene in honey bees was significantly lower than that in the group injected with saline (P=0.0266) and the group injected with 3μg / μL EGFP (1.07±0.075, P=0.0012). There was no significant difference among the saline group, 1μg / μL EGFP group, and 3μg / μL EGFP group (P>0.05). Injecting for gene interference fragments can significantly reduce the expression level of for gene in bees.
[0139] 3.2 Determination of the optimal silencing time after injection
[0140] After 30 bees were injected with different concentrations of dsRNA, the bees showed different states ( Figure 8), there was little difference in the status of the bees 10min and 20min after injection. After 30min, the number of normal bees gradually decreased, and the number of inactive, abnormal and dead bees gradually increased. One hour after the injection, the normal number of bees decreased to 1, and the number of inactive bees increased to the maximum. Considering the active state of the bees, 20min after the injection of dsRNA was selected as the action time of the bees to the injected drug.
[0141] 3.3 Relative expression of foraging genes at different injection times and in different parts
[0142] The honey bees in 3.1 were subjected to qPCR to detect the relative expression of the for gene. After the oriental honey bees were injected with dsRNA of the for gene, the relative expression of the for gene in various parts of the honey bees and the length of treatment time were not significantly different ( Fig. 9 ; Each part: F(2,60)=0.9206, P=0.4038; Treatment time: F(3,56)=0.6700, P=0.5740; Ordinary oneway ANOVA). Fig. 9 A), the expression level of for gene in chest (0.855±0.06) was slightly lower than that in head (0.937±0.076, P=0.6701) and abdomen (0.983±0.064P=0.3790), and the difference was not significant. Fig. 9 B), the relative expression of for gene was not significantly different (P>0.05), combined with Figure 8 From the above data, it can be seen that the number of bees that died and were in poor condition increased after being injected with dsRNA, so 20 minutes after injection was selected as the duration of action of the injected drug on the bees.
[0143] 3.4 Validation results of synthetic dsRNA on the cGMP concentration and PKG activity of the protein encoded by the foraging gene of the oriental honey bee
[0144] After the oriental honey bees were injected with dsRNA of the foraging gene, the concentration of cGMP and the activity of PKG, the precursor protein encoded by the foraging gene, were significantly reduced (cGMP: Fig.10 A, F(4,19)=37.27, P<0.0001; PKG: Fig.10B, F(4,19)=30.07, P<0.0001, Ordinary one way ANOVA). After injection of 1μg / μL for i (cGMP: 20.25±0.53nmol / L, PKG: 374.5±17.34U / mL), the cGMP concentration and PKG activity of honey bees were significantly lower than those in the saline injection group (cGMP: 30.00±0.24nmol / L, P<0.0001; PKG: 516.0±21.87U / mL, P=0.0002; Tukey's multiple comparisons test) and 1μg / μL EGFP group (cGMP: 33.01±0.55nmol / L, P<0.0001, PKG: 579.2±12.92U / mL, P<0.0001). After injection of 3 μg / μL for i (cGMP: 24.76±1.16 nmol / L, PKG: 361.6±18.22 U / mL), the cGMP concentration and PKG activity of honey bees were significantly lower than those in the saline injection group (cGMP: Md=5.234, CI=1.175 to 9.294, P=0.0079; PKG: Md=154.4, CI=79.70 to 229.1, P<0.0001) and the 3 μg / μL for i group (cGMP: 24.76±1.16 nmol / L, PKG: 361.6±18.22 U / mL). EGFP group (cGMP: 31.18±0.78nmol / L, Md=-6.418, CI=-9.732to-3.10, P<0.0001; PKG: 600.4±11.76U / mL, Md=-238.8, CI=-330.3to-147.3, P<0.0001). There was no significant difference among the saline group, 1μg / μL EGFP group and 3μg / μL EGFP group (P>0.05). Injection of for gene interference fragment can significantly reduce the cGMP concentration and PKG enzyme activity in honey bees, thereby regulating the behavioral changes of honey bees.
[0145] 3.5 Verification results of synthetic dsRNA on the behavioral traits of oriental honey bees
[0146] The interference fragment dsRNA of the for gene and the control EGFP gene obtained by enzyme digestion identification, synthesis and purification was micro-injected into the foraging bees of the Oriental honey bees when they left the nest to forage, and physiological saline was used as a blank control. After injecting 1μg / μL and 3μg / μL fori and EGFP, the kissing reaction and taste reaction scores of the bees were tested. After testing, the kissing reaction of the Oriental honey bees was significantly reduced after the injection of the dsRNA of the for gene ( Fig.11A, F(4,30)=3.756, P=0.0136, Ordinary one way ANOVA), the lowest was in the group injected with 3μg / μL for dsRNA (mean±Std.E=41.78±9.16%), which was significantly lower than that injected with saline (77.26±5.56%, P=0.027, Tukey's multiple comparisons test), and there was no significant difference between the bees injected with the control 1μg / μL EGFP gene (64.88±8.99%) and saline (P=0.87), and the 3μg / μL EGFP (72.26±8.16%) gene and saline (P=0.9833). After the injection of the interference fragment of the for gene, the taste response score of the oriental honey bees also showed a significant decrease ( Fig.11 B, Kruskal-Wallis statistic = 43.53, P < 0.0001). The lowest taste response score was in the bees injected with 3 μg / μL for dsRNA (Median = 3), which was significantly lower than saline (Median = 7, P < 0.0001), 1 μg / μL EGFP (Median = 5, P = 0.0214), and 3 μg / μL EGFP (Median = 6, P < 0.0001). The bees injected with 1 μg / μL for dsRNA (Median = 3) were significantly lower than those injected with saline (P < 0.0001) and 3 μg / μL EGFP (P = 0.0007). There was no significant difference between the bees injected with 1 μg / μL for dsRNA and 3 μg / μL for dsRNA (Mrd = 9.173, P > 0.999). Interfering with the for gene of honey bees can significantly reduce the taste response of oriental honey bees to sugar solutions. The for gene plays an extremely important role in the foraging behavior of honey bees.
[0147] The above embodiments are merely explanations of the present invention and are not limitations of the present invention. After reading this specification, those skilled in the art may make modifications to the embodiments without any creative contribution as needed. However, such modifications are protected by the patent law as long as they are within the scope of the claims of the present invention.
Claims
1. A method for interfering with the collection characteristics of oriental honey bees using double-stranded RNA, characterized in that: The following steps are involved: S1. Design primers for interference fragments based on the foraging gene of the oriental honey bee. The sequences of the primers designed on Snapgene are: Xi F:GTGAGAAGTTACCCCGGCAG Xi R:TTCGCGTATCTGTCGCCTCC The primers designed by NCBI are as follows: Hi F:TTATGGGGGAGGCTGATTGC Hi R:GTGAATGGTGGTGTACCCGT S2, synthesizing dsRNA that specifically binds to the foraging gene of the oriental honey bee according to the primers of the interference fragment in step S1; S3, injecting the dsRNA obtained in step S2 into oriental honey bees to interfere with the honey bee's collection behavior; S4. After injection, the bees were placed in a constant temperature incubator at 20°C and 75% humidity to recover from silencing.
2. The method of using double-stranded RNA to interfere with the collection characteristics of oriental honey bees according to claim 1, characterized in that: The detailed steps of step S2 are: S21, obtaining interference fragments by PCR amplification; S22. Add T7 promoter sequence to the 5' end of the PCR product. The primer sequence is as follows: Xi F+T7:TAATACGACTCACTATAGGgtgagaagttaccccggcag Xi R+T7:TAATACGACTCACTATAGGttcgcgtatctgtcgcctcc Hi F+T7:TAATACGACTCACTATAGGttatgggggaggctgattgc Hi R+T7:TAATACGACTCACTATAGGgtgaatggtggtgtacccgt PCR amplification was performed using primers containing the T7 promoter; S23. dsRNA was synthesized using T7 RiboMAXTM Express RNAi System, and high-purity dsRNA was obtained through annealing and purification steps.
3. A method for interfering with the collection characteristics of oriental honey bees using double-stranded RNA according to any one of claims 1 or 2, characterized in that: The collection behavior in step S3 includes kissing response and taste response.
4. The method of using double-stranded RNA to interfere with the collection characteristics of oriental honey bees according to claim 3, characterized in that: In step S3, the injection is performed at the fifth and sixth abdominal intersegments of the bee's abdomen.
5. The method of using double-stranded RNA to interfere with the collection characteristics of oriental honey bees according to claim 3, characterized in that: The injection volume in step S3 is 1 μL.
6. The method of using double-stranded RNA to interfere with the collection characteristics of oriental honey bees according to claim 3, characterized in that: The silence time in step S4 is 20 minutes.