Method for rapidly detecting group B streptococcus and application

Abstract

The invention discloses a group B streptococcus rapid detection method and application, the GBS rapid detection method based on a gene editing technology is clear in clinical application scene and distinct in technical feature, and can be used as a POCT solution for replacing a traditional detection technology. The method has good popularization and application prospects in clinical outpatient service or basic medical institutions without conventional molecular detection capability.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a rapid detection method for group B streptococci and an application thereof. Background Art

[0002] Group B Streptococcus GBS, also known as Streptococcus agalactiae, is a Gram-positive coccus and a broad-spectrum conditional pathogen. Up to 30% of pregnant women will be colonized with GBS, and up to 75% of mothers colonized with GBS will vertically transmit the disease to their newborns, of which 2% will develop invasive GBS infection. GBS is the main pathogen of intra-amniotic infection and early-onset neonatal infection, and is also the most common cause of neonatal sepsis and meningitis, and can even lead to maternal and infant death.

[0003] In order to reduce the occurrence of adverse outcomes, the Expert Consensus on Prevention of Perinatal Group B Streptococcal Disease (China) recommends that all pregnant women at 35-37 weeks of gestation be screened for GBS so that appropriate intervention treatment can be given to patients. The three common methods for GBS detection are microbial culture, immunology, and molecular diagnosis. Microbial culture is the gold standard, but it is time-consuming and requires high personnel quality, and can no longer meet the needs of rapid clinical screening. Immunological methods are simpler than microbial culture methods, but have low sensitivity and specificity, and are currently rarely used in clinical laboratories. Molecular diagnostic technology based on PCR amplification has high sensitivity and strong specificity, but the pre-treatment steps are complicated, and the requirements for laboratory personnel and equipment are high. It is often not suitable for promotion in clinical outpatient clinics or primary medical institutions. Conventional molecular diagnostic methods are affected by the batch and frequency of detection, and may not be able to respond to the treatment needs of patients with maternal and fetal critical infection caused by GBS in a timely manner (that is, it is impossible to do "as soon as the specimen comes"). Therefore, there is an urgent need for rapid GBS detection methods with high specificity and sensitivity, simple operation, and low equipment requirements to meet the needs of critical care and popularization in primary medical institutions. Summary of the invention

[0004] In order to solve the technical problems existing in the prior art, the present invention provides the following technical solutions:

[0005] The present invention provides a primer set for detecting group B streptococci, wherein the sequence of the primer set comprises at least one of the following primer pairs:

[0006] Primer pair SEQ ID NO: 1, 2, primer pair SEQ ID NO: 3, 4, primer pair SEQ ID NO: 5, 6, primer pair SEQ ID NO: 7, 8, primer pair SEQ ID NO: 9, 10, primer pair SEQ ID NO: 11, 12, primer pair SEQ ID NO: 13, 14.

[0007] The present invention provides a primer / probe set for detecting group B streptococci, wherein the sequence of the primer / probe set comprises:

[0008] Primer pair SEQ ID NO: 1, 2, primer pair SEQ ID NO: 3, 4, primer pair SEQ ID NO: 5, 6, primer pair SEQ ID NO: 7, 8, primer pair SEQ ID NO: 9, 10, primer pair SEQ ID NO: 11, 12, primer pair SEQ ID NO: 13, 14, probe sequence SEQ ID NO: 15-20, the primer pairs are used in combination with any one or more probe sequences.

[0009] Further, the sequence of the primer / probe set is at least one of the following primer / probe pairs:

[0010] The primer / probe pair is primer pair SEQ ID NO: 1, 2, and probe SEQ ID NO: 15 and / or SEQ ID NO: 16;

[0011] The primer / probe pair is primer pair SEQ ID NO: 3, 4, and probe SEQ ID NO: 15 and / or SEQ ID NO: 16;

[0012] The primer / probe pair is primer pair SEQ ID NO: 5, 6, and probe SEQ ID NO: 15 and / or SEQ ID NO: 16;

[0013] The primer / probe pair is primer pair SEQ ID NO: 7, 8, and probe SEQ ID NO: 17;

[0014] The primer / probe pair is primer pair SEQ ID NO: 9, 10, and probe SEQ ID NO: 18;

[0015] The primer / probe pair is primer pair SEQ ID NO: 11, 12, and probe SEQ ID NO: 19;

[0016] The primer / probe pair is primer pair SEQ ID NO: 13, 14, and probe SEQ ID NO: 20.

[0017] Further, the probe is detected by CRISPR / Cas12a;

[0018] Further, the probe is labeled with a fluorescent dye;

[0019] Furthermore, the fluorescent dye labels include FAM, HEX, TAMRA, ROX, TET, JOE, Cy3, Cy5, VIC, Cy5.5, Texas Red, NED, FAM-dT, TAMRA-dT, CY3-dT, CY5-dT, HEX-dT, and FITC;

[0020] Further, the probe further comprises a quenching group;

[0021] Further, the quenching group includes BHQ1, TAMRA, BHQ2, Rhodamine 6G, Rhodamine B, BHQ3, Dabcyl, Eclipse, MGB, BHQ1-dT, BHQ2-dT;

[0022] Further, the probe is labeled with a modification group;

[0023] Furthermore, the modification groups include amine groups, phosphate groups, biotin, biotin-TEG, and C3-spacer.

[0024] The present invention provides a system for detecting group B streptococci, the system comprising:

[0025] The primer / probe set, isothermal amplification reagent, CRISPR / Cas12a enzyme digestion system and colloidal gold immunochromatographic test strips described above;

[0026] The isothermal amplification reagents include amplification reagents used in LAMP, RCA, NEAR, NASBA, HDA, ERA, and RPA amplification techniques;

[0027] Furthermore, the CRISPR / Cas12a enzyme cleavage system includes Cas12a nuclease and Cas12a nuclease buffer;

[0028] Further, the Cas12a is LbCas12a;

[0029] Furthermore, the anti-FAM antibody in the colloidal gold immunochromatographic test paper is labeled with colloidal gold, and the detection line on the nitrocellulose membrane (NC membrane) is coated with streptavidin that can bind to biotin.

[0030] In some embodiments, the length of RPA primers is longer than that of general PCR primers. If the primers are too short, the recombination rate will be reduced, affecting the speed of amplification and the detection sensitivity. The length of RPA primers is preferably 30-35 bp. In some embodiments, the length of the target amplified fragment is preferably 100-200 bp. In some embodiments, to promote fragment recombination, the 5' end of the primer should avoid continuous G, preferably C. In some embodiments, to improve amplification performance, the 3' end of the primer is preferably GC. In some embodiments, the overall GC content of the primer is between 30-70%, and the sequence that forms a secondary structure or a hairpin structure is avoided to reduce the formation of primer dimers.

[0031] In some embodiments, there are C lines and T lines on the colloidal gold immunochromatographic test paper NC membrane, the C line is a conventional anti-FAM antibody, and the T line is an anti-biotin antibody (eg, an anti-biotin antibody).

[0032] The present invention provides the aforementioned primer set, the aforementioned primer / probe set, and the use of the aforementioned system in preparing a product for detecting group B streptococci.

[0033] The present invention provides a method for detecting group B streptococci, the method comprising the step of using the aforementioned system for detection, and the specific steps comprising using a constant temperature amplification system and the aforementioned primer set for amplification, the product is combined with the probe in the aforementioned primer / probe set, and then cut using the CRISPR / Cas12a enzyme cutting system, and the product enters the colloidal gold immunochromatography test paper to display the result;

[0034] Furthermore, the method also includes a method for releasing nucleic acid from group B streptococci, the steps of the nucleic acid release method are: using 5% Chelex 100 to release nucleic acid, the nucleic acid release conditions are: 12000rpm, 1 minute, centrifugation at room temperature to collect bacteria, discarding the supernatant and adding 50μl, 5% Chelex 100, incubating at room temperature for 10 minutes, then 12000rpm, 5 minutes, collecting the supernatant at room temperature, and the bacterial nucleic acid is released in the supernatant.

[0035] The present invention provides a kit for detecting group B streptococci, the kit comprising the aforementioned primer set, the aforementioned primer / probe set, the aforementioned system, the aforementioned reagents used in the aforementioned method, a reaction container and / or a step instruction manual.

[0036] The term "kit" used in the present invention may refer to any system for delivering materials. In the case of reaction analysis, such delivery systems may include elements that allow reaction components (such as oligonucleotides, buffer components, additives, reaction enhancers, enzymes, etc.) to be stored, transported or delivered from one position to another position in a suitable container, usually provided with written instructions for analysis. The kit may include one or more packages or boxes containing related reaction reagents and support materials. The kit may include two or more than two separate containers, each of which includes a portion of the total kit components. The containers may be delivered to the intended recipient together or separately.

[0037] In some embodiments, the reaction vessel refers to a compartment (e.g., a microfluidic channel, a well, a tube, or a droplet) in which a biochemical reaction (e.g., target protein and antibody binding, nucleic acid hybridization, and primer extension) or cell growth can occur.

[0038] The present invention provides the use of the aforementioned primer set, the aforementioned primer / probe set, the aforementioned system, and the aforementioned method in preparing an apparatus for automatically detecting group B streptococci.

[0039] The present invention provides a device, the device comprising a processing module, the processing module is used to implement the above method;

[0040] Furthermore, the system or device also includes a storage module;

[0041] Further, the storage module stores a computer program;

[0042] Further, the computer program is used to programmatically execute the steps of the method described above;

[0043] Furthermore, the computer program is implemented by a processing module to perform specific operations.

[0044] In some embodiments, one of the computer programs can construct a processing module, or multiple processing modules can be constructed using one program. On the contrary, multiple computer programs can be used to construct a processing module. In addition, multiple computer programs can be executed by one computer, and multiple processing modules can be manipulated by one computer; similarly, a single computer program can be executed by multiple computers, and a single processing module can be operated by multiple computers. In certain embodiments, the computer stores a storage module. Examples of storage modules may include a hard disk (HD), a random access memory module (RAM), an external storage medium, a storage medium connected via a communication line, and a register included in a central processing unit (CPU), which can be stored separately or in the form of a storage device in the computer.

[0045] The term "automation" used in the present invention refers to a situation where any one or more steps (e.g., cell collection) of a procedure or method do not need to be performed "by hand" (i.e., manually), but wherein the desired step or procedure (e.g., cell collection) can be performed by one or more suitable devices or systems such as one or more robots, liquid handling robots and / or other (e.g., solvent preparation) liquid transfer devices, which are programmed before performing one or more steps so that the corresponding steps and modes (especially the collection step) are performed in an automated manner according to the programmed content.

[0046] The term "device" used in the present invention refers not only to a system or device having a structure in which multiple computers, pieces of hardware, devices, etc. are connected to each other via a communication unit such as a network (including communication connections established in a one-to-one manner), but also to a system or device implemented by one computer, one piece of hardware, one device, etc.

[0047] The term "processing module" used herein is intended to include any integrated circuit or other electronic and mechanical device capable of operating on at least one instruction language, such as executing instructions, codes, computer programs and scripts accessed from a storage medium. However, the term "processing module" should not be interpreted as limited to hardware capable of executing software, but rather refers in a general manner to a processing device, which may include, for example, a microprocessing module, an integrated circuit, or a programmable logic device (PLD). A processing module may also encompass one or more graphics processing units (GPUs), whether used for computer graphics and image processing or other functions.

[0048] The present invention uses the terms "container" and "compartment" interchangeably. The container or compartment can be solid-walled (when the boundary of the container or compartment is solid, such as glass, plastic or polydimethylsiloxane (PDMS)), or liquid-walled (when the boundary of the container or compartment is liquid, such as oil). Solid-walled containers can contain a solid support, which is a continuous solid connecting all containers. The volume of the compartment can be as large as to allow industrial, large-scale production, or as small as 1 picoliter. The volume of the aqueous content in the compartment can be less than or approximately equal to the volume of the compartment. The container can contain a variety of polymerizable or gellable polymers and / or monomers.

[0049] The term "primer" is used in the present invention to refer to an oligonucleotide that can hybridize with nucleic acids and serve as the starting point of polymerization of nucleotides (RNA or DNA) under suitable conditions (that is, in the presence of four different nucleoside triphosphates and polymerizing reagents such as DNA or RNA polymerase or reverse transcriptase) in a suitable buffer and at a suitable temperature. The appropriate length of primer depends on the intended use of primer, but primer is typically at least 7 nucleotides in length, more typically from 10 nucleotides to 30 nucleotides or even more typically from 15 nucleotides to 30 nucleotides in length. Other primers can be slightly longer, for example 30 to 50 nucleotides in length. In some specific embodiments, the primer length is between 30-35nt, and there is no palindromic sequence, continuous single base repeat sequence and internal secondary structure region in the sequence.

[0050] The term "fluorescent group" used in the present invention refers to a fluorescent group that emits light of a wavelength in the visible spectrum and has a high degree of photostability, such as, but not limiting the scope of the present invention, borodipirrometenos, xantenos, rhodamines, cianinas, oxacinas, porphyrins, coumarins and hidrocarburos policiclicos, which may or may not have a substituent. In the present invention, the term "fluorescent group" is used interchangeably with the term "fluorescent dye label".

[0051] The term "quencher" as used herein refers to a portion of a molecule or compound that can reduce the fluorescence emitted by a fluorescent group (eg, a fluorescent donor group). This reduction includes reducing the light generated when a photon is normally emitted from the fluorescent group.

[0052] The term "probe" used in the present invention as used herein may refer to an oligonucleotide sequence. The probe may be complementary to the probe target region. The length of the probe sequence complementary to the probe target region may be less than about 200 residues, between about 15 and 100 nucleotides in length, but longer polynucleotide chains may also be intended to be encompassed. The probe target region may be single-stranded or double-stranded.

[0053] The use of the term "comprising / including" in the present invention refers to a composition or method of one or more named elements or steps that is open-ended, meaning that the named elements or steps are required, but other elements or steps may be added within the scope of the composition and method. To avoid redundancy, it should also be understood that any composition or method described as "comprising / including" one or more named elements or steps also describes a corresponding more limited composition or method that "consists essentially of the same named elements or steps", meaning that the composition or method includes the named required elements or steps, and may also include other elements or steps that do not materially affect the basic and novel characteristics of the composition or method.

[0054] Advantages and beneficial effects of the present invention:

[0055] 1. Based on gene editing (CRISPER) technology, the present invention can complete the detection and reporting of GBS clinical samples within 1 hour (theoretical detection time is 45 minutes), which is more suitable for GBS screening of perinatal pregnant women and rapid diagnosis of critical infection, and strives for a better treatment window for clinical diagnosis and treatment.

[0056] 2. The present invention adopts the method of developing color with colloidal gold test strips to interpret the results, which does not require additional analysis and reporting processes, is low-cost, and is more popular among clinical doctors and grassroots testing personnel.

[0057] 3. The present invention uses gene editing technology to quickly detect Group B Streptococcus, while maintaining high specificity and sensitivity, without the need for special instruments and equipment and experimental environment (only a constant temperature incubation device is required), and the operation process is simple (only steps such as adding samples, mixing, and standing are required), which greatly saves manpower, instruments, personnel training, and laboratory construction and maintenance costs, and is conducive to popularization to grassroots medical institutions with relatively weak facilities and personnel, broadening the scope of accessible patient groups. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 This is a schematic diagram of the principle of the GBS rapid detection system;

[0059] Figure 2 This is the SDS-PAGE image of LbCas12a expression and purification;

[0060] Figure 3 This is a graph showing the results of Cas12a detection activity analysis;

[0061] Figure 4 It is a statistical graph of the GBS test results of different primer / probe pairs;

[0062] Figure 5 It is the test strip detection sensitivity result graph;

[0063] Figure 6It is the result diagram of the test specificity experiment, where A is the specificity test of the fluorescent reporter system, and B is the specificity test of the test strip reporter system;

[0064] Figure 7 This is a graph of clinical sample validation test results. DETAILED DESCRIPTION

[0065] The above contents of the present invention are further described in detail below by means of specific implementation methods in the form of examples, but this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples.

[0066] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0067] Example 1 Principle and Method Overview of Group B Streptococcus Detection Method

[0068] This study has initially established a GBS rapid detection system by integrating isothermal amplification, CRISPR Cas12a enzyme cleavage system and colloidal gold immunochromatography technology (theoretical detection time limit is only 45 minutes, Figure 1 ). In this technical route, first, GBS nucleic acid is quickly extracted at room temperature (RT). Subsequently, after the protospacer adjacent motif (PAM) in the GBS cfb and atoB target gene sequences amplified by specific primers at constant temperature is recognized by crRNA (CRISPER RNA, i.e., guide sequence RNA), the Cas12a nuclease and crRNA binary complex can bind to the template and activate the activity of Cas12a nuclease, cis-cut the double-stranded template DNA, and trigger its trans-cutting activity to the free single-stranded DNA (probe) in the reaction system, so that the probe in the system is cut. Finally, the reaction product is detected using colloidal gold immunochromatography test paper, and the uncut probe forms a streptavidin-biotin-carboxyfluorescein (FAM)-gold-labeled anti-FAM antibody complex at the quality control strip to develop a color strip, and the cut probe forms an anti-antibody-gold-labeled anti-FAM antibody-FAM complex at the detection strip to develop a color strip.

[0069] Example 2 Expression and purification of Cas12a protein

[0070] The pET-28a(+)-TEV-LbCas12a plasmid was transformed into Escherichia coli BL21(DE3), and after amplification and culture, isopropyl-β-D-thiogalactoside (IPTG) was added to induce the expression of LbCas12a protein (meaning Cas12a protein of Lachnospiraceae bacterium). The cells were ultrasonically broken and purified using Ni-beeds (nickel column), followed by elution, dialysis and concentration to obtain LbCas12a protein, which was quantified by the Bicinchoninic Acid (BCA) method and stored in aliquots at a concentration of 50 μm.

[0071] The obtained LbCas12a protein was identified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) ( Figure 2 :M: Marker; IPTG(-): sample without IPTG added; Total: disrupted bacteria; Pellet: precipitate of disrupted bacteria; Supernatant: supernatant of disrupted bacteria; UB: supernatant after bacteria bind to Ni ion affinity chromatography column; 50mM lmid: 50mM imidazole elution; 100mM lmid: 100mM imidazole elution; 200mM lmid: 200mM imidazole elution; Concentrated LbCas12a: LbCas12a protein after ultrafiltration concentration).

[0072] Example 3 Detection of Cas12a protein activity

[0073] In order to detect the enzymatic activity of Cas12a, we used the reported HPV Cas12a detection system to detect the Cas12a we expressed and purified. This research team set up experimental groups and different negative control groups to verify the activity of LbCas12a. Among them, the experimental group contained all the necessary components for fluorescent cutting, and the four negative control groups were crRNA-free group, Cas12a-free group, target DNA-free group, and reporter DNA-only group (Table 1). The results are shown in Figure 3 As shown, only the fluorescence value of the experimental group showed an obvious upward trend over time, while the fluorescence values ​​of the other four negative control groups did not show an upward trend. Therefore, this experiment can prove that the LbCas12a protein purified in this subject has the expected trans-cleavage enzyme activity and can be used for subsequent research.

[0074] Table 1

[0075]

[0076] Example 4 RPA isothermal amplification primers, crRNA sequence design and detection sensitivity experiment

[0077] The present invention designs corresponding primers and corresponding crTNA according to the GBS conserved genes cfb and atoB, and follows the same design principles during design, as follows:

[0078] (a) The length of RPA primers should be longer than that of general PCR primers. If the primers are too short, the recombination rate will be reduced, affecting the amplification speed and detection sensitivity. The length of RPA primers should be 30-35 bp;

[0079] (b) The length of the amplified target fragment should be preferably 100-200 bp;

[0080] (c) To promote fragment recombination, the 5' end of the primer should avoid continuous G and should preferably be C;

[0081] (d) To improve amplification performance, the 3' end of the primer is preferably GC;

[0082] (e) The overall GC content of the primers should be between 30-70%, and the sequences that form secondary structures or hairpin structures should be avoided to reduce the formation of primer dimers.

[0083] Among them, the gene sequence of the GBS conserved gene cfb is shown in SEQ ID NO:21, SEQ ID NO:21: ATGAACGTTACACATATGATGTATCTATCTGGAACTCTAGTGGCTGGTGCATTGTTATTTTCACCAGCTGTATTAGAAGTACATGCTGATCAAGTGACAACTCCACAAGTGGTAAATCATGTAAATAGTAATAATCAAGCCCAGCAAATGGCTCAAAAGCTTGATCAAGATAGCATTCAGTTGAGAAATATCAAAGATAATGTTCAGGGAACAGATTATGAAAAACCGGTTAATGAGGCTATTACTAGCGTGGAAAAATTAAAGACTTCATTGCGTGCCAACCCTGAGACAGTTTATGATTTGAATTCTATTGGTAGTCGTGTAGAAGCCTTAACAGATGTGATTGAAGCAATCACTTTTTCAACTCAACATTTAACAAATAAGGTTAGTCAAGCAAATATTGATATGGGATTTGGGATAACTAAGCTAGTTATTCGCATTTTAGATCCATTTGCTTCAGTTGATTCAATTAAAGCTCAAGTTAACGATGTAAAGGCATTAGAACAAAAAGTTTTAACTTATCCTGATTTAAAACCAACTGATAGAGCTACCATCTATACAAAATCAAAACTTGATAAGGAAATCTGGAATACACGCTTTACTAGAGATAAAAAAGTACTTAACGTCAAAGAATTTAAAGTTTACAATACTTTAAATAAAGCAATCACACATGCTGTTGGAGTTCAGTTGAATCCAAATGTTACGGTACAACAAGTTGATCAAGAGATTGTAACATTACAAGCAGCACTTCAAACAGCATTAAAATAA。

[0084] The primers and probes designed according to the GBS conserved gene cfb are shown in Table 2.

[0085] Table 2

[0086]

[0087]

[0088] The gene sequence of the GBS conserved gene atoB is shown in SEQ ID NO:22. SEQ ID NO:22:

[0089]

[0090] The primers and probes designed based on the GBS conserved gene atoB are shown in Table 3.

[0091] Table 3

[0092]

[0093]

[0094] GBS detection is performed using different pairing methods, with the template being the corresponding plasmid DNA.

[0095] A1: indicates that the RPA primer pair is A and the probe is crRNA1;

[0096] A2: indicates that the RPA primer pair is A and the probe is crRNA2;

[0097] B1: indicates that the RPA primer pair is B and the probe is crRNA1;

[0098] B2: indicates that the RPA primer pair is B and the probe is crRNA2;

[0099] C1: indicates that the RPA primer pair is C and the probe is crRNA1;

[0100] C2: indicates that the RPA primer pair is C and the probe is crRNA2;

[0101] D3: indicates that the RPA primer pair is D and the probe is crRNA3;

[0102] E4: indicates that the RPA primer pair is E and the probe is crRNA4;

[0103] F5: indicates that the RPA primer pair is F and the probe is crRNA5;

[0104] G6: indicates that the RPA primer pair is G and the probe is crRNA6;

[0105] H7: indicates that the RPA primer pair is H and the probe is crRNA7;

[0106] I8: indicates that the RPA primer pair is I and the probe is crRNA8.

[0107] In the process of paired GBS detection, the detection effect of D3 and F5 was not good, which proved that the primers and probes obtained by the same standard may not necessarily be able to detect GBS. Figure 4 shown.

[0108] In addition, the successful primer-probe pairs were used to detect the standard using the method of "recombinase polymerase isothermal amplification + CRISPR / Cas12a detection + colloidal gold test paper result display". One end of the reporter is labeled with biotin (Biotin), and the other end is labeled with fluorescein isothiocyanate (FITC). The anti-FAM antibody is labeled with colloidal gold on the test strip, and the detection line on the nitrocellulose membrane (NC membrane) is coated with streptavidin that can bind to biotin. When Cas12a cuts the reporter, the free biotin can be colored at the detection line. The results showed that in the reaction system using crRNA1 or crRNA2, the sensitivity of the colloidal gold test strip to detect GBS can reach 100 copies / reaction ( Figure 5 ).

[0109] Example 5 Detection specificity experiment

[0110] In order to test the specificity of this system, we selected five common vaginal pathogens (E.Coli: Escherichia coli; Staphylococcus epidermidis: Staphylococcus epidermidis; Staphylococcus aureus: Staphylococcus aureus; Candida glabrata: Candida glabrata; HPV: Human papillomavirus) as controls, and used two reporter systems, fluorescence and colloidal gold test strips, and the results showed that only GBS pathogens had a signal response ( Figure 6 ), indicating that this method has good specificity for pathogen detection.

[0111] Example 6 Microbial culture results consistency comparison experiment (n=20)

[0112] We selected 20 clinical genital tract swab specimens (10 positive and 10 negative) that were identified by microbial culture and retested them using the GBS rapid detection method ("recombinase polymerase constant temperature amplification + CRISPR / Cas12a detection + colloidal gold test paper result display"). The consistency rate of the results of the two methods was 100% ( Figure 7 ).

[0113] The description of the above embodiments is only used to understand the method and core idea of ​​the present invention. It should be pointed out that, for those skilled in the art, several improvements and modifications can be made to the present invention without departing from the principle of the present invention, and these improvements and modifications will also fall within the scope of protection of the claims of the present invention.

Claims

1. A primer set for detecting group B streptococci, the sequence of the primer set comprising at least one of the following primer pairs: Primer pair SEQ ID NO: 1, 2, primer pair SEQ ID NO: 3, 4, primer pair SEQ ID NO: 5, 6, primer pair SEQ ID NO: 7, 8, primer pair SEQ ID NO: 9, 10, primer pair SEQ ID NO: 11, 12, primer pair SEQ ID NO: 13, 14.

2. A primer / probe set for detecting group B streptococci, the sequence of the primer / probe set comprising: Primer pair SEQ ID NO: 1, 2, primer pair SEQ ID NO: 3, 4, primer pair SEQ ID NO: 5, 6, primer pair SEQ ID NO: 7, 8, primer pair SEQ ID NO: 9, 10, primer pair SEQ ID NO: 11, 12, primer pair SEQ ID NO: 13, 14, probe sequence SEQ ID NO: 15-20, the primer pairs are used in combination with any one or more probe sequences.

3. The primer / probe set according to claim 2, wherein the sequence of the primer / probe set is at least one of the following primer / probe pairs: The primer / probe pair is primer pair SEQ ID NO: 1, 2, and probe SEQ ID NO: 15 and / or SEQ ID NO: 16; The primer / probe pair is primer pair SEQ ID NO: 3, 4, and probe SEQ ID NO: 15 and / or SEQ ID NO: 16; The primer / probe pair is primer pair SEQ ID NO: 5, 6, and probe SEQ ID NO: 15 and / or SEQ ID NO: 16; The primer / probe pair is primer pair SEQ ID NO: 7, 8, and probe SEQ ID NO: 17; The primer / probe pair is primer pair SEQ ID NO: 9, 10, and probe SEQ ID NO: 18; The primer / probe pair is primer pair SEQ ID NO: 11, 12, and probe SEQ ID NO: 19; The primer / probe pair is primer pair SEQ ID NO: 13, 14, and probe SEQ ID NO:

20.

4. The primer / probe set of claim 2, wherein the probe is detected by CRISPR / Cas12a; Preferably, the probe is labeled with a fluorescent dye; Preferably, the fluorescent dye label includes FAM, HEX, TAMRA, ROX, TET, JOE, Cy3, Cy5, VIC, Cy5.5, Texas Red, NED, FAM-dT, TAMRA-dT, CY3-dT, CY5-dT, HEX-dT, FITC; Preferably, the probe further comprises a quencher group; Preferably, the quenching group includes BHQ1, TAMRA, BHQ2, Rhodamine 6G, Rhodamine B, BHQ3, Dabcyl, Eclipse, MGB, BHQ1-dT, BHQ2-dT; Preferably, the probe is labeled with a modifying group; Preferably, the modification groups include amine groups, phosphate groups, biotin, biotin-TEG, and C3-spacer.

5. A system for detecting Group B Streptococcus, the system comprising: The primer / probe set according to any one of claims 2 to 4, the isothermal amplification reagent, the CRISPR / Cas12a enzyme digestion system and the colloidal gold immunochromatography test paper; The isothermal amplification reagents include amplification reagents used in LAMP, RCA, NEAR, NASBA, HDA, ERA, and RPA amplification techniques; Preferably, the CRISPR / Cas12a enzyme cleavage system includes Cas12a nuclease and Cas12a nuclease buffer; Preferably, the Cas12a is LbCas12a; Preferably, the anti-FAM antibody in the colloidal gold immunochromatographic test paper is labeled with colloidal gold, and the detection line on the nitrocellulose membrane is coated with streptavidin that can bind to biotin.

6. Use of the primer set of claim 1, the primer / probe set of any one of claims 2 to 4, and the system of claim 5 in the preparation of a product for detecting group B streptococci.

7. A method for detecting group B streptococci, the method comprising the step of using the system of claim 5 for detection, the specific steps comprising using a constant temperature amplification system and the primer set of claim 1 for amplification, the product is combined with the probe in the primer / probe set of any one of claims 2-4, and then cut using the CRISPR / Cas12a enzyme cutting system, and the product enters the colloidal gold immunochromatography test paper to display the result; Preferably, the method further comprises a method for releasing nucleic acid from group B streptococci, the steps of the nucleic acid release method being: using 5% Chelex 100 for nucleic acid release, the nucleic acid release conditions being: 12000 rpm, 1 minute, centrifuging at room temperature to collect bacteria, discarding the supernatant and adding 50 μl 5% Chelex 100, incubating at room temperature for 10 minutes, then 12000 rpm, 5 minutes, collecting the supernatant at room temperature, and the bacterial nucleic acid is released in the supernatant.

8. A kit for detecting group B streptococci, the kit comprising the primer set of claim 1, the primer / probe set of any one of claims 2 to 4, the system of claim 5, the reagents, reaction containers and / or step instructions used in the method of claim 7.

9. Use of the primer set of claim 1, the primer / probe set of any one of claims 2 to 4, the system of claim 5, and the method of claim 7 in preparing an automated device for detecting group B streptococci.

10. A device, comprising a processing module, wherein the processing module is used to implement the method of claim 7; Preferably, the system or device further comprises a storage module; Preferably, the storage module stores a computer program; Preferably, the computer program is used to program the steps of the method according to claim 7; Preferably, the computer program executes specific operations by a processing module.

Images